Содержание

способы применения и возможные побочные эффекты

Стоматит довольно распространённое заболевание, которое поражает слизистую оболочку рта. При этом заболевании появляется нежелательный дискомфорт и различные болевые ощущения при приёме пищи. Также могут возникнуть и масса других неприятных ощущений, в результате распространения заболевания полностью на всю полость слизистой рта, может подняться температура, появиться головные боли.

Причины

Если кто-то из близких вам людей заболел этим недугом, не стоит пугаться. Это заболевание не передаётся и не является заразным. К причинам вызывающим это заболевание можно отнести:

  • плохое питание, недостаточное употребление здоровой и полезной пищи и, как следствие, нехватка витаминов в организме;
  • авитаминоз, чаще всего является результатом длительного некачественного питания, когда организм не получает все необходимые ему микро- и макроэлементы;
  • курение;
  • анемия, характеризуется резким снижением гемоглобина в крови у человека, в результате у ослабленного организма снижается иммунитет и цепляются разные бактериальные инфекции;
  • различные болезнетворные микроорганизмы, являющиеся в первую очередь возбудителями инфекционных заболеваний.
    Также к причинам возникновения болезни можно отнести еще такие факторы, как обезвоживание организма, появившееся в результате долгой рвоты или поноса или некачественно установленные зубные протезы.

Лечение

Нужный курс лечения назначает врач после осмотра ротовой полости и определения тяжести заболевания. В зависимости от степени заболевания может быть назначено жаропонижающее, противовирусное или противомикробное средство. Как правило, если это не сильно запущенная или тяжёлая форма, то стоматит без лечения может пройти в течение недели.

В давние времена особой популярностью для лечения стоматита пользовался такой лекарственный препарат, как синька. Не стоит путать с синькой для бытовых назначений. Её применение на протяжении достаточно долгого времени очень хорошо, многие до сих пор держат в своих домашних аптечках это средство.

Синька — это лекарственный препарат, обладающий ярко выраженным антисептическим свойством. В фармакологии правильно название этого препарата звучит как – метиленовая синька от стоматита. Особенность этого препарата выражается в её способности вырабатывать нерастворимые соединения с белками инфекционного микроорганизма. На этом действии и основано применение медицинской синьки в лечении. При точечном нанесении на повреждённую кожу, лекарство не попадает в кровь. Метиленовую синьку заказывают и изготавливают в специальных рецептурных аптеках.

Метиленовую синьку рекомендуют к применению местного назначения пациентам, у которых наблюдаются повреждения кожного покрова или ожоги, а также при гнойно–воспалительных поражениях кожного покрова, в том числе и слизистых. Внутрь назначают принимать при заболеваниях мочеполовой системы, таких как уретрит или цистит. Также синьку

используют в качестве антидота при острых отравлениях кислотами и различными химическими веществами, а также при таком заболевании, как метгемоглобинемия, которое характеризуется повышенным значением метгемоглобина, приблизительно 1 % от общего содержания гемоглобина.

Синька против стоматита

Перед назначением лечения стоматита, врач на приёме должен осмотреть поражённую ротовую полость и установить диагноз. Затем, в зависимости от степени тяжести заболевания, назначается жаропонижающие, противовирусное, а затем обработка медицинской синькой. Количество раз обрабатывания препаратом язвочек зависит тоже от того, насколько тяжёлая стадия заболевания протекает у пациента. Взрослым обычно назначают обработку слизистой

до пятнадцати раз за сутки , детям можно меньше, но опять же количество обрабатывания назначает непосредственно доктор. Обрабатывать нужно аккуратно, для этого можно взять ватную палочку и точечно мазать каждую ранку.

Следуя предписанным инструкциям, ранки, как правило, начинают заживать на 3-4 день. Иногда врач может порекомендовать после проведённого курса лечения обработать слизистую рта лекарственными препаратами для более быстрого заживления.

Метиленовая синька выпускается в основном в виде порошка по 10 гр. в каждом саше; в виде 1% спиртового раствора в капсулах по 10-15 мл и в виде 1% раствора синьки в 25% растворе глюкозы тоже в ампулах по 20-25 мл.

Согласно инструкции, метиленовую синьку при различных кожных заболеваниях назначают применять наружно в виде смазываний 0,5-3% спиртовым раствором.

Для лечения, ограниченного нейродермита (заболевание, при котором у пациента наблюдается хронический зудящий дерматоз), назначают медицинскую синьку в качестве инъекций внутримышечно в виде 2,5 % раствора на 2% новокаина на протяжении четырех дней. Укол нужно делать не более одного раза в день.

При лечении мочеполовых болезней, синьку применяют в качестве промываний непосредственно уретры и мочевого пузыря , если у пациента как раз обострился воспалительный процесс, тогда ещё назначают внутрь принимать порошок по 0,1 гр. несколько раз в день.

Как любой лекарственный препарат, метиленовая синька имеет и противопоказания — это индивидуальная непереносимость одного из компонентов

, входящих в состав препарата, а также нельзя использовать для лечения заболеваний у маленьких детей, возраст которых не достиг 1 года.

Препарат можно назначать беременным, если ожидаемая польза от препарата для матери будет гораздо превышать риск, который возможен для малыша.

Синьку для белья в советские времена имела в запасе каждая уважающая себя хозяйка. Это порошок для быстрого усиления цвета белых или голубых постельных принадлежностей и одежды из натуральных тканей. В настоящее время существует множество порошков, в составе которых находятся отбеливатели, разнообразные цветные добавки для дополнительной насыщенности цвета. Но тем не менее синька остается самым доступным веществом, которое придает тканям не только свежесть и новизну, но и желаемый оттенок, если синее вещество используется в качестве красителя.

Синька – это чаще всего крахмал, состав которого совмещен с синей минеральной краской, в основном с ультрамарином, синими анилиновыми красками, индигокармином, парижской синью или берлинской лазурью. Синька хозяйственная выпускается в жидкой, пастообразной или порошкообразной форме и делится на два вида: растворимая и нерастворимая. Хорошо растворимые в воде красители гарантируют более равномерное тонирование, окрашивание и насыщенность. Нерастворимые – намного дешевле и подходят преимущественно для освежения белья из натуральных видов ткани. Купить синьку для ткани можно в любом магазине в отделе бытовой химии.

Применение синьки для белья

Более эффективного окрашивания и освежения натурального белья можно достичь благодаря инструкции по применению данного препарата. В описании обращайте внимание на то, при каких процедурах используется данное вещество. Отдельные виды синьки применяют во время стирки, некоторые разновидности – во время основного или последнего процесса полоскания или замачивания.

Неважно, собрались ли вы красить одежду или просто подсинить белье, главное – использовать материал на основе натуральных волокон хлопка или льна. Для того чтобы убедиться в качественности продукта и правильном его разведении, можно изначально поэкспериментировать на маленьком отрезке ткани.

Окрашивают синькой чаще всего классические оттенки джинсов, синее и голубое белье, реже белую ткань. Для того чтобы получить хороший результат тонирования, используют водорастворимую синьку для ополаскивания. Нерастворимая может дать нежелательные развод). Сухой или жидкий красящий пигмент перед использованием тщательно растворяют в воде до получения однородного цвета без сгустков. Для получения идеального раствора жидкость нередко процеживают сквозь несколько слоев марли.

Процесс окрашивания нужно производить только с чистым, выстиранным и выполосканным бельем. Если вещь достаточно большая, то ее лучше всего окрашивать в ванне. Емкость заполняют водой настолько, чтобы вода полностью покрывала материал. Красящий раствор выливают в ванну, при чем цветовая гамма регулируется как концентрацией раствора, так и объемом воды в сосуде. Белье опускают в ванну в расправленном виде без складок и загибов и выдерживают определенное количество времени. Хорошее закрепление цвета достигается после 1-2 часов, но в инструкции по применению можно найти более подробное описание соотношений видов ткани и времени тонировки.

После этого вещь споласкивают в обычной или смешанной с уксусом воде и развешивают в разглаженном состоянии для просушки.

Для устранения желтоватого оттенка на белом белье можно использовать слабый раствор синьки. Ультрамарин придает материалу слегка заметный голубоватый оттенок, который делает ткань визуально белее.

Ручной метод

При ручном способе белье подсинивают в момент последнего полоскания. Для этого подготавливают раствор красящего вещества в соотношении: 0,3 г порошка на 10 л воды либо 2/3 ч. л. пастообразного вещества или же 1-2 драже помещают в плотно связанный марлевый или тканевый мешочек и опускают в подготовленную для полоскания белья воду.

Мешочек с пигментом вымачивают до получения нужного однородного оттенка. Жидкую синьку растворяют из расчета 3-4 капли вещества на 1 л прохладной воды. После этого в воду опускают белье (желательно не все сразу, а по одному предмету) и выдерживают 3-5 секунд.

В стиральной машинке

Современные подсинивающие средства могут быть использованы при стирке и окрашивании материала и в машинке-автомате, если это указано на препарате. При механическом методе также необходимо проверить жидкий красящий раствор на присутствие ненужных сгустков, а порошкообразное вещество тщательно растворить в воде и извлечь лишние песчинки, которые могут привести к порче одежды. Синька добавляется в барабан или отсек для моющих растворов . Если в описании красящего средства рекомендуется добавление соли или соды, то следует прислушаться к данному совету. Это необходимо для фиксации цвета. В зависимости от плотности ткани необходимо выбрать вид стирки. Это может быть интенсивная стирка, обработка хлопка или стирка при 90-95 градусах Цельсия. После автоматической стирки ткань желательно поместить в емкость с уксусным раствором для закрепления цвета. Для того чтобы остальные вещи не окрасились при обработке в стиральной машине, технику прогоняют вхолостую, а в отсек для порошка добавляют немного отбеливателя. После манипуляций машинку протирают внутри насухо.

Важно

  1. Синька нужна тем, кто предпочитает упрощенные методы обработки разнообразным токсичным отбеливающим порошкам.
  2. Качественный препарат не окрашивает емкости и кожу рук.
  3. Синька не является стойким красящим веществом. Каждая последующая стирка будет вымывать цветовые пигменты, поэтому время от времени следует производить повторное подсинивание.
  4. Для получения хорошего результата каждая вещь должна обрабатываться отдельно.
  5. Поваренная соль, добавленная вместе с синькой при полоскании, поможет сохранить синий цвет дольше.
  6. Чтобы добиться желаемого результата, лучше сначала потренироваться на старых вещах.
  7. Всегда читайте инструкцию по применению красящего вещества, потому что в зависимости от производителя, формы выпуска и состава окрашивание может иметь разный результат.
  8. Синьку, в составе которой присутствует крахмал, после разведения следует проварить, а затем процедить.
  9. Не пытайтесь заменить синьку синим предметом одежды при стирке белого белья в машинке, так как это может привести к непредсказуемому результату.
  10. Хранить химическое средство следует в плотно закрытой емкости в недоступном для детей месте.

Синька – достаточно дешевое вещество, способное заменить множество дорогостоящих порошков с отбеливающим эффектом. Это также незаменимое средство для придания свежести белью и насыщенности голубой и синей одежде. Также такое простое, популярное вещество, как синька, может послужить источником вдохновения для создания необычных оттенков или узоров при окрашивании.

Синька от стоматита была популярна 10-20 лет назад. Поэтому, сейчас когда у ребенка обнаруживается стоматит, мамы и, особенно, бабушки часто вспоминают про синьку. Помогает ли синька от стоматита? Разберемся вместе.

Что такое синька?

Синька — народное название тиазинового красителя метиленового синего. Синька обладает свойствами антисептика. Для медицинского применения выпускается в виде 1% водного и 1% спиртового раствора и в порошке.

Способы применения

  • Спиртовой раствор применяется только наружно при пиодермии, ветрянке, герпесе, для обработки ран. На слизистые его наносить не рекомендуется.
  • 1 % водный раствор метиленового синего может применяться наружно (наносится на кожу) и местно (наносится на слизистые оболочки).
  • 1 % водный раствор на 25% растворе глюкозы для внутривенного введения — вводится внутривенно медленно при отравлениях сероводородом, угарным газом, цианидами, анилином, нитритами, как антидот.
  • 0,02% водный раствор может применяться для промывания уретры и мочевого пузыря.
  • Порошок метиленового синего принимают внутрь при циститах и уретритах.

Как видно из вышеизложенного, водный раствор синьки можно не только наносить на слизистые, но и даже принимать внутрь и вводить внутривенно, следовательно синька достаточно безопасна.

Синька обладает антисептическими свойствами, а значит убивает вредные микробы и в полости рта.

Поэтому, синьку можно применять при стоматите.

Как применять?

  • При стоматите можно применять исключительно 1% водный раствор метиленового синего. Спиртовой раствор синьки при стоматите не применяется, т. к. вызывает неприятные ощущения во рту, усиливает боль, может приводить к ожогам слизистой полости рта.
  • 1% водный раствор метиленового синего при стоматите нужно наносить на места поражения (язвочки, пузырьки и т. д.) на слизистой полости рта 5-6 раз в сутки после еды.
  • 1% водный раствор метиленового синего при стоматите разрешен к использованию для детей с момента рождения.

Почему синька от стоматита применяется редко?

Современные педиатры редко назначают синьку от стоматита, а раньше её использовали часто. Почему? Потому, что сейчас появились новые, более эффективные средства для лечения некоторых форм стоматита.

Синька при герпетическом стоматите

У детей самая частая разновидность — герпетический стоматит. Это вирусное заболевание. На вирус герпеса метиленовый синий никакого влияния не оказывает. Он лишь защищает поврежденную слизистую полости рта от вторичного инфицирования микробами. Поэтому, при герпетическом стоматите синьку можно использовать, только как вспомогательное средство в комбинации с противовирусными препаратами (виферон гель, ацикловир и др).

Синька при молочнице

Вторая по частоте форма стоматита у детей — грибковый стоматит или . На грибки метиленовый синий тоже заметного влияния не оказывает. При молочнице применяются раствор буры в глицерине и кандид-раствор для полости рта.

Синька при бактериальном стоматите

Метиленовый синий будет эффективен только при стоматите, вызванном микробами. Это может быть афтозный стоматит или стоматит, возникший после повреждения (ранения) слизистой полости рта. При микробном стоматите метиленовый синий даёт отличный эффект при частом 5-6 р/д нанесении на повреждения в полости рта.

Противопоказания

Синька от стоматита противопоказана тем, у кого имеется индивидуальная непереносимость или аллергия на синьку.

Недостатки 1% водного раствора метиленового синего
  • Метиленовый синий в водном растворе не всегда можно найти в аптеке. Его могут приготовить в рецептурном отделе по рецепту врача, но срок годности такого раствора 10-14 дней.
  • Если Вы вскрыли промышленно изготовленный 1% водный раствор метиленового синего, то срок его хранения после вскрытия флакона — 10-14 дней.
Можно ли приготовить 1% водный раствор синьки дома?

Можно. И даже — не сложно. 10 г порошка (содержимое 1 флакона с порошком) развести в 1 литре кипяченой или дистиллированной воды. Перемешать, процедить через 4-6 слоев марли. Раствор готов.

Из всего вышеизложенного можно сделать вывод — синька от стоматита может использоваться у детей с рождения, но только по назначению педиатра или стоматолога.
Желаю Вам здоровья!

Стоматит – это обобщающее название разного рода воспалений слизистой оболочки ротовой полости. Существует множество заболеваний, вызывающих воспалительные и гнойные процессы, многообразные по этиологии: вирусные, бактериальные, инфекционные, грибковые, другие. Каждое из них требует определенного медицинского комплексного метода лечения, поэтому способы избавления , исцеляющих от них, может назначать только доктор.

Проявление стоматита

Если у ребенка во рту появились прыщики, пузырьки, язвочки, красные пятнышки, срочно вызывайте педиатра, он определит природу заболевания. Запущенный стоматит излечить весьма сложно, при недостаточном воздействии возникают тяжелые осложнения.

Часто доктора назначают детям и взрослым для дезинфицирования слизистой оболочки рта водный 1% раствор метиленовый синий при стоматите афтозном, молочнице (грибковом заболевании), герпесном (вирусном поражении). Это практически безвредное для организма людей антисептическое средство моментально уничтожает патогенные микроорганизмы, подсушивает, заживляет, восстанавливает повреждения слизистой.

Нельзя намазывать раствор метиленовый синий до обследования врача, такое действие приведет к недостаточно ясной картине заболевания, последовательно, к неправильной диагностике, недостаточному дальнейшему лечению!

Что такое метиленовый синий

Водный раствор метиленового синего – это синтетическое антисептическое средство, с давних времен используемое наружно в стоматологии, для лечения стоматита, гингивита, кариеса, пародонтита.

Применяется также для лечения нарывов, ожоговых ран, трофических язв, от бактериальных, вирусных, грибковых плесневелых заболеваний. Кормящим мамам медицинская синька рекомендуется с целью обеззараживания болезнетворных бактерий, грибков при трещинах на сосках груди, что предохраняет младенцев от заболевания молочницей.

Введение внутрь — при диагностике, излечении заболеваний мочеполовой системы. Изредка применяется в лечении невралгии. Эффективно используется при отравлениях. В ветеринарии препарат служит лекарственным средством для оздоравливания слизистой рта, ушей и кожного покрова животных. Уничтожения грибковой инфекции аквариумных рыб.

1% раствор водный имеет выраженный синий цвет, прочно окрашивает поверхности кожи, тканей, другие. При использовании важно проверить индивидуальную переносимость. Не допускать попадания вещества в глаза. Выпускается в ампулах, флаконах, спиртового, водного препаратов и в виде порошков.

Полезные свойства

Фармакологическое действие щелочного препарата является губительным для многих болезнетворных микроорганизмов. Область применения антисептика достаточно широка, благодаря его обеззараживающим, восстанавливающим свойствам:

Использование метиленового синего в качестве антисептического средства обусловлено механизмом его воздействия: при попадании на поврежденные инфицированные клетки тела, синька от стоматита образовывает малорастворимое прочное соединение с чужеродным белком патогенного микроорганизма, вследствие чего вирус (бактерия, грибок) мгновенно погибает.

Применение при стоматите

Препарат не токсичен, поскольку не способен проникать в кровеносные сосуды, поэтому его назначают даже грудным малышам. Лечение стоматита синькой у детей проводит врач педиатр, по его рекомендации назначается дальнейшее обследование у другого специалиста.

Учимся красить синькой различные ткани. Хозяйственная синька – это смесь красителя и крахмала, которая продается в виде порошка или жидкости. Обычно синька используется для придания свежести постельному белью или белым рубашкам из хлопка и льна, а реже – для подкрашивания тканей.

Синька бывает двух видов: с растворимым и нерастворимым красителем. Нерастворимый краситель более дешевый, но годится только для освежения белья. Растворимый же можно применять для окрашивания тканей.

Выбор синьки

Для того чтобы красить синькой, необходимо изначально правильно выбрать материал. При этом нужно учесть, что:

  • Синька должна быть водорастворимой. В таком случае можно добиться равномерного окрашивания тканей – нерастворимая дает разводы при концентрированном применении.
  • Неважно, выбрать порошок или жидкость – и то, и другое перед применением следует развести в воде до полного растворения.
  • Синьки могут использоваться как во время стирки, так и во время полоскания белья. Для окрашивания лучше выбрать синьку, предназначенную для полоскания.
  • Синьку можно использовать для окрашивания белой ткани или освежения синих и голубых оттенков. Темные цвета она не изменит, а на других светлых тканях может получиться непредсказуемый результат. Чаще всего синькой подкрашиваются классические цвета джинсов.
  • Следует учесть, что синькой можно красить только натуральные ткани – синтетику она не окрашивает.

Окрашивание

Для окрашивания синькой необходимо:

  • Выстирать вещь, которую нужно подкрасить, и выполоскать от порошка до прозрачной воды.
  • Развести синьку согласно инструкции. В воде не должно быть сгустков красящего вещества, она должна быть равномерного цвета.
  • Заполнить ванну водой для окрашивания.
  • Разложить вещь в ванной. Важно, чтобы ткань была равномерно разложена (при скручивании, складках и изгибах возможно неравномерное окрашивание – именно поэтому рекомендуется красить в ванной, а не в тазу или другой емкости). Вода должна полностью покрывать окрашиваемую вещь. Для легкого подсинивания белья нужно несколько минут, для окраски – от 1 часа. Для джинсов обычно достаточно 2 часов.
  • Высушить ткань в расправленном состоянии – на складках и заломах может измениться цвет.

При окраске синькой необходимо помнить, что:

  • Качественная синька не окрашивает руки или ванну. Если от синьки остаются следы, можно испортить вещь во время подсинивания – ткань пойдет пятнами.
  • Синьку нельзя назвать стойким красителем – с каждой стиркой вещь будет выцветать, и процедуру необходимо часто повторять заново. Для получения стойкого эффекта следует воспользоваться специальными красками для тканей.

Лечение стоматита — детское отделение ОН Клиник Харьков Дворец Спорта

Стоматитом называется инфекция ротовой полости, при которой слизистая оболочка рта раздражается и воспаляется. Стоматит у ребенка проявляется по-разному, в зависимости от причин, вызвавших инфицирование.

Как выглядит стоматит у детей?

Стоматит у детей до года развивается из-за несовершенного и более слабого (по сравнению со взрослым) иммунитета, выраженного сосательного рефлекса и тонкой слизистой оболочки рта. В этом возрасте малыши «пробуют все на вкус», что и приводит к постоянным травмам и ссадинам во рту. В них начинает активно развиваться патогенная микрофлора, что и вызывает заболевание.

Стоматит на языке у ребенка старшего возраста часто возникает из-за неправильного прикуса и скученности зубов, при употреблении слишком горячей или холодной пищи. Также часто болезнь развивается на фоне ОРВИ и других респираторных инфекций, когда нарушена нормальная работа дыхательной системы и ослаблен иммунитет.

Признаки стоматита у детей зависят от патогена, вызывающего инфекцию.

В зависимости от этого врачи выделяют следующие виды болезни:

  • кандидозный стоматит у детей – развивается из-за грибка рода Candida. Для него характерно появление белого налета на языке, появляется неприятный запах изо рта. Инфекция причиняет сильное беспокойство, грудной ребенок может отказываться от еды;
  • герпетический стоматит у детей вызывает вирус герпеса. Основные симптомы: появление во рту мелких язвочек (могут быть заполнены жидкостью), общая слабость, головная боль. Возможны боли в мышцах;
  • афтозный – еще один специфический вид болезни, при котором на слизистой появляется одна язва, покрытая серовато-белым или желтоватым налетом. Вокруг повреждения обычно развивается ярко-красное воспаление.

Инфекция может возникнуть и по более специфичным причинам: например, как последствие лучевой или химиотерапии.

Чем опасен стоматит у детей?

Воспаление слизистой оболочки рта часто приводит к тому, что малыши отказываются от еды, теряют вес, становятся плаксивыми и капризными.

Но заболевание опасно еще и тем, что часто приводит к распространению воспаления на соседние ткани и вызывает:

Чтобы предотвратить развитие осложнений, необходимо подобрать правильное лечение стоматита у ребенка.

Как обезболить стоматит у детей?

Язвы причиняют больному сильный дискомфорт: он не может нормально пить и есть, постоянно чувствует жжение. Для снятия неприятных симптомов используются местные обеззараживающие средства и анестетики. Один из наиболее известных «рецептов»: синька при стоматите. Ее раствором либо локально обрабатывают язвочки, либо полощут рот.

Но самолечение опасно. Запущенная форма стоматита приводит к сильной лихорадке, может вызвать развитие тяжелых болезней. Оптимальное решение – это обращение к врачу, который диагностирует инфекцию, установит причину ее возникновения, расскажет, как быстро вылечить стоматит у ребенка.

Сколько длится стоматит у детей?

Скорость выздоровления зависит от причин, вызвавших болезнь, и общего состояния пациента. Лечение в домашних условиях может занимать больше месяца и при этом привести к серьезным осложнениям. Лечение стоматита у ребенка под контролем опытного педиатра длится не более 7-10 дней и позволяет добиться полного восстановления здоровья.

Какой врач лечит стоматит у детей?

Диагностировать и вылечить патологию может детский врач – педиатр. Для этого достаточно записаться на прием по контактному номеру телефона медицинского центра «ОН Клиник Харьков Дворец Спорта».

Стоматит. Лечение стоматита. Питание при стоматите

Стоматит – это воспаление слизистой оболочки ротовой полости. Причины возникновения стоматита могут быть как инфекции (ребенок взял что-то грязное в ротик) и травмы, аллергические реакции, так и снижении иммунитета после приема антибиотиков.

Грибковый стоматит, его ещё называют молочницей, чаще всего возникает из-за дрожжеподобных грибков рода Candida. Именно от него и появилось ещё одно название этого заболевания — кандидоз.

От молочницыстрадают чаще дети, так как слюна ребенка не содержит достаточного количества кислотных веществ для борьбы с бактериями, дисбактериоз (нарушение микрофлоры).

Так же, существует герпетический (афтозный) стоматит, который вызывается вирусом простого герпеса. Острым герпетическим стоматитом чаще болеют малыши от 6 месяцев до 3 лет, так как у совсем маленьких деток есть к нему антитела, полученные от мамы.

Заражение происходит от больного человека или носителя вируса контактным (через игрушки, соски, посуду) или воздушно-капельным путем. Начинается резко: малыш становится слабым, раздражительным, бледным, у него повышается температура, пропадает аппетит, заметно увеличиваются подчелюстные лимфатические узлы. На пике температуры усиливаются краснота и отечность слизистой ротика. Появляются пузырьки, которые очень быстро вскрываются, и на их месте образуются поверхностные эрозии, повышается слюноотделение, губки становятся сухими, потрескавшимися, покрываются корочками.

Бактериальный (травматический) стоматит возникает при попадании инфекции на травмированную слизистую. Например, если малыш, случайно оцарапал щечку об игрушку или веточку и в эту ранку попали бактерии, так же, если щечка ребенка постоянно травмируется неправильно выросшим зубом.

У ребенка повышается температура тела ребенка, на слизистой появляются пузырьки, содержащие гной или кровянистую жидкость, появляется гнилостный запах изо рта.

Аллергический стоматит не является отдельным заболеванием, а относится к общей аллергической реакции на какой-то из многочисленных аллергенов, и лечится вместе с основным заболеванием.

Проявляется, покраснением, белыми пятнами на слизистой, пузырьками или мелкоточечных кровоизлияний.

Какие стадии стоматита бывают и как их опознать?

  1. При начальной стадии заболевания стоматитом слизистая оболочка языка и десен краснее, становится блестящей и сухой. Если малыш начал капризничать, отказываться от еды и жаловаться на боль в ротике – проверьте внимательно рот ребенка. Обратите особое внимание под язычком, за губой.
  2. Если вовремя не распознать стоматит, то спустя 1-2 дня на язычке появляется белый налет, со временем он охватывает всю внутреннюю слизистую поверхность щек, языка, небо, а так же губы, часто в уголках рта появляются «заеды». Визуально он похож на капельки молока или крупинки творожка и легко снимается.
  3. Следующая стадия, когда на месте белого налета образуются язвочки и ранки.

    Лечение стоматита:

     
    • Частое полоскание рта раствором питьевой соды (1 чайная ложка на ½ стакана охлажденной кипяченой воды).
    • Можно применять 1% раствор метиленового синего или бриллиантового зеленого (это хорошо известные нам синька и зеленка), 20% раствор буры.
    • Обработать ротик малыша ватным тампоном, смоченным в отваре лекарственных трав, или сбрзнть слизистую растворами антисептиков (риванолом, фурацилином, марганцовкой, перекисью водорода) каждые 3-3,5 часа.
    • Промыть рот ребенка раствором фурацилина или 3%-ым раствором перекиси водорода.
    • Слизистую оболочку нужно обработать средствами, способствующими быстрому заживлению (масло шиповника, облепихи, персиковое, льняное масло, сок каланхоэ).
    • При стоматите средней тяжести, кроме полосканий,  необходимо применять противогрибковую мазь, противогрибковые препараты.
    • При тяжелой форме стоматита необходима госпитализация ребенка в стационар, где ему в полном объеме будет оказана вся необходимая помощь. Итак, если заглянув в рот, Вы обнаружили на деснах и слизистых покраснения или белый налет, язвочки или ранки – нужно бить тревогу, обратиться к педиатру и лечить стоматит.

      Стоматит – болезнь, которой быстро можно заразить всю семью. Поэтому, заболевшего малыша нужно изолировать – выделить свое полотенце, свою ложку, чашку и т.д.

      Регулярно проветривать комнату и проводить влажную уборку.
       

      Питание малыша, заразившегося стоматитом.


      Не заставляйте малыша покушать!  Его внутренние органы работают на выведение токсинов и ядов, поэтому организму лучше воздерживаться от дополнительной пищеварительной нагрузки.

      Давайте крохе больше питья (чуть-чуть теплого или комнатной температуры и лучше через трубочку или из поильничка).

      Для того чтобы слизистая быстрее заживала, она не должна травмироваться. Поэтому кормите малыша механически и термически щадящей пищей, т.е. желательно протертой, не слишком холодной и не горячей.

      Если проголодавшийся кроха попросит поесть, предложите ему теплый вегетарианский супчик,  нежирное молоко и молочные продукты, кисломолочные продукты, обогащенные полезными для восстановления баланса микроорганизмами, НО БЕЗ САХАРА! Так же, ребенку можно предложить яйца всмятку. Давайте больше овощных и фруктовых соков.

      Кормите ребенкаего 3-4 раза в день, в промежутках давайте только питье. Помните, что в результате слюнотечения, ребенок теряет много жидкости, и ему просто необходимо ее восполнять.

      После еды попросите ребенка прополоскать рот крепким чаем.

      ИСКЛЮЧИТЬ ИЗ РАЦИОНА сладкое, так как углеводы являются питательной средой для грибов.

      Не пугайтесь, если вашему ребенку поставили диагноз стоматит. Следуйте всем рекомендациям врача, правильно обрабатывайте ротик и  ваш ребенок очень скоро станет здоровым.
       

      Как лечить стоматит: рецепты народной медицины


      — При возникновении стоматита во время лечения необходимо полоскать полость рта несколько раз в день чистой горячей водой, особенно после еды.
      — Для уменьшения болезненности слизистой оболочки полость рта можно полоскать раствором перекиси водорода: 1 чайная ложка на 0,5 стакана воды.
      — Для лечения стоматита можно жевать листья алоэ, смазывать десны или полоскать рот свежим соком из листьев алоэ или каланхоэ.
      — В начальной стадии заболевания можно начинать лечение стоматита настойкой прополиса. Для этого больные места промыть перекисью водорода, просушить теплой струей воздуха, затем закапать пипеткой несколько капель 50%-ной настойки прополиса и вновь подсушить до образования тонкой прополисной пленки.
      — Для лечения стоматита можно взять 3 больших зубчика чеснока, растереть и соединить с 2 чайными ложечками йогурта. Смесь слегка подогреть и держать во рту, стараясь языком распределять ее по всем пораженным местам. Не обращая внимания на неизбежное жжение, повторить процедуру несколько раз в течение нескольких дней.
      — Разотрите в кашицу 3 зубчика чеснока, смешайте с 1 десертной ложкой простокваши. Получившуюся кашицу возьмите в рот и распределите языком на места, пораженные язвочками на деснах и мягких тканях полости рта. В первый момент такого лечения стоматита будет чувствоваться жжение, но необходимо потерпеть. Процедуры проводить 3 раза в день вплоть до полного выздоровления.
      — Для лечения стоматита к воспаленным деснам можно прикладывать сырой картофель, растертый в кашицу или нарезанный ломтиками.
      — Можно для лечения стоматита полоскать рот 3 раза в день свежеприготовленным морковным соком. Сок необходимо разбавить водой в соотношении 1:1.
      — Такие же полоскания для лечения стоматита можно делать и свежим капустным соком, разбавив его наполовину кипяченой водой. Полоскать рот.
       

      Рецепты народной медицины для лечения стоматита с лекарственными растениями


      — Приготовить настойку травы зверобоя на 40%-ном спирте или водке в соотношении 1:5. Применять как вяжущее и противовоспалительное средство для полоскания десен и полости рта: 30-40 капель на 0,5 стакана воды. Внутрь принимать по 40-50 капель.
      — Залить 1 столовую ложку травы синеголовника плосколистного 1 стаканом воды, кипятить 15 минут, настаивать 1 час, процедить. Полоскать рот.
      — Залить 15-20 г цветков ромашки аптечной 1 стаканом воды, настоять, в настой рекомендуется добавить 4 г борной кислоты. Применять как противовоспалительное и антисептическое средство для полоскания полости рта.
      — Залить 1 столовую ложку соцветий календулы лекарственной 1 стаканом кипятка, варить 10 минут, процедить. Применять как противовоспалительное, бактерицидное, регенерирующее средство для полоскания полости рта.
      — Залить 1 чайную ложку измельченного корневища лапчатки прямостоячей 1 стаканом воды, настаивать 5 часов, прокипятить. Полоскать рот при стоматитах.

Читайте также: стоматит и его лечение

Также интересно почитать: чем полоскать рот, чтобы вылечить опухшие десны

Лечение стоматита у детей: симптомы, виды и профилактика

Стоматологии, в которых возможно лечение стоматита у детей.

Содержание:

Если ребенок жалуется на боль в полости рта, отказывается от приемов пищи и часто капризничает, при этом отмечается повышение температуры его тела, а в процессе осмотра ротовой полости обнаруживаются небольшие язвы и покраснения на поверхности языка, неба, внутренней стороны губ и щек, то это означает, что у малыша стоматит. Данное заболевание у детей связано с вызвавшими его причинами, так как обычно воспаления во рту ребенка появляются из-за нескольких разновидностей возбудителей – бактерий, токсинов, аллергенов, вируса герпеса или грибов Candida albicans. До начала лечения данной болезни специалист обязательно должен диагностировать причину появления стоматита у ребенка.

Стоматит у ребенка

Причины стоматита у детей

Специалисты выделяют следующие причины появления стоматита у грудничков:

  • Нарушение правил гигиены. Возбудители заболевания, попавшие в детскую ротовую полость из-за грязных игрушек или невымытых рук, практически беспрепятственно проникают в слизистую оболочку и вызывают ее неблагоприятные перемены. Стоматит у детей до года нередко развивается в то время, когда малыш уже умеет ползать и способен дотянуться до множества предметов, которые ему хочется попробовать на вкус
  • Неправильная гигиена ротовой полости. Это касается как недостаточной гигиены, способствующей развитию патогенной микрофлоры, так и чрезмерной гигиены, сопровождающейся нанесением травм слизистой оболочке полости рта
  • Возраст ребенка. Во многих случаях стоматит возникает у детей 0,5-3 лет. Широкая распространенность стоматита у детей данного возраста связана с физиологической слабостью иммунной системы, так как у детей старше 6 месяцев исчезают приобретенные от мамы антитела, а выработка собственных еще не успевает полностью активизироваться
  • Наличие других заболеваний. Инфекционные и соматические недуги приводят к снижению местного иммунитета, что облегчит процесс развития стоматита у грудничков
  • Начало посещения детского сада. Для детей от 2 лет и старше поступление в детский садик является провоцирующим фактором появления стоматита. Это связано с тем, что малыш, ранее контактировавший лишь с близкими родственниками, попадает в большую группу других детей, каждый из которых является носителем чужеродной для него микрофлоры

Виды стоматита у детей

Кандидозный стоматит

Наиболее распространенная разновидность стоматита, способная возникнуть в течение первых дней после рождения ребенка – это кандидоз, или молочница, вызываемая грибком Candida albicans. Заражение ребенка может произойти в процессе рождения, если мама страдает от вагинального кандидоза. Кроме этого, ребенка можно заразить в процессе поцелуя или по причине некачественной гигиены грудного вскармливания. Кандидоз проявляется творожистым налетом белого или серого цвета на слизистых оболочках, отмечается сухость в полости рта, под налетом специалист отмечает воспаленный вид слизистой оболочки, но без кровоточивости. При остром протекании кандидоза не исключается подъем температуры тела ребенка до 38 °С.

Кандидозный стоматит

Среди растворов с антисептическим действием особенно рекомендуется препарат Мирамистин, способствующий регенерации пораженной слизистой оболочки и устраняющий большую часть болезнетворных микроорганизмов.

Герпетический стоматит

Данная разновидность стоматита развивается по причине вируса человеческого герпеса, который имеется, согласно данным ВОЗ, более чем у 90% всех жителей нашей планеты. Если у ребенка отмечается слабость иммунной системы, либо он недавно перенес ОРЗ или прочий недуг, проявляющийся повышением температуры тела, то получаемый извне или уже имеющийся вирус герпетического стоматита запускает патологические изменения в организме. Данная болезнь нередко протекает в легкой форме, но в большинстве случаев происходит ее обострение с повышением температуры до 40 °С. Кроме этого, специалисты отмечают увеличение лимфатических узлов и появление болезненной водянистой сыпи во рту и вокруг него.

Афтозный стоматит

Зачастую стоматит проявляется афтами — мелкими отдельными язвочками, имеющими кайму ярко-красного оттенка и сероватый налет. Такой стоматит называется афтозным. По словам специалистов, причиной афтозного стоматита могут быть различные вирусы, например, гриппа и ветряной оспы, а также некоторые микробные инфекции.

Бактериальный стоматит

Бактериальный стоматит возникает при наличии инфекционных недугов, например, ангины, дифтерии, ОРЗ, скарлатины, гингивита, стрептококковых и стафилококковых заражений.

Травматический стоматит

Травматический стоматит возникает по причине нанесения травм полости рта, например, при ожогах горячей пищей. Во рту, где очень влажно и постоянно присутствует неблагоприятная микрофлора, заживление может длиться долго. Помимо прочего, дети до года и старше часто ранятся, например, карандашами и игрушками, имеющими острые края и углы, груднички способны пораниться даже пустышкой. Травматический стоматит может возникнуть у ребенка на месте прикусывания языка или слизистой оболочки, либо при неправильной чистке зубов. При получении ребенком травмы полости рта специалисты рекомендуют посетить стоматолога.

Аллергический стоматит

Аллергический стоматит может возникнуть из-за приема ранее незнакомой пищи или лекарства, он проявляется высыпаниями и отечностью слизистой оболочки. Для лечения необходимо выявить и устранить аллерген, провести физиотерапию.

Ангулярный стоматит

Ангулярный стоматит проявляется наличием «заедов» — довольно болезненных покраснений и трещин в углах рта, но не всякий родитель знает, что это – проявление стоматита. Ангулярный стоматит может появляться при любых прочих видах этого заболевания, сопровождающихся высыпаниями в полости рта. Иногда появление «заедов» может быть симптомом анемии — недостатка железа, или гиповитаминоза витаминов группы B (особенно B6 и B12) или витамина A. Проблема решается приемом витаминов и смазыванием уголков рта их масляными растворами.

Рецидивирующий стоматит

Рецидивирующий стоматит у детей до года и старше возникает по разным причинам, но чаще всего – из-за сниженной устойчивости организма к патогенным процессам при наличии другого недуга, особенно в хронической форме. Нередко стоматит у детей возникает на фоне таких болезней, как колит, диабет, нарушение функций печени и желчевыводящих путей. Подобные стоматиты не провоцируют повышение температуры тела, но проявляются болезненностью и покраснением ротовой полости. Специалист проводит симптоматическое лечение в зависимости от имеющегося основного заболевания.

Опасность стоматита у ребенка

Во многих случаях стоматиты у детей до года и старше протекают в легких формах или формах средней тяжести, болезнь неплохо поддается лечению. Несмотря на это, при тяжелой форме данного заболевания или в случае отсутствия его правильного и своевременного лечения оно может быть опасно для здоровья малыша, особенно по причине таких симптомов, как повышенная температура тела и интоксикация. Кроме этого, болезненность стоматита может привести к отказу ребенка от питья и еды, что вскоре вызовет его истощение и обезвоживание.

Лечение стоматита у детей

После проведения врачебной диагностики стоматита у детей до года и старше специалист назначает высокоэффективные лекарственные препараты для борьбы с имеющейся разновидностью недуга. Родителям специалисты рекомендуют при первых подозрениях стоматита у ребенка повышать количество детского питья для орошения слизистой оболочки ротовой полости и выведения токсинов из организма. Для этого прекрасно подойдет чистая питьевая вода без газа, не слишком сладкий или кислый морс или компот, травяные чаи. В этот период стоит отказаться от питья ребенком концентрированных соков и напитков с газом во избежание появления раздражения слизистой оболочки.

После этого специалист начинает врачебные манипуляции с целью лечения стоматита у ребенка.

Обезболивание

Для начала необходимо выполнить обезболивание слизистых оболочек для обеспечения нормального приема ребенком пищи и напитков и общего снижения уровня стресса малыша. В качестве детского обезболивающего обычно применяются препараты холина салицилатом или лидокаином. Для данной цели подходят препараты для облегченного зубного прорезывания, к примеру, Камистад или Дентинокс-гель. Гелеобразные средства для детей предпочтительнее, ведь они почти мгновенно впитываются в ткани слизистой оболочки. Препараты с лидокаином в виде спрея не стоит применять для детей младше года – это может привести к бронхоспазму.

Препараты с лидокаином

Непосредственно лечение стоматита

После обезболивания можно приступать к лечению стоматита у ребенка. Сначала все высыпания и ранки необходимо обработать специальным препаратом в зависимости от вида заболевания. Противовирусные препараты применяются при герпетическом стоматите, антибиотические и антисептические препараты – при бактериальном стоматите, антифунгицидные препараты – при кандидозном стоматите. Обработке подлежат не только области поражения, но и зоны вокруг них – это остановит распространение патогенного процесса.

Важным условием устранения инфекции является тщательная и своевременная гигиена ротовой полости. Поверхность языка и зубы ребенка нужно очищать дважды в день, полоскания рта специалисты рекомендуют проводить после каждого приема пищи или питья. Маленьким детям гигиенические процедуры проводятся при помощи кусочка марли или силиконового напальчника.

Лечение аллергического стоматита

Если специалист выявил наличие аллергического стоматита, либо если присутствует сильная отечность ротовой полости, применяются препараты Фенистил, Супрастин, Димедрол.

Лечение вирусного стоматита

При герпетическом стоматите следует применять противовирусные средства в виде мазей с содержанием ацикловира – Герпевир, Виролекс, Ацик, Виферон, Оксолиновую мазь.

При рецидивах вирусного стоматита специалисты рекомендуют провести общее укрепление иммунной системы при помощи препаратов Иммунал, Интерферон, Виферон в свечах. Длительность лечения и дозировка препарата определяется доктором. Нередко медицинские специалисты рекомендуют использовать препарат Холисал в виде геля. Он прекрасно снимает отечность, воспаление, боль, жар и устраняет патогенную микрофлору. Препарат не содержит сахара, он не имеет вкуса и отличается легким ароматом аниса. Для лечения стоматита у ребенка до года и старше необходимо 2-3 раза в день после чистки зубов втирать в небо, десны и внутреннюю поверхность щек полоску гелеобразного препарата длиной не более 0,5 сантиметра.

Лечение кандидозного стоматита

При кандидозном стоматите врач использует противогрибковые препараты в виде мази, например, Клотримазол, Кандид, Кандизол, нередко назначаются полоскания с содой.

Это способствует созданию щелочной среды в ротовой полости, губительной для патогенной грибковой микрофлоры. Особенно эффективны процедуры с содой при лечении кандидозного стоматита у детей до года, ведь в этом возрасте большая часть препаратов противопоказана для приема. Для обработки полости рта необходимо развести чайную ложку соды в стакане теплой кипяченой воды, после чего следует кусочек марли обернуть вокруг чистого пальца и протирать небо, внутреннюю поверхность щек, десны и подъязычное пространство ребенка, периодически окуная палец в раствор. Процедуру следует выполнять после каждого приема пищи или питья малышом. Дети старшего возраста могут самостоятельно полоскать рот содовым раствором.

Лечение афтозного стоматита

При афтозном стоматите первоочередной задачей является обезболивание области поражения и ускоренное заживление афт. Для этого уже в течение долго времени применяется водный раствор синьки (метиленовый синий). Не рекомендуется применять для этого спиртовой раствор синьки, так как этиловый спирт в его составе вызовет отравление или ожог слизистой оболочки малыша.

Обработка ран производится с помощью пропитанной синькой ватной палочки 3-6 раз в день.

Лечение травматического стоматита

По словам специалистов, чаще всего травматический стоматит возникает у детей 1-2 лет. Данный вид недуга сопровождается бактериальной микрофлорой, поэтому потребуется применение ранозаживляющих и антисептических средств. Для детей до 2 лет применяется гель Холисал, Солкосерил, Актовегин, а также протирания полости рта раствором хлоргексидина или соды.

Лечение бактериального стоматита

Для лечения бактериального стоматита эффективны такие препараты, как Тантум Верде, Орасепт и Гексорал в виде спрея, Доктор Тайсс и Септолете в виде леденцов и многое другое. Леденцы специалисты не рекомендуют использовать для лечения детей до 6 лет из-за риска асфиксии, а спреи подходят для лечения бактериального стоматита у детей старше года. Эффективны также антисептические растворы для полоскания и гелеобразные препараты с метронидазолом.

Среди растворов с антисептическим действием особенно рекомендуется препарат Мирамистин, способствующий регенерации пораженной слизистой оболочки и устраняющий большую часть болезнетворных микроорганизмов. Флакон с распылителем удобен для лечения детей до года и старше. Для этого необходимо сделать 3 впрыскивания и полоскать ими рот в течение нескольких минут 3-4 раза в день. Детям до года обрабатывают рот марлей, пропитанной препаратом.

Народные средства для лечения стоматита у детей

Неудивительно, что для лечения стоматита у грудничков и детей постарше родители стремятся использовать проверенные поколениями целебные народные рецепты. Это безопасно, полезно и натурально, но стоит понимать, что организм малыша, особенно до года, еще не имеет устойчивой иммунной системы, а значит, что при невнимательном использовании продукты пчеловодства и травы могут привести к аллергии. Вместо меда специалисты рекомендуют использовать для лечения детей прополис – его раствор для маленьких детей и спиртовой настой для детей старшего возраста. Среди трав стоит обратить внимание на календулу, ромашку и шалфей. Их настои и отвары применяются для протираний и полосканий рта при стоматите.

Если ребенок уже говорит и воспринимает речь родителей и отличается сговорчивостью, его следует попросить подержать настой или раствор в полости рта в течение нескольких минут. Кроме прочего, в борьбе с детским стоматитом эффективен сок алоэ и капусты, масло облепихи. Ими можно проводить смазывания области поражения 3-4 раза в день до устранения проблемы.

Исследования ученых: Современные методы лечения стоматита у детей

Некоторыми специалистами активно применяется метод ультразвукового распыления жидких лекарственных препаратов в процессе лечения герпетического стоматита. Учеными была проведена клинико-иммунологическая оценка вероятности применения данного метода для проведения лечения на основе препаратов для укрепления иммунитета, например, Ларифана.

Суть метода ультразвукового распыления лекарственных составов в жидком виде состоит в образовании потока мелких аэрозольных частиц, которые при попадании на слизистую оболочку покрывают ее тончайшим слоем жидкости. Последующие частицы аэрозоля при попадании на первый слой препарата будут создавать акустическую волну, сферически распространяющуюся от зоны удара. Колебания частичек легко массируют ткани, улучшают обменные процессы и ускоряют проникновение действующих веществ через мембраны клеток.

Метод ультразвукового распыления медикаментов осуществлялся при помощи российского аппарата для ультразвукового распыления жидких сред. Такие препараты, как Ларифан и Интерферон, устойчивы к влиянию ультразвука и позволяют распылять их по данному методу. Это способствует эффективному лечению данного заболевания у детей в более короткие сроки.

В последние годы медицинская отрасль зарекомендовала применение гелий-неонового лазера в стоматологии и при лечении слизистой оболочки ротовой полости. Для лечения герпетического стоматита с рецидивами у детей применяются допущенные до медицинской практики лазерные аппараты, например, гелий-неоновый лазер с мощностью излучения 25 мегаватт и лазерный магнитооптический аппарат локального воздействия с мощностью излучения 40 мегаватт.

По словам специалистов, эффективность гелий-неонового лазера обеспечивается благодаря усиленному терапевтическому действию, следовательно, происходит более качественное проникновение лазерных лучей в биологические ткани, особенно если сравнивать данный лазер с излучением прочих участков ультрафиолетового и видимого спектральных диапазонов.

Отзывы в интернете: Как опытные родители советуют лечить стоматит у детей

Стоматит у ребенка – очень распространенное явление, и опытные мамы в интернете с радостью делятся методами избавления от этого заболевания.

В целом многие сходятся во мнении, что лучше всего при стоматите активно полоскать рот и смазывать язвочки. К сожалению, полоскания маленьким детям недоступны, так что нужно просто как можно чаще мазать рот антисептическими средствами. Родители на форумах советуют при первых признаках стоматита бежать к врачу, чтобы специалист прописал вам подходящие лекарства.

Многие дети во время стоматита отказываются есть. Посетительницы форумов советуют сильно не переживать по этому поводу, и перед едой смазывать ребенку рот чем-нибудь замораживающим, к примеру, Калгелем. Обычно после этого дети соглашаются поесть.

Кстати, многим деткам помогает такое весьма тривиальное средство, как пищевая сода – мамы советуют смачивать в ней ватные тампоны и прикладывать к язвочкам.

При правильно лечении, по словам посетительниц форумов, стоматит у малышей проходит за 2-3 дня.

Во многих случаях стоматиты у детей до года и старше протекают в легких формах или формах средней тяжести, болезнь неплохо поддается лечению. Несмотря на это, при тяжелой форме данного заболевания или в случае отсутствия его правильного и своевременного лечения оно может быть опасно для здоровья малыша.

Отзывы в интернете: Лучшие аптечные средства от стоматита для детей

Одними народными средствами стоматит не вылечить – это знает каждый родитель. Поэтому мы собрали топ самых популярных средство от детского стоматита из аптеки:

  • Безусловным фаворитом у пользовательниц интернет-форумов является раствор метиленового синего, или попросту синька. Ее родители мажут своим детям на язвочки, и это действительно отличное и эффективное средство
  • Очень хорошо помогает витамин А и облепиховое масло. Особенно его любят мамы, которые хотят лечить детей натуральными средствами
  • Неплохо помогает гель Холисал и полоскание рта Стоматидином
  • Хорошим средством является мазь Солкосерил – ее мамы используют и для совсем маленьких, и для детей постарше
  • Очень хорошо брызгать рот Гексоралом, особенно если ребенок не слишком дает смазывать язвочки

Профилактика стоматита у детей

Профилактика возникновения стоматита у детей до года и старше основывается на нескольких принципах, которые направлены на исключение любых причин неправильного ухода за малышом и факторов, которые могут быть спровоцированы общим состоянием детского организма:

  • Необходимо с рождения ребенка приучать его к тщательной и своевременной личной гигиене. Важно, чтобы сами родители ее соблюдали, показывая ребенку пример. Это касается как простого мытья рук после туалета и улицы, так и гигиены всего тела
  • Необходимо проводить тщательное кипячение детских пустышек и сосок до их использования
  • Необходимо внимательно следить за качеством пищи, потребляемой ребенком, и ее температурой
  • Необходимо продлить период лактации до окончания грудного возраста ребенка. Это делается потому, что дети, находящиеся на искусственном вскармливании, более подвержены появлению стоматита по причине наличия многих причин для этого

Родителям стоит помнить, что важно во избежание появления стоматита у ребенка исключить вероятность дефицита иммунитета или дисбактериоза. При возникновении подобных болезней специалисты рекомендуют немедленно показать малыша лечащему врачу.

Полезная статья?

Сохрани, чтобы не потерять!

Отказ от ответственности: Этот материал не предназначен для обеспечения диагностики, лечения или медицинских советов. Информация предоставлена только в информационных целях. Пожалуйста, проконсультируйтесь с врачом о любых медицинских и связанных со здоровьем диагнозах и методах лечения. Данная информация не должна рассматриваться в качестве замены консультации с врачом.

Читайте также

Нужна стоматология? Стоматологии Самары

Выберите метроРоссийскаяМосковскаяГагаринскаяСпортивнаяСоветскаяПобедаБезымянкаКировскаяЮнгородокАлабинская

Посмотрите стоматологии Самары с услугой «Лечение стоматита»

Возле метроРоссийскаяМосковскаяГагаринскаяСпортивнаяСоветскаяПобедаБезымянкаКировскаяЮнгородокАлабинская

Стоматит! Когда это кончится?, — 14756

Всем доброго здоровья!!! Хочу поделится со всеми нашей проблемой и заодно спросить совета.

У моей старшей доци приключился стоматит. Все началось вечером после садика с внезапной температуры 39,1. Я подумала горло, обычно оно дает такую температуру. Дала нурофен, стали применять ингалипт, фарингосепт, септефрил. Температура быстро упала до 36,6. Утром в субботу температура сново 39, нурофеном сбили, продолжаем ингалипт, фарингосепт, септефрил, полость рта смазываем маслом хлорофилипта, все еще думаем горло.

 

В воскресенье ребенок жалуется на десенки, губы потрескались, а еще привычка царапать губы во сне, температура 39, сбивается нурофеном и через 6-7 часов сново поднимается, отказываемся от еды, много пьем. Ночью спали плохо, а утром в понедельник жалобы, что болит язык, с температурой ситуация стабильна — 39. Еще показалось что опухло под нижними челюстями, мне уже «свинка» привиделась. Вызвали врача. Позвонили в сад сообщить что заболели, а там у одногруппника скарлатина. Я ели дождалась врача. Оказалось СТОМАТИТ! Назначили Стоматодин, синьку, септефрил, полоскания. Почитала спецвыпуск «Здоровье малыша» журнала Твой малыш — там пишут и о облепиховом масле. Второй день лечимся так: полоскание раствором вода+спиртовый хлорофилипт, смазываем полость рта, язык, десенки, губы синькой, через время губы смазываю облепиховым маслом, через время опять полощим, все смазываем облепиховым маслом, полощим стоматодином, через время мажу губы облепиховым маслом и т. д. Температура отпустила, нурофен приняли последний раз вчера вечером, на утро температуры нет, вот только к обеду поднялась 37 — буду наблюдать. Раны на губах стали кровоточить при движении, конечно синька спиртовая, сушит, все время мажу облепих. маслом. Может есть спец. мазь какая-то что б заживала кожа?  Ребенка жалко, капризная, ест плохо даже жиденькое, хорошо хоть пьет. Даю компот — смородина сырая перетертая с сахаром и такая же малина + лимон — развожу ели теплой кипяченой водой. Потом сразу же полошим рот, мажем губы.

Девочки поделитесь опытом, особенно беспокоят губки…

Спасибо!

Как лечить стоматит | Домовой

27 апреля 2016

Стоматиты — одни из самых распространенных заболеваний слизистой оболочки ротовой полости. Что здесь и к чему? Откуда эти неприятные ощущения и язвочки во рту? Что делать, чтобы быстро избавиться от недуга? Об этом мы расспросили специалиста — стоматолога высшей категории, кандидата медицинских наук, доцента Аллу Владимировну Марченко.

— Стоматит — это общее название любых воспалительных процессов на слизистой оболочке полости рта. Поэтому прежде, чем начинать лечение стоматита, следует определить причину его возникновения, возбудителя стоматита, иначе неадекватная терапия может быть или малоэффективной, или даже ухудшить состояние.

Поскольку возбудителями этого заболевания могут быть бактерии, вирусы и грибки, потому и борьба с ними проводится различными средствами. И без тщательного осмотра стоматолога, а возможно и без лабораторной диагностики на герпес, кандидоз и бактериальный посев мазка, невозможно определить, как и чем лечить стоматит.

— Каковы характерные проявления стоматита?

— По глубине поражения эпителия стоматит может быть катаральным, когда появляется только покраснение и отечность слизистой, могут возникать эрозии и пузырьки — афтозный стоматит, и язвы — язвенный стоматит. 

Для всех видов характерно жжение, выраженная болезненность в месте локализации стоматита, боль бывает настолько сильной, что ребенок или взрослый буквально не может принимать пищу, отказывается от нее.  

— Что провоцирует развитие стоматита?

— Причин появления стоматита существует много. Самая банальная — это травмирование полости рта — термическое или химическое, а также прикусы, царапины твердой пищей. Размножение различных бактерий, вируса герпеса или грибковых агентов во рту, которые активизируются при ослаблении защитных сил организма. Использование зубных паст с лауриловым сульфатом натрия, который высушивает слизистую и провоцирует вялотекущие, хронические стоматиты. Нарушение правил личной гигиены, особенно у детей. 

— Какие лечебные средства можно посоветовать при стоматите? 

— Чтобы снизить болезненность при стоматите можно использовать различные растворы антисептиков и проводить полоскание или аппликации. Особенно это важно при язвенном стоматите, это поможет не допустить отказа от пищи и сохранит аппетит. Ранки можно смазывать Лидокаином, Бензокаином, Тримекаином, также хорошо помогают комбинированные препараты с обезболивающим и антисептическим свойством — Лидокаин Асепт, Камистад, Инстиллагель, Пародонтоцид.

 При язвенном стоматите быстрому заживлению ранок мешает бактериальный налет, поэтому если не очищать стоматит от этого слоя, он приобретает рецидивирующий, длительный и вялотекущий характер. Эффективными средствами для очищения язв от бактериального налета являются различные моющие пасты, в состав которых входят перекись водорода или перекись карбамида, хлоргексидин биглюконат.

— А какие народные средства лечения стоматита можно использовать в домашних условиях?

— Прежде всего, полоскание рта. При простом катаральном бактериальном стоматите следует достаточно часто полоскать рот, особенно после приема пищи. Полоскать рот можно крепким чаем или кипяченой теплой водой.

 Много рецептов народной медицины содержат капустный и морковный соки, как основу для многих процедур. Так, можно полоскать рот этими соками, смешанными 1:1 с перекисью водорода. Поскольку перекись — очень агрессивная среда, то соки смягчают ее действие, витаминизируют и помогают быстрой эпителизации тканей.  

Особое восстановительное свойство имеет картофельный сок, народная медицина рекомендует прикладывать кашицу из сырого очищенного картофеля к язвам. Также среди народных средств есть такой рецепт для лечения стоматита в домашних условиях: использовать для полоскания смесь тертого чеснока, кислого молока и настойки прополиса.

 Ребенку полоскание рта лучше проводить с помощью груши, спринцовки, наклонив малыша вниз головой, делать орошение, чтобы он не глотал жидкость. Очень эффективно лечение стоматита соком каланхоэ или алоэ. Вещества, входящие в состав этих лечебных растений, и обезболивают, и покрывают защитной пленкой эрозированный участок плоскости во рту. Некоторые предпочитают жевать листья алоэ и каланхоэ.

 Лекарственные травы и растения в народной медицине имеют большое значение, при условии, что на них нет аллергии. Для лечения стоматита самыми действенными лечебными травами являются ромашка, зверобой, календула, синеголовник плосколистный, лапчатка прямостоячая, кора дуба.

Чтобы облегчить приготовление настоев, можно использовать готовые сборы, специально подобранные для полости рта — Стоматофит (мята, кора дуба, ромашка, арника, шалфей), Ротокан (ромашка, календула, тысячелистник), Ингафитол или Евкаром (ромашка и шалфей).

— Требует ли специфического лечения герпетический стоматит?

— Когда возбудителем стоматита является вирус, эффективным станет использование противовирусных мазей. Однако их следует использовать только по назначению врача, когда установлен точный диагноз — вирусный стоматит, герпетический стоматит. Применяют в этих случаях теброфеновую, интерфероновую и оксолиновую мази, а также другие противовирусные мази от стоматита: Бонафтон, Ацикловир, Виру-мерц-серол. 

При вирусной природе стоматита следует проводить комплексное лечение, поскольку его появление указывает на снижение иммунитета. Детям в таких случаях врач может назначить рассасывающие таблетки Имудон, мазь или свечи Виферон, различные препараты на основе Интерферона. Антибактериальный, противовирусный и обезболивающий эффект имеет гель Холисал, в его состав входит цеталкония хлорид и холина салицилат. При значительном отеке, курении также показана антигистаминная терапия, лучше всего использовать препараты 3 поколения, которые имеют пролонгированное действие и не вызывают сильную сонливость — Цетрин, Зиртек, Зодак. Для детей эти средства используются в каплях или сиропе только с 2 лет.

— Часто молодые мамы сталкиваются с грибковым стоматитом у младенцев… Как тут быть?

— Грибковый стоматит действительно чаще всего бывает у младенцев, поэтому главным условием избавления от молочницы полости рта является обработка рта после каждого кормления, при этом ватку, а лучше бинтик, смачивают в 2-процентном растворе соды. Также врач может рекомендовать различные противогрибковые мази — Кандид, Клотримазол.

В случае бактериального стоматита, который поражает нас независимо от возраста, для лечения используется большое количество различных спреев, удобных в применении, это антибактериальные, антисептические средства — Тантум Верде, Гексорал спрей, Орасепт, Доктор Тайсс Шалфей, Прополис спрей, Ингалипт и другие. Также эти препараты выпускаются и в виде рассасывающих таблеток и леденцов. Можно использовать и масляный раствор Хлорфиллипта или метиленовый синий краситель, который называют «синькой». Что же касается профилактики стоматита любой этиологии, то тут главными являются — здоровый образ жизни, соблюдение личной гигиены, уход за полостью рта.



 

инструкция к препарату, описание препарата, аналоги, отзывы

Оксолиновая мазь предназначена для лечения вирусных заболеваний слизистой оболочки носа и глаз, чешуйчатого и мокнущего лишая. А также этот препарат используется при воспалении кожного покрова любой этиологии. Неплохо зарекомендовала себя оксолиновая мазь при стоматите у детей и взрослых. Благодаря уникальному составу это средство может эффективно противостоять инфекции и не допустить появление гриппа в период эпидемии.

Состав и свойства

В основе этого средства содержится активное вещество оксолин. Оно заставляет организм вырабатывать редукторы интерферона, который, в свою очередь, и противостоит заболеванию. Однако, по мнению некоторых ученых, такое действие оксолина приводит к истощению организма и ослаблению иммунитета. Поэтому препараты с ним запрещены во многих странах мира. Своим действием это средство напоминает антибиотик и также вызывает привыкание.

Для чего используется

У этой мази широкий спектр применения. Ее используют в следующих случаях:

  • Практически все вирусные заболевания кожи и слизистой можно вылечить с помощью этой мази.
  • Она справляется с любым воспалением на поверхности кожи и в течение непродолжительного времени избавляет от него.
  • Мазь используют при лишае. Курс лечения иногда длится на протяжении двух месяцев, но всегда заканчивается полным выздоровлением.
  • С ее помощью выводят бородавки и папилломы. Так как эти наросты имеют грибковое и вирусное происхождение, Оксолиновая мазь отлично с ними справляется.
  • Очень хорошо помогает оксолиновая мазь при стоматите.

С ее помощью избавляются от острого вирусного ринита и заболеваний глаз. Словом, любая болезнь вирусного характера не в силах устоять перед этой мазью.

Как использовать

Применяют ее исключительно наружно и не более 60 дней. В зависимости от характера заболевания, Оксолиновую мазь следует использовать следующим образом:

  • При лечении глаз мазью смазывают нижнее и верхнее веко не более трех раз в сутки.
  • В случае сложных заболеваний, вызванных вирусной инфекцией, лечение может продолжаться на протяжении 50-60 дней, при ежедневном двухразовом использовании препарата.
  • Отлично зарекомендовало себя это средства при профилактике гриппа. Перед выходом на улицу врачи рекомендуют смазывать ею нос. Если вместе с мазью принимать витамин С, то любое простудное заболевание обойдет стороной.

Нежелательно использовать это средство чаще трех раз в сутки. А в качестве профилактического средства дозировка уменьшается до двух раз в день. Для укрепления иммунитета пьют горячий чай из лекарственных трав с медом и едят как можно больше продуктов, содержащих витамин С.

Побочные эффекты

Попадая на небольшие ранки или раздраженную слизистую, оксолиновая мазь может вызвать легкое покалывание, которое быстро проходит. У препарата отсутствует вкус и запах, поэтому его использование довольно комфортно. Нельзя проглатывать большое количество мази, это вызывает дискомфорт в желудке и легкое отравление. Так как досконально неизвестно влияние оксолина на развитие плода, то его использование в первом и последнем триместре не желательно.

Условия возникновения стоматита

Это заболевание представляет собой воспаление слизистой оболочки ротовой полости. Возникает эта болезнь по следующим причинам:

  • Инфекция, занесенная немытыми овощами или фруктами.
  • Повреждение слизистой рта в кабинете стоматолога.
  • При снижении иммунитета, патогенная микрофлора, которая постоянно обитает в полости рта, начинает размножаться и проявляться в виде стоматита.
  • Отсутствие гигиены или ее чрезмерная частота. При слишком частой чистке зубов также нарушается микрофлора полости рта и появляется стоматит.
  • Курение и прием алкоголя часто провоцируют это заболевание.
  • Некоторые лекарственные препараты заметно уменьшают слюноотделение, что, в свою очередь, неблагоприятно сказывается на здоровье слизистой рта.

Стоматит бывает бактериальным, вирусным, химическим и грибковым. С каждым из перечисленных видов отлично справляется мазь с оксолином.

Лечение стоматита

Для диагностики этого заболевания используют мазок или соскоб со слизистой рта. Для лечения стоматита используют мази или гели. Если боль не дает покоя, то можно выпить таблетку «Парацетамола». Он отлично обезболивает и снимает воспаление. В качестве местной терапии используется крем с лидокаином. А самым эффективным препаратом является оксолиновая мазь. Благодаря своим свойствам это средство отлично обеззараживает полость рта, а также быстро и эффективно воздействует на воспалительный процесс.

Признаки заболевания

Эту болезнь можно узнать по некоторым характерным признакам. Она не всегда протекает остро. Это может быть вялотекущий процесс без повышенной температура тела. Для него характерны следующие симптомы:

  • Вначале происходит легкое покраснение, которое через сутки переходит в болезненный отек.
  • В дальнейшем рана превращается в язву со всеми вытекающими последствиями.
  • Язва выделяет кровь или гной, из-за которых появляется неприятный запах изо рта.
  • Стоматит может быть представлен как одной крупной язвой, так и сыпью мелких. Самые распространенные места их обитания — щеки, губы и миндалины.

Дети подвержены аллергическому или афтозному стоматиту, а у взрослых это заболевание чаще всего носит грибковых характер. Применение при стоматите оксолиновой мази довольно комфортно.

Правила применения

Мазь наносят на на щеки ребенка, предварительно смазывая их облепиховым маслом. Для обеззараживания слизистой, полощут теплой водой. Только после этого раны от стоматита мажем оксолиновой мазью. Для этого небольшое количество выдавливают на палец и аккуратно проводят им по больному месту, захватывая области вокруг язвы. Такую процедуру следует повторять не более трех раз в день на протяжении одной недели.

Если стоматит появился у совсем маленьких детей до года, оксолиновую мазь используют исключительно в разбавленном виде. В качестве добавок можно использовать вазелин. Соотношение мази оксолина и вазелина должна составлять 2:1.

Аналоги препарата

У этого средства имеется несколько аналогов. Заменить оксолиновую мазь можно следующими препаратами:

  • «Виферон» представляет собой гель серого оттенка. У нее отличный состав, который справляется со многими заболеваниями. Ее используют, как и Оксолиновую мазь при стоматите у детей. «Виферон» стараются применять нечасто. Достаточно одного или двух раз в сутки.
  • Еще одна мазь, состоящая из натуральных компонентов — «Доктор Мом». При насморке смазывают крылья носа или слизистую оболочку. Средство состоит из эфирных масел и рекомендуется к использованию детям, начиная с трехлетнего возраста.
  • «Эваменол» содержит в своем составе левоментол и обладает регенерирующим и противовоспалительным свойством. Она отлично зарекомендовала себя при лечении острого насморка. Из побочных эффектов выделяют чувство печения, иногда возникающее при передозировке препарата. Инструкции оксолиновой мази при стоматите и «Эваменола» идентичны.
  • Вьетнамский бальзам «Звездочка». В его составе присутствуют исключительно растительные компоненты: эфирное масло эвкалипта, корицы, гвоздики, камфорное масло и так далее. Как и оксолиновую мазь, бальзам можно использовать при насморке, смазывая слизистую оболочку носа. При наружном стоматите у детей оксолиновая мазь и «Звездочка» используются одинаково. При герпесе ею смазывают губы несколько раз в сутки.

Оксолиновая мазь хранится в течении трех лет. Температура хранения не должна превышать 30 градусов. А лучшим местом для этого препарата является холодильник.

Отзывы пользователей

В своих отзывах пользователи часто рекомендуют эту мазь для лечения как детей, так и взрослых. В интернете сложно найти отрицательный отзыв об этом средстве. Своей ценой она привлекает покупателей, которые очень часто остаются довольны полученным результатом. Всем известно, что любое заболевание легче предупредить чем вылечить. Если ею смазывать нос, то эффекта хватает до конца дня. Из побочных проявлений отмечают легкое пощипывание и изменение цвета слизистой.

Отлично зарекомендовало себя это средство при лечении герпеса. Им просто смазывают язвы на губах на протяжении дня до полного выздоровления. Иногда требуется нанесение мази полностью на всю поверхность губ. Оксолиновая мазь имеет жирный состав и отлично увлажняет кожу. Она немного изменяет цвет и выглядит неопрятно на герпесных язвах. Поэтому сверху рекомендуют наклеивать специальный пластырь, совпадающий с оттенком губ.

Очень комфортно лечить этой мазью стоматит. В своих отзывах оксолиновую мазь при стоматите у детей советуют использовать с первых дней заболевания. Перед процедурой полощут рот, после чего наносят небольшой слой средства. По словам пользователей, иногда герпес пропадает уже через 2 дня после начала лечения. На следующий день он заметно подсыхает, а к вечеру язва начинает затягиваться. Чтобы внешне рана выглядела как можно опрятнее, ее можно спрятать под герпесным пластырем. Он имеет легкий розоватый оттенок и отлично маскирует все недостатки на поверхности кожи.Применение оксолиновой мази при стоматите у детей очень комфортно.

Популярность этого средства настолько велика, что в некоторых детских садах воспитатели просят родителей приносить оксолиновую мазь в зимнее время года. Воспитатели сами смазывают носики детям с помощью ватной палочки для профилактики гриппа. По словам родителей, в таких группах практически отсутствует заболеваемость простудой и гриппом. Это намного лучше, чем прием сомнительных витаминных комплексов или биодобавок.

Словом, эффект от этого средства просто впечатляет. Оксолиновая мазь при стоматите у детей — одно из самых доступных и эффективных препаратов среди всех известных аналогов подобного действия на сегодняшний день.

Желание Уолтера — Гуманное общество Орегона

Обновление
: Уолтера усыновили всего через несколько дней после того, как его история была опубликована в социальных сетях.

Наши последователи — настоящие герои.

Энни специально хотела усыновить кошку, которой было труднее найти дом. Когда 20 февраля вошла Энни, они спокойно и тихо сидели с Уолтером, просто позволяя ему быть, мягко гладя его по голове и нежно заверяя его, что лучшие дни впереди. «У меня есть действительно красивое окно, в которое можно сесть и выглянуть.”

Когда оформление документов было завершено, Энни взбудоражилась. «Давай отвезем тебя домой, пока я не заплакал»

Подробнее о путешествии Уолтера в дом навеки читайте ниже.

________________________

Как потерянный кот получил лечение, необходимое ему от болезненной болезни

В одиночестве, страдая и блуждая по улицам Ла-Гранд, бедняга Уолтер нуждался в чуде. Его удача начала меняться, когда в сентябре о нем начал заботиться добрый самаритянин. Поход к ветеринару обнаружил ужасные новости.Уолтер страдал от болезненного стоматологического заболевания под названием стоматит. Это состояние трудно поддается лечению и требует многократных и зачастую дорогостоящих стоматологических процедур. Итак, в январе Уолтер оказался в Blue Mountain Humane в Ла-Гранде. Добрый самаритянин, который ухаживал за ним, больше не мог позволить себе его тяжелое заболевание.

Программа «Второй шанс»

OHS часто работает с Blue Mountain Humane, поэтому, когда поступил звонок о помощи, медицинская бригада OHS рассмотрела дело Уолтера, и его планировали доставить в Портленд.

Когда приехал Уолтер, было ясно, что его стоматит тяжелый. Ему уже удалили 17 зубов, и было установлено, что единственный способ облегчить его боль — это удалить оставшиеся 13 зубов. Его выздоровление было трудным, но после нескольких дней любви и заботы в Медицинском центре OHS он начал поворачивать за угол. Команда уговорила его поесть и предоставила ему особые условия, чтобы он чувствовал себя комфортно. Затем он провел несколько недель в приемной семье, в то время как его рот продолжал заживать после челюстно-лицевой хирургии.

Теперь Уолтер ждет следующего счастливого случая. После всех операций он готов к следующей счастливой и здоровой главе своей жизни. Ваш любящий дом, которого он ждет?

ОБНОВЛЕНИЕ
: У УОЛТЕРА НАЗНАЧЕНИЕ ADOPTON НАЗНАЧЕНО

У вас есть вопросы по поводу стоматита? Доктор Стив Кочис, главный врач OHS, отвечает на часто задаваемые вопросы о болезни ниже:

Что такое стоматит?

Стоматит — болезненное хроническое заболевание, которое вызывает сильное воспаление тканей во рту, в результате чего десны, края губ, мягкое небо и задняя часть ротовой полости становятся ярко-красными и раздраженными.Ткань становится более нежной и легко кровоточит. Кошки могут быть хитрыми и хорошо скрывать вещи от нас, но эти кошки часто испытывают трудности с едой, могут похудеть, ласкают рот или чрезмерно пускают слюни. Они могут казаться более неряшливыми, чем обычно, что может происходить из-за плохого питания и плохого ухода за шерстью

Стоматит поражает только кошек или собак?

Стоматит может поражать кошек и собак. Однако у собак это, по-видимому, ограничено определенными породами.

Как кошки заболевают стоматитом?

Хотя стоматит встречается довольно часто, его причина остается в значительной степени неизвестной. Считается, что это состояние вызвано чрезмерной реакцией иммунной системы кошки на нормальные бактерии зубного налета, что приводит к тяжелой воспалительной реакции. Состояние также может ухудшиться, если присутствуют другие формы стоматологических заболеваний. Дополнительные тесты могут быть выполнены, чтобы увидеть, есть ли какие-либо другие сопутствующие заболевания или способствующие факторы. В случае Уолтера он дал отрицательный результат на FeLV / FIV.

Что такое лечение?

Специального лечения стоматита не существует. Поскольку это воспаление часто вызвано чрезмерной реакцией на бактерии зубного налета на зубах, распространенный способ справиться с этим состоянием — удалить все (или почти все) зубы кошки. В настоящее время это единственное решение, которое, по-видимому, обеспечивает долгосрочное облегчение боли и воспаления. Было показано, что удаление зубов излечивает стоматит у большинства кошек, но некоторым все же может потребоваться длительная медицинская помощь, если воспаление не проходит.Медицинское лечение часто состоит из приема противовоспалительных препаратов, антибиотиков и ежедневной чистки полости рта.

Нужно ли кормить кошек, больных стоматитом, специальной диетой?

Поскольку кошкам с крайними случаями стоматита, таким как Уолтер, удалили все зубы, рекомендуется диета, состоящая из мягкой пищи.

Что еще нужно знать потенциальному усыновителю о том, чтобы усыновить питомца со стоматитом?

Домашние животные, страдающие стоматитом, могут иметь другие проблемы с иммунитетом, поэтому усыновители должны быть в курсе любых изменений в здоровье своего питомца или новых симптомов.Даже у домашнего животного без зубов десны могут воспаляться, и их следует контролировать и лечить по мере необходимости.

Ваш подарок спасает жизни. Пожалуйста, подарите сегодня и помогите нуждающемуся питомцу.

Клиника для животных Troy & Heights — Гингивит и стоматит

Гингивит и стоматитDVM-G4L4XY2019-10-15T12: 42: 20 + 00: 00

Гингивостоматит

Обычно встречаются два заболевания полости рта у кошек:

  1. Гингивит : воспаление десен
  2. Стоматит : воспаление всего рта, включая язык, внутренние губы, дно и нёбо

Бактерии, скопившиеся на зубах, могут попасть в кровоток вашего питомца и заразить другие органы.Если не лечить, это приведет к потере зубов.

Гингивостоматит поддается лечению и профилактике. Регулярный стоматологический уход дома и у ветеринара необходим для хорошего здоровья зубов вашего питомца.

ПРИЧИНЫ:

Доказанных причин нет, но есть некоторые теории:

  • Заболевания, подавляющие иммунную систему
  • Плохая гигиена полости рта
  • Вирус лейкемии кошек (FeLV)
  • Вирус иммунодефицита кошек (FIV)
  • Нарушения обмена веществ
  • Почечная недостаточность
  • Диабет
  • Бактериальные или грибковые инфекции
  • Травма лица или рта
  • Рак
  • Химиотерапия или лучевая терапия

ЗНАКИ:

Очевидные признаки того, что у вашей кошки гингивит и стоматит:

  • Сильное воспаление в месте соприкосновения зубов с деснами
  • Сильная боль: может вызвать изменение поведения, включая раздражительность, агрессивность, депрессию
  • Чрезмерное слюнотечение
  • Затруднение при еде и похудание
  • Неприятный запах изо рта
  • Неадекватный уход
  • Бугристые десны, легко кровоточащие

ДИАГНОСТИКА:

Чтобы правильно диагностировать у вашей кошки гингивит и стоматит, ваш ветеринар может выполнить следующее:

  • Осмотр: зубы и десны
  • Рентгеновские снимки зубов
  • Анализы крови и мочи: для выявления основных заболеваний

ЛЕЧЕНИЕ:

Большинство ветеринаров порекомендуют кошкам с гингивостоматитом следующие методы лечения:

  • Чистка зубов: с помощью инструментов для анестезии, ультразвукового удаления зубного камня и полировки
  • Стоматологическая хирургия: удаление сильно пораженных зубов
  • Антибиотики пероральные

Самостоятельно удалить зубной налет и зубной камень невозможно, потому что:

  • Зубной камень может оставаться ниже линии десен и продолжать вызывать проблемы, и вы можете удалить зубной камень только над линией десен
  • Чистить внутренние части зубов, пока ваш питомец в сознании, небезопасно.
  • Использование стоматологических инструментов может поцарапать зубы вашего питомца, что приведет к дальнейшим повреждениям.Ваш ветеринар отполировает зубы вашего питомца, чтобы предотвратить это.

ПРОФИЛАКТИКА:

  • Ежегодные устные экзамены
  • Чистите зубы питомцу каждый день зубной пастой, предназначенной только для домашних животных! Зубная паста для человека содержит токсичные для домашних животных ингредиенты. Очень важно чистить зубы вашего питомца ежедневно, так как зубной налет и зубной камень могут начать накапливаться всего через шесть часов после чистки зубов. Ваш ветеринар проинструктирует вас, как чистить зубы питомцу.
  • Ваш ветеринар может разработать рецептурную стоматологическую диету для удаления зубного налета, когда ваш питомец грызет
  • В питьевую воду можно добавлять гели и жидкие продукты
  • Дайте вашему питомцу специальные игрушки для жевания, которые уменьшают образование зубного камня

ПРОГНОЗ:

Прогноз зависит от основной причины. В простых случаях прогноз отличный при профессиональной чистке зубов и домашнем уходе.

Микробиом полости рта, связанный с протезом, в здоровье и стоматите

ВВЕДЕНИЕ

Как здоровье полости рта, так и микробные обитатели полости рта, в частности, все чаще признаются за их роль в общем здоровье и болезнях человека (1). Установлены связи между микробными инфекциями полости рта и многочисленными системными заболеваниями (2), и предполагается, что биопленки полости рта служат резервуаром для возбудителей инфекционных заболеваний (3).Благодаря сочетанию мягких тканей и твердых поверхностей полость рта представляет собой уникальную среду для микробной колонизации. Совместные усилия ряда исследовательских групп привели к исчерпывающей инвентаризации микроорганизмов полости рта (4–6). Помимо естественных поверхностей полости рта, микроорганизмы могут эффективно образовывать биопленки на искусственных твердых поверхностях, которые вводятся в процессе реставрации зубов. Образование биопленки на реставрационных материалах положительно коррелирует с более высокой шероховатостью поверхности и свободной энергией поверхности (7).Среди биопленок, заселяющих искусственные твердые поверхности, те, что образуются на зубных имплантатах, привлекли большое внимание в исследованиях. Здоровые имплантаты содержат очень разные микробиоты по сравнению с зубами (8), и в зависимости от исследования было высказано предположение, что разные виды микробов участвуют в развитии болезни вокруг имплантата (9). Напротив, бактериальные сообщества, заселяющие зубные протезы, еще одну важную искусственную поверхность, присутствующую в полости рта значительной части населения, в значительной степени еще предстоит исследовать.Несмотря на то, что некоторые исследовательские группы изучали микробиоту, связанную с зубными протезами (10–17), большинство исследований сосредоточено на особых аспектах, включая определенные группы бактерий или влияние чистящих средств.

Более 20% людей старше 65 лет в США не имеют всех зубов. С увеличением доли пожилых людей в популяции эта доля, вероятно, будет расти (18, 19). Зубные протезы, заселяющие бактерии, составляют важную часть микробиома человека, которую необходимо изучить на предмет их роли в поддержании здоровья полости рта у пожилых людей.Ношение протезов связано с рядом микробных заболеваний, включая воспаление слизистой оболочки, связанное с протезами (стоматит протезов) (20) и неприятный запах (21). Также предполагается, что протезы служат резервуаром для респираторных патогенов (3, 13) и, таким образом, приводят к повышенному риску легочных инфекций (22). Несмотря на то, что микроорганизмы являются очевидными подозреваемыми в большинстве перечисленных заболеваний, связанных с зубными протезами, об их этиологии известно мало. Большинство исследований, посвященных изучению микроорганизмов, связанных с зубными протезами, сосредоточено на колонизации Candida sp., который считается важным этиологическим агентом стоматита зубных протезов (23), хотя в это заболевание полости рта также причастны различные виды бактерий (11, 16, 24). В настоящее время доступны лишь ограниченные сведения о микробном составе биопленок, растущих на зубных протезах. Необходимо провести сравнение с микробиотой, обитающей на естественных поверхностях полости рта, чтобы выяснить, как микроорганизмы, колонизирующие протез, формируют микробиоту полости рта и наоборот.Очень мало исследований оценивали колонизацию бактериального протеза с использованием независимой от культуры библиотеки клонов и подходов с шахматной доской (10, 14, 15, 17). На сегодняшний день только в одном недавнем исследовании сообщалось об анализе секвенирования следующего поколения, который предоставил первоначальный анализ преимущественно на уровне класса зубных протезов, колонизирующих микробиоту, соответствующих поверхностей слизистой оболочки и выбранных оставшихся зубов (12). Хотя это важный шаг к пониманию бактериального компонента здоровья и заболеваний у пользователей зубных протезов, недавняя всесторонняя оценка различных участков полости рта на уровне олиготипа подчеркнула важность определения сообществ на более подробных таксономических уровнях, чтобы лучше понять экологические и функциональные аспекты. разнообразие микробиоты, имеющее отношение к здоровью и болезням (25).Этот уровень анализа все еще отсутствует для микробиоты, связанной с зубными протезами, и соответствующих микробных сообществ на оставшихся зубах пользователей зубных протезов.

В этом исследовании мы выполнили комплексный анализ микробных биопленок, заселяющих зубные протезы, на основе секвенирования гена 16S рРНК на уровне родов и видов. Соответствующие образцы зубных протезов и оставшихся зубов здоровых людей и людей со стоматитом зубных протезов, но без других заболеваний полости рта, были использованы для сравнения факторов, связанных с пациентом и поверхностью.Мы исследовали, являются ли биопленки, присутствующие на этих разных поверхностях, разными, можно ли различить сообщества биопленок, связанных со здоровьем и болезнями, и влияют ли микробные сообщества, присутствующие на разных поверхностях у одних и тех же пациентов, друг на друга. Выявление соответствующих факторов и микроорганизмов, связанных с заболеванием, расширит возможности стоматологов по разработке более целенаправленных подходов к лечению заболеваний, связанных с зубными протезами.

РЕЗУЛЬТАТЫ

Характеристики пациентов, сбор образцов и секвенирование.Образцы были взяты индивидуально из зубных протезов и оставшихся зубов 10 здоровых носителей зубных протезов и 10 пациентов со стоматитом зубных протезов, которые в остальном не имели микробных заболеваний полости рта (более подробную информацию см. В разделе «Материалы и методы»). Мы идентифицировали таксономический состав микробиоты полости рта с помощью 454 пиросеквенирования гипервариабельных областей от V1 до V3 генов 16S рРНК в общей сложности для сорока образцов (один образец зубного протеза и один образец зубного протеза на пациента, собранный, как описано в разделе «Материалы и методы»).Мы получили в общей сложности 106 894 прочтения со средней длиной считывания 444 п.н. после удаления низкокачественных и коротких последовательностей, а также химерных последовательностей. Один из образцов, взятых из оставшихся зубов пациента со стоматитом, который дал <1500 считываний, был исключен из дальнейшего анализа вместе с подходящим образцом зубного протеза из-за недостаточной глубины секвенирования. Для каждого образца было проанализировано в среднем 2739 считываний (диапазон от 1692 до 4975), что обеспечивает достаточную глубину секвенирования для определения общего разнообразия образцов (см.рис.S1 в дополнительном материале).

Структуры сообщества микробиомов, связанных с зубными протезами и зубами, у здоровых и больных зубных протезов очень похожи. Последовательности гена 16S рРНК обрабатывались, как описано в разделе «Материалы и методы». Двадцать шесть различных родов, представляющих в общей сложности 136 различных видов / филотипов, присутствовали по крайней мере у двух субъектов с относительной численностью> 1% (рис. 1). Равномерность и богатство микробного сообщества (альфа-разнообразие) на уровне рода были очень похожи между зубными протезами и оставшимися естественными зубами в состоянии здоровья, а также при болезни (рис.2А). Структура микробного сообщества (бета-разнообразие) статистически значимо не различалась между четырьмя разными группами (зубные протезы — здоровье; зубные протезы — стоматит; оставшиеся зубы — здоровье; оставшиеся зубы — стоматит), независимо от того, какой аспект исследовался (рис. 2B; см. Рис. S2 в дополнительном материале). Затем мы сравнили отдельные таксоны, присутствующие в образцах, полученных от зубных протезов и естественных зубов одного и того же человека с комбинациями зубной протез, зубной протез и зубной протез от разных людей, используя различие Брея-Кертиса, которое, в отличие от UniFrac, не учитывает филогенетическое родство между членами сообщества.Среднее совпадение филотипов в соответствующих образцах зубных протезов, полученных от одних и тех же участников исследования, было значительно больше (более низкий индекс Брея-Кертиса), чем в различных комбинациях образцов, полученных от разных людей (рис. 2C). Таким образом, микробная колонизация разных поверхностей внутри человека кажется более похожей, чем одна и та же поверхность (зубные протезы или оставшиеся зубы) у разных людей.

Рисунок S2

Бета-разнообразие (анализ основных координат) микробных сообществ, колонизирующих здоровых людей (зеленый) и пациентов со стоматитом (красный), независимо от поверхности (A) и колонизирующих зубных протезов (синий) и оставшихся зубов (черный) независимо от состояние здоровья полости рта, связанное с зубным протезом (B). Скачать Рисунок S2, файл TIF, 0,4 МБ. Авторские права © 2016 Shi et al.

Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4.0. .

Рис. 1

Состав на уровне рода зубных протезов и ассоциированных с зубами микробиомов при здоровье и стоматите. Относительная численность на уровне рода в образцах зубных протезов (вверху) и зубов (внизу), собранных у одних и тех же людей, показана в одном порядке (от h2 до h20, от S1 до S6 и от S8 до S10).Слева показаны образцы от здоровых людей, справа — от пациентов со стоматитом. HD, здоровый протез; SD — протез при стоматите; HT — здоровые оставшиеся зубы; ST, стоматит оставшихся зубов. Роды, присутствующие с относительной численностью> 1% по крайней мере в двух образцах пациентов, были включены в анализ и перечислены справа с соответствующей цветовой кодировкой. Роды, присутствующие при относительной численности <1% или только в одной выборке пациентов, были объединены в категорию «Другие».

FIG 2

Анализ структуры микробного сообщества. (A) Альфа-разнообразие (индекс Шеннона) микробного сообщества между зубными протезами и зубами в состоянии здоровья и болезни, (B) Бета-разнообразие (анализ основных координат [PCoA]) микробных сообществ, колонизирующих зубные протезы (синий) или оставшихся зубов (зеленый ) здоровых людей и больных стоматитом (красные — зубные протезы; желтые — оставшиеся зубы) соответственно. (C) Совместная встречаемость филотипов (рассчитанная как несходство Брея-Кертиса) в образцах зубных протезов и оставшихся зубов от здоровых людей (черные полосы) и пациентов со стоматитом (белые полосы).Филотипы, колонизирующие зубные протезы (D) и зубы (T), сравнивались у одних и тех же людей (DT Same Ind.), Между разными людьми (DT Different Individuals) и между образцами зубных протезов (DT Different Individuals) и зубов (TT Различные люди) от разных людей. *, P <0,05; **, P <0,001.

Из 26 идентифицированных родов (см. Рис. S3A в дополнительном материале) 25 были обнаружены в зубных протезах, а 24 колонизированных зуба (см. Рис.S3B) при указанных выше критериях отсечки. Eikenella и Abiotrophia в значительном количестве отсутствовали на оставшихся зубах, тогда как род Gemella в значительной степени отсутствовал на зубных протезах. Род Actinomyces был наиболее распространен на обеих поверхностях, зубных протезах и оставшихся зубах, за ним следовали Streptococcus , Veillonella , Capnocytophaga , Neisseria , Prevotella и Corynebacterium , все из которых были идентифицированы в более половины протестированных образцов независимо от поверхности или состояния здоровья.Другие роды, отвечающие указанным выше критериям отсечения, включали Rothia , « Candidatus TM7» (« Candidatus G-1»), Leptotrichia , Porphyromonas , Selenomonas , Campylobacter , Lautropia , Granulicatella , Haemophilus , Kingella , Fusobacterium , Bacteroidales Candidatus G-5»), « Candidatus TM7» (« Candidatus G-5»), Actinobaculum Tannerella и Clostridiales Candidatus F-2», « Candidatus G-5»), а также Gemella , Eikenella и Abiotrophia . Ни одно из видимых различий в распространенности или относительной численности не было значительным.

Рис. S3 Роды

, присутствующие в относительной численности> 1% по крайней мере в двух образцах пациентов, были включены в анализ. Показаны распространенность (a) и средняя относительная численность ± SEM (b) всех образцов (средние серые столбцы) (A), дифференцированных на зубные протезы (темно-серые столбцы) и зубы (светло-серые столбцы) (B), а также в состоянии здоровья. (черные полосы) и стоматит (белые полосы) (C). *, P Рисунок S3, файл TIF, 2.5 МБ. Авторские права © 2016 Shi et al.

Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4.0. .

Затем мы провели аналогичный анализ, сравнивая образцы, полученные от здоровых субъектов, с образцами, полученными от пациентов со стоматитом, независимо от поверхности, с которой они были взяты (см. Рис. S3C). Микробиомы здоровых людей содержали только 22 из 26 родов, включенных в анализ. Отсутствующие роды: Fusobacterium , Tannerella , « Candidatus TM7» (« Candidatus G-5») и Eikenella .Микробные сообщества, выделенные от больных стоматитом, содержали все роды, за исключением Gemella . Единственным родом, который продемонстрировал значительные различия ( P = 0,026) в относительной численности между здоровьем и болезнью независимо от поверхности, был Fusobacterium (см. Рис. S3C и S4A).

Рисунок S4

Состояние здоровья и болезни и поверхностно-зависимая дифференциальная колонизация на уровне рода и филотипа. Показаны средние значения относительной численности Porphyromonas sp.штамм HOT-279, P. gingivalis и другие связанные с заболеванием бактерии Porphyromonas ( P. cantoniae , P. endodontalis и Porphyromonas sp., штамм HOT-275 вместе взятые) (A) и Campylobacter showae, Capnocytophaga sp. штамм HOT-329 и P. melaninogenica (B). Образцы подразделяются на состояние здоровья (черные столбцы), заболевания (белые столбцы), зубные протезы (темно-серые столбцы), зубы (светло-серые столбцы), зубные протезы в состоянии здоровья (синие столбцы), зубные протезы от пациентов со стоматитом (красные столбцы), здоровые зубы. (зеленые столбцы) и зубы больных стоматитом (желтые столбцы).*, P Рисунок S4, файл TIF, 1,3 МБ. Авторские права © 2016 Shi et al.

Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4.0. .

Для дополнительных сравнений мы дополнительно разделили образцы на образцы, полученные от зубных протезов и зубов здоровых людей и пациентов с зубным стоматитом (рис. 3). Микробиом зубных протезов от больных стоматитом был самым разнообразным и включал 24 различных преобладающих рода, тогда как на протезах здорового человека было обнаружено только 18 родов.В каждом случае, здоровье и болезнь, оставшиеся зубы состояли из 21, хотя и не идентичного, рода. Некоторые из родов, которые встречались в меньшей степени, были преимущественно обнаружены в определенных условиях. Kingella и Gemella в основном колонизировали зубы здоровых носителей протезов, тогда как Bacteroidales Candidatus G-5») отсутствовали. Eikenella использовалась только для больных зубных протезов. Род Porphyromonas соответствовал пороговому значению относительной численности в 1% для всех состояний, кроме больных зубных протезов.В Fusobacterium , Tannerella и « Candidatus TM7» (« Candidatus G-5»), которые были обнаружены преимущественно у пациентов с заболеванием, не было обнаружено поверхностно-зависимых различий.

Рис. 3

Распространенность рода и средняя относительная численность микробиомов, связанных с зубными протезами и зубами, в состоянии здоровья и при стоматите. Роды, присутствующие с относительной численностью> 1% по крайней мере в двух образцах пациентов, были включены в анализ. Показаны распространенность (A) и средняя относительная численность ± SEM (B) на зубных протезах в состоянии здоровья (синие столбцы), на зубных протезах пациентов со стоматитом (красные столбцы), на здоровых зубах (зеленые столбцы) и на зубах у пациентов со стоматитом. (желтые полосы).Числа, которым предшествуют буквы G и F, относятся к еще не названным родам и семействам, соответственно, в пределах указанных типов и порядков.

Конкретные виды / филотипы демонстрируют отчетливую поверхностную колонизацию зубов и зубных протезов, связанную со здоровьем и заболеваниями. Дальнейший подробный анализ уровня филотипов видов / был проведен для родов, которые встречались по крайней мере в 10% образцов, чтобы исключить влияние филотипы, которые встречаются только в одном или двух образцах с очень высокой относительной численностью и, следовательно, не являются репрезентативными для данного состояния.Этот анализ показал, что Fusobacterium nucleatum subsp. animalis был обнаружен почти исключительно на зубных протезах больных стоматитом ( P = 0,016). F. nucleatum subsp. vincentii , напротив, был обнаружен в основном на оставшихся зубах пациентов со стоматитом ( P = 0,0097) (рис. 4A), тогда как F. nucleatum subsp. polymorphum и F. periodonticum существенно не различались ни на поверхности, ни по состоянию здоровья, ни по заболеванию (данные не показаны).Несмотря на то, что Streptococcus не выделялся как род, несколько видов, включая Streptococcus gordonii ( P = 0,012), S. sanguinis ( P = 0,049) и S. australis ( P = 0,0215). ), колонизировали зубные протезы здоровых владельцев зубных протезов на значительно более высоком уровне (рис. 4B). Интересно, что Porphyromonas sp. штамм HOT-279, филотип рода, часто ассоциируемый с заболеваниями полости рта (26), был значительно более распространен здоровьем ( P = 0.048) (см. Рис. S4A). Большинство других представителей этого рода были прочно связаны с зубами у больных стоматитом, хотя и в относительно небольшом количестве. Поверхностно-зависимые различия независимо от состояния здоровья / заболевания наблюдались для Campylobacter showae ( P = 0,0173), Capnocytophaga sp. штамм HOT-329 ( P = 0,045) и P. melaninogenica ( P = 0,026), причем первые два присутствуют преимущественно на зубах, а последний значительно больше на поверхностях протезов (см.рис.S4B).

FIG 4

Дифференциальная колонизация зубных протезов или зубов здоровыми и больными на уровне рода и филотипа. Показана средняя относительная численность рода Fusobacterium , а также F. nucleatum subsp. animalis и vincentii (A), S. gordonii, S. sanguinis и S. australis (B). Образцы подразделяются на состояние здоровья (черные столбцы), заболевания (белые столбцы), зубные протезы в состоянии здоровья (синие столбцы), зубные протезы от пациентов со стоматитом (красные столбцы), здоровые зубы (зеленые столбцы) и зубы от пациентов со стоматитом (желтые столбцы). .*, P <0,05.

Кроме того, каждый образец зубного протеза оценивали на наличие Candida с помощью ПЦР. В группе пациентов со стоматитом Candida был обнаружен в 90% образцов по сравнению с 50% образцов из здоровой группы (таблица 1). Несколько видов бактерий, включая Atopobium parvulum, Lachnospiraceae sp. штамм HOT-097 и Veillonella atypica присутствовали в основном в образцах протезов, содержащих Candida , а Leptotrichia sp.штамм HOT-212, за исключением одного пациента, присутствовал только в образцах без Candida .

ТАБЛИЦА 1

Оценка образцов зубных протезов на наличие Candida с помощью ПЦР и совместной встречаемости с видами / филотипами бактерий

ОБСУЖДЕНИЕ

Стоматит зубных протезов в значительной степени изучался в контексте грибковых инфекций, и даже несмотря на то, что имел место Десятилетия назад Купманс и его коллеги предложили «уделять больше внимания бактериальной популяции при стоматите, вызванном зубными протезами, вместо того, чтобы сосредотачиваться только на Candida albicans» (11), с тех пор мало исследований было сделано. Подробный анализ библиотеки клонов (10) дал первое представление о разнообразии бактериальных филотипов, связанных с зубными протезами при состоянии здоровья и болезни, в то время как недавнее исследование преимущественно на уровне классов и типов (12) представило современные подходы к секвенированию в этой области. Представленные здесь данные представляют собой первый комплексный анализ на уровне родов и видов бактерий, обитающих в биопленках на зубных протезах и оставшихся зубах здоровых пациентов и пациентов со стоматитом. Важно отметить, что сравнение образцов, взятых из зубных протезов и оставшихся зубов одних и тех же людей, позволило нам проанализировать возможное взаимное влияние бактериальных сообществ, колонизирующих эти различные поверхности, в состоянии здоровья и болезни.

Наш первоначальный анализ на уровне родов показал, что, в отличие от отдельной микробиоты, связанной со здоровьем и заболеванием, о которой ранее сообщалось для других заболеваний полости рта, таких как пародонтит (27–30), бактериальные сообщества, проживающие на зубных протезах и оставшихся зубах в состоянии здоровья и болезни, скорее похожи друг на друга (рис. 1). Отсутствие различий в составе бактериального сообщества также отражалось в соответствующем альфа- и бета-разнообразии (рис. 2A и B; см. Рис. S2). В соответствии с предыдущими выводами о больших индивидуально зависимых вариациях микробиома (29, 31, 32), мы обнаружили, что филотипический состав бактериальных сообществ, растущих на зубных протезах, и сообществ, полученных из оставшихся зубов, были значительно более похожи друг на друга (нижняя часть Брея-Кертиса индекс несходства) в образцах, полученных от одного и того же человека, чем в несвязанных зубных протезах и образцах зубов от разных людей (рис.2С). Это также отражено в наших наблюдениях, что только три филотипа / видов продемонстрировали значительную дифференциальную колонизацию поверхности (см. Рис. S4B). Учитывая это очевидное сильное взаимное влияние бактерий, колонизирующих зубные протезы и зубы у одного и того же человека, здоровье и целостность оставшихся зубов может быть важным фактором здоровья слизистой оболочки носителей зубных протезов, помимо их роли в закреплении реставраций и поддержании целостности костей. Точно так же состояние слизистой оболочки полости рта, связанное с протезом, может сыграть решающую роль в сохранении оставшихся зубов.

Кроме того, составы бактериальных филотипов, присутствующие в биопленках, собранных с одной и той же поверхности (зубные протезы или оставшиеся зубы) разных пациентов, были значительно менее похожи друг на друга, чем на сообщества, идентифицированные на сопоставленных образцах зубных протезов у ​​тех же пациентов (рис. . 2С). Это интересно, поскольку считается, что образование биопленок в значительной степени зависит от поверхности (7), и, хотя существует перекрытие, различные естественные поверхности в полости рта заселяются разными сообществами (25).Наши результаты показывают, что индивидуальные факторы могут быть более доминирующими детерминантами состава бактериальной биопленки полости рта, чем поверхности. Одним из важных факторов, влияющих на это явление, может быть слюна, которая покрывает доступные естественные, а также искусственные поверхности полости рта так называемой пленкой (33). Слюна может иметь большие различия между людьми (34, 35) и обеспечивает важные адгезионные белки для прикрепления бактерий (36). Кроме того, наше открытие о том, что факторы, возникающие внутри пациента, могут быть более сильными детерминантами состава сообщества бактериальной биопленки, чем различные поверхности, подчеркивает, что группировка и объединение образцов от разных людей может влиять на результат анализа.

Предыдущие исследования, посвященные анализу бактерий, заселяющих зубные протезы при здоровье и болезнях, не являются окончательными. Подобно нашим результатам, недавнее исследование секвенирования (12) и более старые подходы, основанные на культуре (11, 16, 24), не обнаружили различий в видимом микробном составе между здоровыми пациентами и пациентами со стоматитом и отметили только то, что количество накопленных бляшек значительно больше. у больных стоматитом. Напротив, независимое от культуры исследование на основе библиотеки клонов (10) показало, что микробиота биопленок, колонизирующих зубные протезы, при здоровье и болезни различна. Кроме того, в отличие от наших результатов, подробно описанных выше, недавно опубликованное исследование секвенирования (12) описало значительную разницу между составами бактериального сообщества, обнаруженными на поверхности зубных протезов, и на оставшихся зубах. Очевидные расхождения между нашими выводами и предыдущими исследованиями секвенирования на основе гена 16S рРНК могут быть вызваны многими факторами, начиная от географических различий между популяциями пациентов и заканчивая сбором образцов, параметрами секвенирования (выбор целевой области 16S рРНК, используемая платформа секвенирования, доступно для чтения длина и глубина секвенирования, среди прочего) или протоколы экстракции ДНК и ПЦР (37).

Неудивительно, что мы обнаружили, что Actinomyces , Capnocytophaga , Streptococcus , Veillonella и Neisseria являются наиболее распространенными и многочисленными родами, независимо от поверхности или состояния здоровья / болезни, во всех наших образцах. (Рис. 3; см. Рис. S3). Эти роды являются одними из наиболее распространенных в полости рта и были определены как основные колонизаторы зубных протезов в предыдущих исследованиях, основанных на культуре и не зависящих от культуры (10–12, 16).В частности, роды Actinomyces и Streptococcus считаются ранними колонизаторами ротовой полости, которые легко прикрепляются к доступным поверхностям, а также друг к другу (38, 39). Они обеспечивают поверхностную колонизацию других видов микробов, включая Capnocytophaga и Neisseria , посредством физического связывания, а также метаболических взаимодействий, таких как метаболическая взаимозависимость между видами Veillonella и Streptococcus (40, 41).Другие распространенные роды, присутствующие в образцах, проанализированных в нашем исследовании, включают Corynebacterium , Rothia , несколько родов « Candidatus TM7» и Fusobacterium . Большинство предыдущих исследований, сравнивающих зубной налет на протезах при состоянии здоровья и болезни, не идентифицировали эти роды (10–12), хотя в исследовании с шахматной доской, сравнивающем модели колонизации естественных зубов и зубных протезов, было обнаружено, что они колонизируют зубные протезы (15). В соответствии с более ранними исследованиями (10, 12, 23, 24, 42, 43), образец Candida не ограничивался образцами стоматита зубных протезов, с меньшим количеством положительных образцов здоровых образцов (Таблица 1).В то время как предыдущий анализ на уровне классов показал, что колонизация Candida положительно коррелировала с лактобактериями и отрицательно коррелировала с Fusobacteria , этого не было для проанализированных здесь образцов. В нашем исследовании мы наблюдали возможную положительную корреляцию для A. parvulum , Lachnospiraceae sp. штамм HOT-097 (« Candidatus G-4»), Veillonella atypica, а Leptotrichia sp. штамм HOT-212 не присутствовал в образцах, содержащих Candida , за исключением одного здорового пациента.Поскольку мало что известно о взаимодействии между этими видами и Candida , необходимы дальнейшие исследования, чтобы подтвердить актуальность этого наблюдения.

Несмотря на сходство на уровне сообщества биопленок, отдельные роды и виды значительно различались по встречаемости на определенных поверхностях и / или по состоянию здоровья / болезни пациента, связанному с зубными протезами. Все представители рода Fusobacterium имели очень низкие показатели колонизации здоровых зубных протезов и здоровья в целом (рис.4A), даже несмотря на то, что виды Streptococcus gordonii и S. sanguinis, к которым, как известно, прикрепляются фузобактерии (44, 45), присутствовали в значительно повышенных количествах в этом состоянии (рис. 4B). Эти данные показывают, что в сложной биопленочной среде полости рта факторы, помимо способности связываться друг с другом, играют важную роль в динамике и составе микробного сообщества. Среди различных видов и подвидов Fusobacterium F. nucleatum subsp. polymorphum , F.нуклеатум подвид. Ранее отмечалось, что vincentii и F. periodonticum увеличиваются больше на естественных зубах, чем на зубных протезах (15). В нашем исследовании они показали более высокое относительное количество на естественных зубах при заболевании; однако это различие было значимым только для F. nucleatum subsp. vincentii (рис. 4А). Удивительно, но характер колонизации F. nucleatum subsp. animalis полностью отличался от такового для всех других идентифицированных видов и подвидов фузобактерий, с поразительной почти исключительной колонизацией поверхностей зубных протезов у ​​пациентов со стоматитом (рис.4А). Этот конкретный подвид F. nucleatum был идентифицирован как этиологический агент в отчете о случае, связывающем микробиоту полости рта с мертворождением (46), документально подтверждено, что он более распространен при поддесневом налете и раннем периодонтите (47), а также экспериментальном гингивите (48). ). Кроме того, F. nucleatum subsp. animalis является частью микробной сигнатуры при раннем обнаружении колоректального рака (49) и единственным подвидом фузобактерий /, который, как обнаружено, перекрывается между микроорганизмами, выделенными из пародонтального кармана, и атероматозной бляшкой у пациентов с сердечными заболеваниями (50).Наше открытие сильной ассоциации F. nucleatum subsp. animalis с воспалительным заболеванием слизистой оболочки стоматитом в сочетании с вышеуказанными данными других исследовательских групп предполагает, что этот подвид F. nucleatum может быть более патогенным, чем другие.

Помимо заметного различия между F. nucleatum subsp. животное — это распространение , что может иметь отношение к этиологии стоматита, другие микроорганизмы демонстрировали несопоставимые модели колонизации, зависящие от поверхности и / или состояния здоровья.Как уже упоминалось выше, определенные виды Streptococcus продемонстрировали значительно более высокую распространенность и численность на зубных протезах у здоровых пользователей зубных протезов, чем при всех других условиях (рис. 4B). Среди них S. sanguinis и S. gordonii ранее были связаны со здоровьем полости рта (51–53), а недавнее исследование выявило отчетливое видоспецифичное распределение стрептококков на естественных поверхностях полости рта здоровых людей (25). Дополнительное свидетельство важности анализа, выходящего за пределы уровня рода или типа, обеспечивает картину колонизации родов Fusobacterium и Porphyromonas .В то время как их присутствие сильно коррелировало со здоровьем и болезнью независимо от поверхности при анализе на уровне рода (рис. 4A; см. Рис. S4A), подробный анализ на уровне филотипов видов / дал более дифференцированную картину. Как уже обсуждалось выше, различные представители рода Fusobacterium , присутствующие в наших образцах, демонстрировали четкое распределение в зависимости от состояния поверхности и состояния зубных протезов (рис. 4A). Наше открытие, что Porphyromonas , род, обычно связанный с заболеванием (26), демонстрирует значительную независимую от поверхности ассоциацию со здоровьем (см.рис.S4A) представляет собой пример того, как отсутствие таксономического разрешения может повлиять на результаты и интерпретацию данных. Исследование на уровне филотипа показало, что род Porphyromonas преимущественно представлен в наших выборках Porphyromonas sp. штамм HOT-279, филотип, который в изобилии встречается у здоровых людей, участвовавших в проекте Human Microbiome Project (25, 54). Дополнительные, менее многочисленные представители Porphyromonas (P. gingivalis, P.endodontalis , P. catoniae и Porphyromonas sp. штамм HOT-275) продемонстрировали «типичную» ассоциацию с заболеванием этого рода, поскольку они достоверно коррелировали с остальными зубными рядами пациентов со стоматитом (см. рис. S4A). Поскольку эти отчетливые паттерны распределения отдельных представителей определенных родов, связанные со здоровьем и болезнями, очевидны только на уровне филотипа / вида, анализа микробиома на уровне рода не всегда достаточно для получения полной картины соответствующих участников, и анализ с более высоким разрешением может иметь решающее значение для глубокого понимания микробиома полости рта при здоровье и болезнях.

В заключение, наше исследование предполагает, что бактериальная микробиота на зубных протезах очень похожа по здоровью и болезням на более широком уровне сообщества. Это также наблюдалось в отношении зубных протезов и оставшихся зубов независимо от состояния здоровья, особенно в образцах, взятых у одних и тех же людей. Филотипический состав бактериальных сообществ, заселяющих зубные протезы и оставшихся зубов одних и тех же людей, в значительной степени отражает друг друга, что указывает на возможное взаимное влияние состояния здоровья зубных протезов на зубной ряд и наоборот.Наблюдаемое отсутствие отчетливой микробиоты согласуется с большинством предыдущих отчетов о том, что при заболеваниях полости рта, связанных с зубными протезами, общая микробная нагрузка может иметь большее влияние на развитие стоматита, чем фактический микробный состав зубного налета, обращенного к слизистой оболочке. Несмотря на это общее сходство, мы смогли идентифицировать отдельные виды, такие как F. nucleatum subsp. animalis и несколько видов Streptococcus , которые были сильно связаны с образцами больных и здоровых протезов, соответственно.Наши выводы о том, что значительные различия в колонизации наблюдались преимущественно на уровне филотипов /, подчеркивают важность анализа на уровне видов / филотипов или даже олиготипов (25).

МАТЕРИАЛЫ И МЕТОДЫ

Популяция испытуемых и сбор образцов. Двадцать взрослых добровольцев, носящих зубные протезы, с минимум четырьмя оставшимися зубами и одним полным протезом были набраны для этого исследования под руководством Институционального наблюдательного совета No. 2012-0004 гг. — в Западно-Китайский университет (Чэнду, Китай).Согласно опубликованным рекомендациям по диагностике стоматита зубных протезов, десять человек были здоровыми носителями зубных протезов и 10 были пациентами со стоматитом, связанным с зубными протезами (55). В группу здоровых носителей протезов вошли пять женщин и пять мужчин, средний возраст 69,8 ± 4,7 года. Аналогичным образом в группу больных стоматитом вошли пять женщин и пять мужчин со средним возрастом 61,1 ± 12,0 года. У участников исследования не было других активных заболеваний полости рта, таких как кариес или пародонтит.Подходящие люди были системно здоровыми и не принимали никаких рецептурных или безрецептурных лекарств в течение как минимум 6 месяцев. Кроме того, участники исследования не использовали какие-либо биоцидные зубные пасты или средства для чистки зубных протезов в течение последних 6 месяцев. Информированное согласие было получено до сбора образцов и подписано участниками исследования, а также клиницистами и исследовательским персоналом, выполняющими оценку состояния полости рта, сбор и обработку образцов.

Участников исследования попросили носить зубные протезы не менее 3 часов и воздерживаться от еды, питья и чистки зубов или зубных протезов перед взятием образцов зубного налета.Образцы зубного налета были собраны опытным стоматологом с частей розовой акриловой поверхности протеза, которые контактировали с поверхностью слизистой оболочки полости рта, путем наложения стерильных зубочисток круговыми движениями. С помощью аналогичных круговых движений стерильные зубочистки также использовались для получения наддесневого налета с оставшихся зубов. Были приняты меры для сбора с щечных поверхностей зубов, которые не находились в прямом контакте с поверхностями протезов. Отдельные образцы зубных протезов и зубного налета, а также контрольные зубочистки помещали в отдельные микроцентрифужные пробирки, содержащие 0.5 мл фосфатно-восстановленного физиологического раствора с пониженным содержанием кислорода и немедленно хранить при -20 ° C до экстракции ДНК.

Экстракция

ДНК и секвенирование. Геномную ДНК выделяли из собранных образцов бляшек и соответствующих контролей с помощью стерильных зубочисток с помощью набора DNeasy Blood and Tissue (Qiagen Inc., США), как описано ранее (56), с добавлением взбивания шариков для максимальный лизис клеток (29). Качество и количество ДНК определяли на спектрофотометре NanoDrop 2000 (Thermo, США).После выделения геномной ДНК и количественного определения концентрации ДНК в образцах были нормализованы до 2-6 нг / мкл, и амплификация ПЦР была выполнена в соответствии с протоколом, разработанным Human Microbiome Project для секвенирования на титановой платформе 454 FLX (54). Вкратце, гипервариабельные области от V1 до V3 генов 16S рРНК были амплифицированы из очищенной геномной ДНК с праймерами 27F (праймер V1, 5’AGAGTTTGATCCTGGCTCAG3 ‘) и 534R (праймер V3, 5’ATTACCGCGGCTGCTGG3’) с индивидуальной последовательностью адаптера. (5’CCATCTCATCCCTGCGTGTCTCCGACTCAG3 ‘) для праймера 534R и адаптера B (5’CCTATCCCCTGTGTGCCTTGGCAGTCTCAG3’) для праймера 27F и объединены для секвенирования.Библиотеки ампликонов гена 16S рРНК были сконструированы, и 454 пиросеквенирование было выполнено в Объединенном технологическом центре института Дж. Крейга Вентера.

Анализ таксономического состава микробов. 454 данных пиросеквенирования были демультиплексированы в соответствующие образцы на основе индивидуальных штрих-кодов каждого образца. После того, как штрих-коды были обрезаны, процесс очистки данных был применен ко всем образцам с помощью собственной программы Perl. Вкратце, низкокачественные последовательности, содержащие основания со значением качества Phred <20, были обрезаны с концов считывания.Удаляли последовательности с конечной длиной считывания <300 п.н. или с ≥3% неопределенных оснований. Подозреваемые химеры были идентифицированы и удалены с помощью ChimeraSlayer (57). Последовательности 16S рРНК были сгруппированы в рабочие таксономические единицы (OTU) на уровне сходства последовательностей 97% с QIIME (58). Затем OTU были аннотированы с таксономическим назначением путем сравнения репрезентативной последовательности каждой OTU со ссылками на базу данных оральных микробов человека (16S рРНК, RefSeq версии 11.0) (59) с помощью BLAST на основе наилучшего совпадения при> 97% идентичности нуклеотидных последовательностей более не менее 95% длины запроса (56).Равномерность и богатство микробного сообщества измеряли по альфа-разнообразию, а сходство между отдельными микробными сообществами измеряли по бета-разнообразию. Альфа-разнообразие (индекс Шеннона), бета-разнообразие (взвешенный и невзвешенный UniFrac), анализ главных координат и оценка глубины секвенирования с помощью анализа разрежения были рассчитаны или выполнены с помощью QIIME (58) на уровне OTU. Роды, присутствующие по крайней мере у двух субъектов с относительной численностью> 1%, были включены в дальнейший анализ уровня филотипов родов и видов /.Таксономический состав каждой выборки был обобщен на уровне родов и видов.

Обнаружение Candida с помощью ПЦР. Наличие или отсутствие Candida в образцах, взятых с зубных протезов, оценивали с помощью универсальных праймеров ITS1 (5 ‘CTTGTTATTTAGAGGAAGTAA 3’) и ITS2 (5 ‘GCTGCGTTCTTCATCATGC 3’) (60) под следующие условия цикла: 94 ° C в течение 11 минут, затем 35 циклов 94 ° C в течение 30 секунд, 50 ° C в течение 30 секунд и 72 ° C в течение 30 секунд с последним 30-минутным продлением при 72 ° C.

Статистический анализ. Данные представлены как среднее ± стандартная ошибка среднего (SEM), если не указано иное. Все наборы данных были проверены на предмет их свойств распределения с помощью теста Шапиро-Уилка перед анализом. Статистическая проверка различий в относительной численности распределения родов и видов между различными группами выборки была проверена с помощью U-критерия Манна-Уитни для парных сравнений (протезы по сравнению с зубами; здоровье по сравнению со стоматитом) и теста Краскела-Уоллиса для сравнения нескольких групп ( зубные протезы против зубов в здоровье и болезни). Различия в распространенности родов и филотипов между несколькими группами оценивали с помощью точного критерия Фишера. Различия Брея-Кертиса использовали для оценки совпадения бактериальных филотипов на зубных протезах и зубах, полученных от одних и тех же людей, по сравнению с зубными протезами и зубами от разных людей и только зубными протезами или только зубами от разных людей. Результаты несходства Брея-Кертиса были дополнительно проанализированы с помощью двустороннего непарного теста t и дисперсионного анализа.Вся статистика была проведена с соответствующими функциями в R Studio, Prism и Excel, в то время как непараметрический многомерный анализ anosim в mothur (61) использовался для проверки того, насколько сходство микробиома в группах статистически значимо отличается от сходства между группами. Значения P были скорректированы для многократного тестирования микробных таксонов с p.adjust в R с использованием коэффициента ложного обнаружения (62).

Доступность данных. Набор данных, подтверждающих выводы этой статьи, доступен в NCBI BioProject под инвентарным номером PRJNA292354 .

Что такое фторид диамина серебра (SDF)? — Детский стоматолог в Highlands Ranch, Колорадо — Детская стоматология Blue Sky

Что такое фторид диамина серебра?

Silver Diamine Fluoride — это жидкий антибиотик, одобренный FDA, который клинически применяется для контроля активного кариеса зубов и предотвращения дальнейшего прогрессирования заболевания.Хотя идеальный способ лечения кариеса — это удаление кариеса и установка реставрации, это альтернативное лечение позволяет остановить разрушение неинвазивными методами, особенно у маленьких детей с молочными зубами, которые не могут пройти стандартное лечение.

Лечение диамином фторидом серебра не устраняет необходимости в реставрационной стоматологии для восстановления функции или эстетики, но эффективно предотвращает дальнейшее разрушение. Реставрации зубов могут включать, помимо прочего, пломбирование зубов, терапию корневых каналов и / или коронки.

Как работает фторид диамина серебра?

Фторид диамина серебра состоит из двух основных компонентов: серебра и фторида. Серебро действует как антимикробный агент, который одновременно укрепляет нижележащий защитный слой ваших зубов, называемый дентином. Фторид — это активный ингредиент, который останавливает кариес и помогает предотвратить появление дополнительного кариеса.

Когда рекомендуется фторид диамина серебра?

Есть несколько ситуаций, в которых его можно рекомендовать.К ним относятся, но не ограничиваются следующим:

  • Дети с сильным кариесом (тяжелый кариес в раннем детстве)
  • Дети младшего возраста, которым трудно сотрудничать во время лечения
  • Пациенты с особыми потребностями
  • Дети с кариозными поражениями, которые нельзя вылечить за одно посещение

Факты для размышления:

  • Фторид диамина серебра (SDF) — это антибактериальная жидкость, используемая для лечения чувствительности зубов и остановки кариеса. SDF может потребовать повторного применения.
  • Порядок действий:
  1. Высушите пораженный участок.
  2. Нанесите небольшое количество SDF на пораженный участок.
  3. Дайте SDF высохнуть.
  4. Полоскание.
  • Ребенок не должен лечиться SDF, если:
  1. У вашего ребенка аллергия на серебро.
  2. Есть болезненные язвы или сырые участки на деснах (например, язвенный гингивит) или где-либо во рту (т.э., стоматит).
  • Лечение SDF не устраняет необходимость в зубных пломбах или коронках для восстановления функции или эстетики. За дополнительные процедуры взимается отдельная плата.

Преимущества получения SDF:

  • SDF может помочь остановить кариес.
  • SDF может помочь уменьшить чувствительность.
  • SDF может помочь выиграть время для тех пациентов, которые очень молоды, напуганы или имеют особые потребности, которым в противном случае может потребоваться седация при традиционном стоматологическом лечении.

Риски, связанные с SDF, включают, но не ограничиваются:

  • Пораженный участок навсегда останется черным. Здоровая структура зуба не оставляет пятен. Окрашенную структуру зуба в дальнейшем можно заменить пломбой или коронкой.
  • При случайном нанесении на кожу или десны может появиться коричневое или белое пятно, которое не причинит вреда и исчезнет в течение одной-трех недель.
  • Ваш ребенок может заметить металлический привкус, который быстро исчезнет.
  • Существует риск того, что процедура не остановит разрушение, и нет гарантии успеха.
  • Если не остановить кариес, кариес будет прогрессировать. В этом случае зуб потребует дальнейшего лечения, например повторного SDF, пломбирования или коронки, лечения корневого канала / пульпы или удаления.

Альтернативы SDF, не ограничиваясь следующим:

  • Не требуется лечения, которое может привести к дальнейшему ухудшению структур зубов и косметического вида. Симптомы могут усиливаться.
  • В зависимости от локализации и степени разрушения зуба, а также уровня поведения и сотрудничества, другое лечение может включать нанесение фторсодержащего лака, пломбы или коронки, удаление с седативным действием или без него.

Есть дополнительные вопросы? Пожалуйста, позвоните в офис, доктор Дженн и сотрудники Blue Sky будут рады помочь.

Молекулярное профилирование бактериальной микробиоты, связанной со стоматитом, связанным с зубными протезами

Демографические данные пациентов

Всего в исследование были включены 19 пациентов (стоматит зубных протезов (DS) n = 8; стоматит без зубных протезов (NoDS) n = 11 ).Демографические и клинические данные субъектов представлены в таблице 1. Образцам был присвоен анонимный справочный номер (S001-S019). Идентификатор образца включает ссылку на образец сайта; где T относится к языку, P — к слизистой оболочке неба, а D представляет собой поверхность, подходящую для протезирования ( e , g, . S001T, участок образца языка пациента 1).

Таблица 1 Демографические данные пациентов, записанные при наборе для каждого отдельного пациента (анонимно).

Было набрано больше женщин (n = 11), чем мужчин (n = 8), и средний возраст примерно 69 лет.64 года (± 13,84) и 64,88 года (± 7,14) были очевидны для обоих полов соответственно. Из набранных пациентов восемь (42,1%) были курильщиками.

Восемь пациентов имели СД в различной степени (женщины n = 6; мужчины n = 2), тогда как 11 человек не имели признаков СД (женщины n = 5; мужчины n = 6).

Обнаружение

Candida видов с помощью культивирования и ПЦР

Обнаружение Candida подробно описано в таблице 2. Пациенты, которые были положительными на Candida с помощью агаровой культуры или гнездовой ПЦР, были включены в анализ профилирования бактериального сообщества.

Таблица 2 Candida Присутствие и предполагаемая идентификация посевом и ПЦР.

Несколько образцов, которые не дали роста Candida на агаровой культуре, дали положительный результат на Candida методом вложенной ПЦР. Это были образцы S003D, S006P, S006D, S007T, S007D, S008T, S008P, S013D, S014P, S015D. В этих примерах описания D, P и T обозначают зубной протез, нёбо и язык соответственно. И наоборот, Candida не был обнаружен молекулярным тестированием образца S014T, но был обнаружен посевом.

Из каждого типа образцов ( и , и . Язык, небо или зубной протез) на SDA несколько типичных колоний пересевали на агар CHROMagar® Candida . Чашки с агаром инкубировали в течение 48 часов, после чего наблюдали бирюзово-зеленый цвет колоний, что указывает на предполагаемую идентификацию C . Альбиканс .

Вложенная ПЦР в реальном времени была использована для идентификации Candida в образцах до уровня вида. Ампликоны наблюдались в канале pan- Candida для множества образцов, но в C обнаружение не было обнаружено. glabrata или C . krusei зондирующих каналов, что исключает присутствие этих видов. Эти результаты, если рассматривать их вместе с результатами культивирования, указали на присутствие Candida , предположительно C . albicans во всех испытанных образцах и последующие тесты зародышевых трубок подтвердили способность изолятов образовывать гифы в присутствии сыворотки.

Метатаксономическое профилирование видов бактерий, присутствующих в образцах мазков

Из 57 собранных образцов 55 были обработаны для секвенирования ДНК.Пять не смогли получить ампликоны на первичной стадии, поэтому оставшиеся 50 образцов были использованы в последующих анализах. Всего было получено 2 194 967 считываний последовательностей, а после этапов контроля качества общее количество окончательных считываний составило 1 864 575. Для нормализации между выборками OTU были подвергнуты подвыборке с наименьшим числом считываний (S019P) из 10 995 считываний.

Пациенты были сгруппированы по статусу болезни и . и . наличие или отсутствие клинических симптомов DS (DS или NoDS, соответственно) и проанализированы.Всего было идентифицировано 2411 OTU, 353 из которых имели более десяти считываний последовательностей. В анализ были включены роды и виды бактерий с десятью или более прочтениями последовательностей.

Дублирующиеся виды бактерий (которые могут возникать из-за вариации последовательности штаммов) при филотипической классификации были объединены вместе с данными об их ОТЕ и относительной доле. Таким образом, общее количество уникальных видов бактерий было меньше, чем количество обнаруженных OTU. Оба рассматривались независимо для целей настоящего исследования.

Различия в бактериальной микробиоте пациентов с СД и без СД

Количества и относительные пропорции бактериальных родов сравнивались на участках выборки (например, DS по сравнению с NoDS в образцах языка, неба и поверхности, подходящей для протезирования), а также между участками отбора проб , например (язык DS по сравнению с небом DS по сравнению с протезом DS). Никаких существенных различий ( P > 0,05) не было обнаружено при сравнении в пределах или между участками выборки для количества родов при рассмотрении пациентов, сгруппированных по состоянию болезни и участку выборки (рис.1А). Аналогичным образом, никаких существенных различий ( P = 0,191) не было обнаружено при анализе пациентов, сгруппированных только по статусу заболевания (рис. 1B).

Рисунок 1

График разброса количества уникальных родов бактерий, сгруппированных по участку образца ( A ) и состоянию DS, и только состоянию DS ( B ). Количество родов бактерий для каждого пациента, сгруппированное как по участку образца, так и по состоянию DS, и только по состоянию DS, с отображением разброса и полос ошибок, представляет собой стандартное отклонение.Сходное среднее количество родов бактерий было очевидным во всех группах без статистически значимых различий.

Количество уникальных OTU определялось для каждой выборки (индекс Чао) (рис. 2). Количество уникальных OTU в образцах поверхности, подходящей для протезирования (рис. 2A), не показало значимых различий ( P = 0,806) между пациентами с DS и NoDS. Точно так же образцы слизистой оболочки неба (рис. 2B) у тех же пациентов показали небольшое увеличение количества уникальных видов бактерий для пациентов с NoDS, но это не было статистически значимым ( P = 0.104). Однако значительное ( P = 0,007) увеличение количества уникальных видов бактерий наблюдалось в образцах с языка (рис. 2C) у пациентов с NoDS по сравнению с пациентами с DS.

Рис. 2

График в виде прямоугольников и усов, показывающий анализ индекса Чао для каждого участка отбора проб. Количество уникальных бактериальных операционных таксономических единиц (OTU) для пациентов с DS (синий) по сравнению с пациентами без DS (красный) в образцах поверхности протезирования ( A ), ( B ) поверхности слизистой оболочки неба и ( C ) язычок. Значительное ( P = 0,007) уменьшение количества обнаруженных OTU наблюдалось в образцах с языка пациентов с DS, но наблюдались сильные сходства в образцах поверхности, подходящей для протезирования, и неба.

Индекс Шеннона был рассчитан (рис. 3) как показатель численности и равномерности распространения OTU, чтобы указать на разнообразие в выборках. Никаких существенных различий ( P > 0,05) не наблюдалось между пациентами DS и NoDS для любого участка выборки.Это свидетельствовало о том, что частота OTU была более равномерно распределена по всей популяции, чем кластеры с более высокой относительной численностью, связанные с меньшей группой конкретных видов бактерий. Для образцов NoDS со слизистой оболочки неба наблюдался немного более высокий индекс Шеннона, чем для образцов DS, что указывает на то, что различия в равномерности распределения между частотой бактериальных видов могли присутствовать, но различия были незначительными и незначительными.

Рис. 3

График в виде прямоугольников и усов, показывающий анализ индекса Шеннона для каждого участка отбора пробы.Обширность и равномерность распределения связаны с обилием бактериальных операционных таксономических единиц (OTU) у пациентов с DS (синий) по сравнению с пациентами без DS (красный) в образцах ( A ) поверхности для протезирования, ( B ) ) поверхность слизистой оболочки неба и ( C ) язык. Общее увеличение индекса Шеннона для каждого участка выборки указывает на более высокое разнообразие и более равномерное распределение численности в выборках от пациентов без клинических проявлений СД по сравнению с пациентами с СД.

Сообщества микроорганизмов могут быть сгруппированы по общему сходству бактериальной микробиоты и представлены графически, чтобы показать, являются ли кластеры отдельными. Если группы образцов перекрываются, они не считаются разнородными. Неметрические графики многомерного масштабирования были созданы для каждого участка выборки (рис. 4). Распространение точек данных и тенденции, обозначенные эллипсами групп пациентов DS и NoDS, в этом анализе значительно перекрывались для всех участков выборки.Это указывало на то, что бактериальная микробиота в целом не считалась отдельной, но как таковая показывала большее общее сходство между здоровым и болезненным состояниями. Разброс результатов указывает на некоторые различия между образцами и врожденную вариабельность между пациентами.

Рисунок 4

Графики неметрической многомерной шкалы (NMDS) стоматита, связанного с зубными протезами (DS), по сравнению с группами без DS (NoDS). Метод ординации NMDS: анализ образцов в группах DS и NoDS для каждого участка отбора проб для выявления отдельных кластеров групп.( A ) Поверхность, подходящая для протезирования, ( B ) поверхность слизистой оболочки неба и ( C ) язык. Наблюдались перекрывающиеся группы образцов, поэтому общая бактериальная микробиота не была различима.

Наличие и различия в относительной численности бактерий, проанализированных на уровне родов и видов

Несмотря на отсутствие очевидных различий в родовой микробиоте при совокупном рассмотрении (рис. 5) при анализе различий относительной численности между DS и NoDS в каждом образце site, были обнаружены поразительные отличия.Данные, представленные на рис. 5 (с соответствующими конкретными числовыми пропорциями, представленными в дополнительных таблицах S1 – S3) демонстрируют долю каждого обнаруженного рода как среднее значение для всех участников в этой выборочной группе, где наблюдались многие существенные различия. В образцах поверхности, подходящей для протезирования (рис. 5A, B), наблюдался ряд сдвигов, особенно в родах, связанных с 15 ведущими родами по средней численности. В образцах, связанных с DS, было очевидным увеличение относительной численности Streptococcus , Pseudomonas и Stenotrophomonas с уменьшением относительной численности Actinomyces , Serratia и Rhizobium .

Рисунок 5

Графические представления круговой диаграммы, показывающие среднюю относительную численность бактериальных родов на каждом участке отбора проб. Топ-15 бактериальных родов (по средней численности) в образцах поверхности, подходящей для протезирования, от пациентов ( A ) с DS и ( B ) без DS, образцы неба от пациентов ( C ) с DS и ( D ) без DS, а также образцы языка от пациентов ( E ) с DS и ( F ) без DS.

Сдвиги в относительной численности родов также наблюдались в образцах из других участков, включая значительное увеличение относительной численности, наблюдаемое у Streptococcus , Masillia и Acinetobacter в образцах неба (рис. 5C, D) и Streptococcus и Enterococcus в образцах языка (рис. 5E, F). Значительное снижение количества родов, включая Serratia , Lactobacillus и Flavobacterium , было очевидным в образцах неба, и аналогичным образом снижение у Serratia и Flavobacterium наблюдалось в образцах языка.

При рассмотрении микробиоты на уровне видов, относительная доля различных видов бактерий значительно варьировалась между образцами и пациентами (рис. 6; дополнительные таблицы S4–6). В целом, 25 основных видов бактерий по средней численности составляли более 85% от общей численности видов бактерий, а в случае образцов со слизистой оболочки неба пациентов с СД — 98% от общей численности.

Рисунок 6

Средняя относительная численность 10 основных видов бактерий, общих для групп пациентов с DS (синий) и NoDS (красный), в образцах поверхности, подходящей для протезирования ( A ), ( B ) неба, и ( C ) язык.

Сотни уникальных видов бактерий были обнаружены в каждом из образцов. Многие виды были уникальными для пациентов с DS или NoDS и могут способствовать возникновению DS. Однако среди видов бактерий, обнаруженных как у пациентов с DS, так и у пациентов с NoDS, были обнаружены некоторые существенные различия в относительной численности (рис. 6).

В образцах поверхностей, прилегающих к зубным протезам пациентов с NoDS (рис. 6A), относительные доли Acinetobacter johnsonii и Streptococcus mitis были почти в три раза выше по сравнению с пациентами с DS, а доля Actinomyces odontolyticus была почти в три раза выше. были почти в шесть раз выше.Также наблюдались дополнительные различия, но в меньшей степени. Они включали уменьшение присутствия Pseudomonas putida , A . lwoffii , Lactobacillus salivarius и небольшое уменьшение A . lingnae в образцах от пациентов с NoDS. Кроме того, два из трех наиболее распространенных видов бактерий в образцах прилегающей поверхности протеза были уникальными для группы DS. К ним относятся неизвестные виды из рода Myroides и Pseudomonas fluorescens с относительной численностью примерно 8.5% и 7,2% соответственно. Присутствие Myroides не было обнаружено ни на одном другом участке отбора проб.

Дальнейшие различия наблюдались для микробиоты слизистой оболочки неба (рис. 6B). Pseudomonas fluorescens был бактериальным видом с наибольшей представленностью у пациентов с DS, но также был обнаружен у пациентов с NoDS. Тем не менее, была существенная разница в средней относительной численности со снижением с 19,99% у пациентов с DS до 2,34% у пациентов с NoDS.Это была самая большая разница для всех видов бактерий, независимо от места отбора пробы. Кроме того, было очевидно более чем шестикратное увеличение доли Brevundimonas vesicularis у пациентов с NoDS по сравнению с пациентами с DS. И наоборот, снижение на S . oralis , Chrysobacterium spp., B . terrae и небольшое уменьшение A . johnsonii наблюдались у пациентов с NoDS. Как также было очевидно на образцах посадочной поверхности зубных протезов, в группах DS и NoDS был обнаружен ряд уникальных видов бактерий.

Streptococcus salivarius был обнаружен с наибольшей относительной численностью в образцах с языка (рис. 6С). Небольшое сокращение наблюдалось между пациентами с DS и NoDS примерно на 3% (DS = 18,41%, NoDS = 15,37%), но численность по-прежнему была выше, чем у всех других бактерий, обнаруженных в образцах языка пациентов с DS или NoDS. Большие различия наблюдались в доле Р . fluorescens между DS (12,48%) и NoDS (2,06%) и S . mitis (DS = 6,09%, NoDS = 11,18%). Меньшие различия наблюдались с другими видами бактерий, общими между пациентами с DS и NoDS, но их пропорциональный вклад в микробиоту составлял примерно 2% или меньше, поэтому степень различий была менее очевидной.

Когда пациенты были разделены на подгруппы по статусу курения, были очевидны некоторые четкие различия в относительной численности ОТЕ. Сильное сходство в количестве ОТЕ, обнаруженных на образцах поверхности, подходящей для протезирования, было очевидным между курильщиками и некурящими, независимо от состояния СД (рис.7А). Однако в образцах из биотических участков (рис. 7B, C) у курильщиков с DS было значительно меньшее количество обнаруженных OTU, чем во всех других группах ( P <0,05 по сравнению с некурящими с DS и некурящими без DS. , и P <0,01 по сравнению с курильщиками с DS), так что в образцах с языка (рис. 7C).

Рис. 7

Ящики и усы, показывающие анализ индекса Чао, с образцами, сгруппированными по участку отбора пробы, состоянию DS и подгруппам по статусу курения. Значительное снижение наблюдалось у курильщиков с DS по сравнению с некурящими с DS и некурящими без DS ( P <0.05) и курильщиков без DS ( P <0,01) в образцах языка, но не наблюдали значительных различий в образцах поверхности, прилегающей к зубному протезу. Образцы неба показали сходную тенденцию с образцом языка, но не имели статистической значимости.

Изменения слизистой оболочки полости рта, вызванные противоопухолевой терапией и ингибиторами иммунных контрольных точек.

  • 1.

    Sacco AG, Cohen EE (2015) Современные варианты лечения рецидивирующей или метастатической плоскоклеточной карциномы головы и шеи. J Clin Oncol 33: 3305–3313

    CAS PubMed Статья Google ученый

  • 2.

    Сампат К.Р., О’Нил Б. (2013) Антиангиогенная терапия запущенной гепатоцеллюлярной карциномы. Онколог 18: 430–438

    CAS PubMed PubMed Central Статья Google ученый

  • 3.

    Кунду С.К., Нестор М. (2012) Таргетная терапия при раке головы и шеи. Tumor Biol 33: 707–721

    CAS PubMed Статья Google ученый

  • 4.

    Johnson DB, Pollack MH, Sosman JA (2016) Новые целевые методы лечения меланомы. Мнение эксперта Emerg Drugs 21: 195–207

    CAS PubMed Статья Google ученый

  • 6.

    Rizvi NA, Mazières J, Planchard D, Stinchcombe TE, Dy GK, Antonia SJ et al (2015) Активность и безопасность ниволумаба, ингибитора иммунных контрольных точек анти-PD-1, для пациентов с прогрессирующим рефрактерным плоскоклеточным немелкоземным поражением. клеточный рак легкого (CheckMate 063): фаза 2, одноранговое испытание. Ланцет Онкол 16: 257–265

    CAS PubMed Статья Google ученый

  • 7.

    Motzer RJ, Hutson TE, Glen H, Michaelson MD, Molina A, Eisen T et al (2015) Ленватиниб, эверолимус и комбинация у пациентов с метастатической почечно-клеточной карциномой: рандомизированная, фаза 2, открытая -лейбл, многоцентровое исследование. Ланцет Онкол 16: 1473–1482

    CAS PubMed Статья Google ученый

  • 8.

    Robert C, Schachter J, Long GV, Arance A, Grob JJ, Mortier L et al (2015) Сравнение пембролизумаба и ипилимумаба при запущенной меланоме. N Engl J Med 372: 2521–2532

    CAS PubMed Статья Google ученый

  • 9.

    Robert C, Long GV, Brady B, Dutriaux C, Maio M, Mortier L et al (2015) Ниволумаб при ранее нелеченой меланоме без мутации BRAF.N Engl J Med 372: 320–330

    CAS PubMed Статья Google ученый

  • 10.

    Пеннок Г.К., Чоу Л.К. (2015) Растущая роль ингибиторов иммунных контрольных точек в лечении рака. Онколог 20: 812–822

    CAS PubMed PubMed Central Статья Google ученый

  • 11.

    Wang J, Reiss KA, Khatri R, Jaffee E, Laheru D (2015) Иммунотерапия злокачественных новообразований желудочно-кишечного тракта: обзор.J Clin Oncol 33: 1745–1753

    CAS PubMed PubMed Central Статья Google ученый

  • 12.

    Macdonald JB, Macdonald B, Golitz LE, LoRusso P, Sekulic A (2015) Кожные побочные эффекты таргетной терапии: часть I: ингибиторы клеточной мембраны. J Am Acad Dermatol 72: 203–218

    CAS PubMed Статья Google ученый

  • 13.

    Macdonald JB, Macdonald B, Golitz LE, LoRusso P, Sekulic A (2015) Кожные побочные эффекты таргетной терапии: часть II: ингибиторы внутриклеточных молекулярных сигнальных путей.J Am Acad Dermatol 72: 221–236

    CAS PubMed Статья Google ученый

  • 14.

    Роберт К., Сибо В., Матеус С., Черпелис Б.С. (2012) Достижения в управлении кожной токсичностью при таргетной терапии. Семин Онкол 39: 227–240

    CAS PubMed Статья Google ученый

  • 15.

    Роберт С., Матеус С., Спатц А., Векслер Дж., Эскудье Б. (2009) Дерматологические симптомы, связанные с ингибитором мультикиназ сорафенибом.J Am Acad Dermatol 60: 299–305

    PubMed Статья Google ученый

  • 17.

    Роберт С., Сориа Дж. К., Спатц А., Ле Сесне А., Малка Д., Потье П. и др. (2005) Кожные побочные эффекты ингибиторов киназ и блокирующих антител.Ланцет Онкол 6: 491–500

    CAS PubMed Статья Google ученый

  • 18.

    Reyes-Habito CM, Roh EK (2014) Кожные реакции на химиотерапевтические препараты и таргетная терапия рака: часть II. Таргетная терапия. J Am Acad Dermatol 71: 217.e1–217.e11

    CAS Статья PubMed Google ученый

  • 20.

    Sibaud V, Meyer N, Lamant L, Vigarios E, Mazieres J, Delord JP (2016) Дерматологические осложнения иммунных контрольных антител против PD-1 / PD-L-1. Curr Opinion Oncol 28: 254–263

    CAS Статья Google ученый

  • 21.

    Sibaud V, Boralevi F, Vigarios E, Fricain JC (2014) Оральная токсичность таргетных противоопухолевых методов лечения.Ann Dermatol Venereol 141: 354–363 [Статья на французском языке]

    CAS PubMed Статья Google ученый

  • 23.

    Уоттерс А.Л., Эпштейн Дж. Б., Агульник М. (2011) Устные осложнения таргетных методов лечения рака: обзор повествовательной литературы.Oral Oncol 47: 441–448

    CAS PubMed Статья Google ученый

  • 24.

    Дженсен С.Б., Петерсон Д.Е. (2014) Повреждение слизистой оболочки полости рта, вызванное методами лечения рака: текущее лечение и новые рубежи в исследованиях. J Oral Pathol Med 43: 81–90

    PubMed Статья Google ученый

  • 26.

    Аль-Ансари С., Зеха Дж. А., Бараш А., де Ланге Дж, Розема Ф. Р., Рабер-Дурлахер Дж. Э. (2015) Мукозит полости рта, вызванный противоопухолевой терапией. Curr Oral Health Rep 2: 202–211

    PubMed PubMed Central Статья Google ученый

  • 27.

    Sonis S, Treister N, Chawla S, Demetri G, Haluska F (2010) Предварительная характеристика поражений полости рта, связанных с ингибиторами мишени рапамицина млекопитающих у онкологических больных. Рак 116: 210–215

    CAS PubMed Google ученый

  • 28.

    Boers-Doets CB, Epstein JB, Raber-Durlacher JE, Ouwerkerk J, Logan RM, Brakenhoff JA et al (2012) Пероральные побочные эффекты, связанные с тирозинкиназой и мишенью для млекопитающих ингибиторов рапамицина при почечно-клеточной карциноме: структурированный обзор литературы. Онколог 17: 135–144

    CAS PubMed Статья Google ученый

  • 29.

    Gomez-Fernandez C, Garden BC, Wu S, Feldman DR, Lacouture ME (2012) Риск кожной сыпи и стоматита с мишенью для млекопитающих ингибитора рапамицина темсиролимус: систематический обзор литературы и метаанализ. Eur J Cancer 48: 340–346

    CAS PubMed Статья Google ученый

  • 31.

    Vigarios E, Lamant L, Delord JP, Fricain JC, Chevreau C, Barrés B et al (2015) Плоскоклеточный рак полости рта и гиперкератотические поражения с ингибиторами BRAF. Br J Dermatol 172: 1680–1682

    CAS PubMed Статья Google ученый

  • 32.

    De Oliveira MA, Martins E, Martins F, Wang Q, Sonis S, Demetri G et al (2011) Клиническая картина и лечение стоматита, связанного с ингибитором mTOR. Oral Oncol 47: 998–1003

    PubMed Статья CAS Google ученый

  • 33.

    Peterson DE, Boers-Doets CB, Bensadoun RJ, Herrstedt J, Guidelines Committee ESMO (2015) Лечение травм слизистой оболочки полости рта и желудочно-кишечного тракта: клинические практические рекомендации ESMO по диагностике, лечению и наблюдению. Ann Oncol 26: v139 – v151

    PubMed Статья Google ученый

  • 34.

    Topalian SL, Sznol M, McDermott DF, Kluger HM, Carvajal RD, Sharfman WH et al (2014) Выживаемость, стойкая ремиссия опухоли и долгосрочная безопасность у пациентов с запущенной меланомой, получающих ниволумаб. J Clin Oncol 32: 1020–1030

    CAS PubMed PubMed Central Статья Google ученый

  • 36.

    McDermott DF, Sosman JA, Sznol M, Massard C, Gordon MS, Hamid O et al (2016) Атезолизумаб, антитело против лиганда 1 запрограммированной смерти, при метастатической почечно-клеточной карциноме: долгосрочная безопасность , клиническая активность и иммунные корреляты из исследования фазы Ia. J Clin Oncol 34: 833–842

    CAS PubMed Статья Google ученый

  • 37.

    Джексон Л.К., Джонсон Д.Б., Сосман Дж. А., Мерфи Б. А., Эпштейн Дж. Б. (2015) Здоровье полости рта в онкологии: влияние иммунотерапии. Support Care Cancer 23: 1–3

    PubMed Статья Google ученый

  • 38.

    Ши В.Дж., Родик Н., Геттингер С., Левенталь Дж. С., Некман Дж. П., Жирарди М. и др. (2016) Клинические и гистологические особенности лихеноидных кожно-слизистых высыпаний из-за антипрограммированной гибели клеток 1 и антипрограммированной гибели клеток лиганд 1 иммунотерапия.JAMA Dermatol 152: 1128–1136

    PubMed Статья Google ученый

  • 39.

    Shameem R, Lacouture M, Wu S (2015) Заболеваемость и риск стоматита высокой степени с ингибиторами mTOR у онкологических больных. Исследование рака 33: 70–77

    CAS Статья Google ученый

  • 41.

    Vargo CA, Berger MJ, Phillips G, Mrozek E (2016) Возникновение и характеристика побочных эффектов эверолимуса во время первого и последующих циклов лечения метастатического рака молочной железы. Support Care Cancer 24: 2913–2918

    PubMed Google ученый

  • 42.

    Rugo HS, Hortobagyi GN, Yao J, Pavel M, Ravaud A, Franz D et al (2016) Мета-анализ стоматита в клинических исследованиях эверолимуса: частота и взаимосвязь с эффективностью.Энн Онкол 27: 519–525

    CAS PubMed PubMed Central Статья Google ученый

  • 44.

    Baselga J, Campone M, Piccart M, Burris HA, Rugo HS, Sahmoud T. et al (2012) Эверолимус при постменопаузальном гормонально-рецепторно-положительном прогрессирующем раке молочной железы.N Engl J Med 366: 520–529

    CAS PubMed Статья Google ученый

  • 45.

    Armstrong AJ, Halabi S, Eisen T, Broderick S, Stadler WM, Jones RJ et al (2016) Сравнение эверолимуса и сунитиниба у пациентов с метастатической непрозрачной почечно-клеточной карциномой (ASPEN): многоцентровое, открытое метка, рандомизированное испытание фазы 2. Ланцет Онкол 17: 378–388

    CAS PubMed Статья Google ученый

  • 46.

    André F, O’Regan R, Ozguroglu M, Toi M, Xu B, Jerusalem G et al (2014) Эверолимус для женщин с трастузумаб-резистентным, HER2-положительным, распространенным раком груди (BOLERO-3): рандомизированный двойной -слепое плацебо-контролируемое исследование фазы 3. Ланцет Онкол 15: 580–591

    PubMed Статья CAS Google ученый

  • 47.

    Motzer RJ, Escudier B, McDermott DF, George S, Hammers HJ, Srinivas S. et al (2015) Сравнение ниволумаба и эверолимуса при почечно-клеточной карциноме на поздней стадии.N Engl J Med 373: 1803–1813

    CAS PubMed Статья Google ученый

  • 49.

    Hudes G, Carducci M, Tomczak P, Dutcher J, Figlin R, Kapoor A et al (2007) Темсиролимус, интерферон альфа или оба препарата для лечения прогрессирующей почечно-клеточной карциномы.N Engl J Med 356: 2271–2281

    CAS PubMed Статья Google ученый

  • 50.

    Wolff AC, Lazar AA, Bondarenko I, Garin AM, Brincat S, Chow L et al (2013) Рандомизированное плацебо-контролируемое испытание фазы III летрозола плюс пероральный темсиролимус в качестве эндокринной терапии первой линии у женщин в постменопаузе с местнораспространенный или метастатический рак груди. J Clin Oncol 31: 195–202

    CAS PubMed Статья Google ученый

  • 51.

    Hutson TE, Escudier B, Esteban E, Bjarnason GA, Lim HY, Pittman KB et al (2014) Рандомизированное испытание фазы III темсиролимуса по сравнению с сорафенибом в качестве терапии второй линии после сунитиниба у пациентов с метастатической почечно-клеточной карциномой. J Clin Oncol 32: 760–767

    CAS PubMed Статья Google ученый

  • 52.

    Rini BI, Bellmunt J, Clancy J, Wang K, Niethammer AG, Hariharan S. et al (2014) Рандомизированное испытание фазы III темсиролимуса и бевацизумаба по сравнению с интерфероном альфа и бевацизумабом при метастатической почечно-клеточной карциноме: испытание INTORACT.J Clin Oncol 32: 752–759

    CAS PubMed Статья Google ученый

  • 54.

    Park K, Tan EH, O’Byrne K, Zhang L, Boyer M, Mok T. et al (2016) Афатиниб по сравнению с гефитинибом в качестве лечения первой линии пациентов с немелкоклеточным раком легкого с положительным результатом мутации EGFR (LUX- Легкое 7): открытое рандомизированное контролируемое исследование фазы 2B. Ланцет Онкол 17: 577–589

    CAS PubMed Статья Google ученый

  • 55.

    Miller VA, Hirsh V, Cadranel J, Chen YM, Park K, Kim SW et al (2012) Афатиниб по сравнению с плацебо для пациентов с запущенным метастатическим немелкоклеточным раком легкого после неэффективности эрлотиниба, гефитиниба , или оба, и одна или две линии химиотерапии (LUX-Lung 1): рандомизированное исследование фазы 2b / 3. Ланцет Онкол 13: 528–538

    CAS PubMed Статья Google ученый

  • 56.

    Wu YL, Zhou C, Hu CP, Feng J, Lu S, Huang Y et al (2014) Афатиниб по сравнению с цисплатином плюс гемцитабин для лечения первой линии азиатских пациентов с распространенным немелкоклеточным раком легкого несущие мутации EGFR (LUX-Lung 6): открытое рандомизированное исследование фазы 3. Ланцет Онкол 15: 213–222

    CAS PubMed Статья Google ученый

  • 57.

    Machiels JP, Haddad RI, Fayette J, Licitra LF, Tahara M, Vermorken JB et al (2015) Афатиниб по сравнению с метотрексатом в качестве лечения второй линии у пациентов с рецидивирующей или метастатической плоскоклеточной карциномой головы и шеи, прогрессирующей после или после Платиновая терапия (LUX-Head & Neck 1): открытое рандомизированное исследование фазы 3. Ланцет Онкол 16: 583–594

    CAS PubMed Статья Google ученый

  • 58.

    Soria JC, Felip E, Cobo M, Lu S., Syrigos K, Lee KH et al (2015) Сравнение афатиниба и эрлотиниба в качестве терапии второй линии пациентов с запущенной плоскоклеточной карциномой легкого (LUX-Lung 8): открытое рандомизированное контролируемое исследование фазы 3.Ланцет Онкол 16: 897–907

    CAS PubMed Статья Google ученый

  • 59.

    Sequist LV, Yang JC, Yamamoto N, O’Byrne K, Hirsh V, Mok T. et al (2013) Исследование фазы III афатиниба или цисплатина плюс пеметрексед у пациентов с метастатической аденокарциномой легкого с мутациями EGFR. J Clin Oncol 31: 3327–3334

    CAS PubMed Статья Google ученый

  • 61.

    Geyer CE, Forster J, Lindquist D, Chan S, Romieu CG, Pienkowski T. et al (2006) Лапатиниб плюс капецитабин при HER2-положительном распространенном раке молочной железы.N Engl J Med 355: 2733–2743

    CAS PubMed Статья Google ученый

  • 62.

    Goss PE, Smith IE, O’Shaughnessy J, Ejlertsen B, Kaufmann M, Boyle F et al (2013) Адъювант лапатиниб для женщин с ранней стадией HER2-положительного рака молочной железы: рандомизированная контролируемая фаза 3 проба. Ланцет Онкол 14: 88–96

    CAS PubMed Статья Google ученый

  • 63.

    Mok TS, Wu YL, Thongprasert S, Yang CH, Chu DT, Saijo N et al (2009) Гефитиниб или карбоплатин-паклитаксел при аденокарциноме легких. N Engl J Med 361: 947–957

    CAS PubMed Статья Google ученый

  • 64.

    Mitsudomi T, Morita S, Yatabe Y, Negoro S, Okamoto I, Tsurutani J et al (2010) Гефитиниб по сравнению с цисплатином плюс доцетаксел у пациентов с немелкоклеточным раком легкого, несущим мутации эпидермального фактора роста рецептор (WJTOG3405): открытое рандомизированное исследование фазы 3.Ланцет Онкол 11: 121–128

    CAS PubMed Статья Google ученый

  • 66.

    Ciuleanu T, Stelmakh L, Cicenas S, Miliauskas S, Grigorescu AC, Hillenbach C et al (2012) Эффективность и безопасность эрлотиниба по сравнению с химиотерапией при лечении второй линии пациентов с распространенным немелкоклеточным раком легкого с плохим прогнозом (TITAN): рандомизированное многоцентровое открытое исследование фазы 3. Ланцет Онкол 13: 300–308

    CAS PubMed Статья Google ученый

  • 68.

    Shepherd FA, Rodrigues Pereira J, Ciuleanu T., Tan EH, Hirsh V, Thongprasert S. et al (2005) Эрлотиниб при ранее леченном немелкоклеточном раке легкого. N Engl J Med 353: 123–132

    CAS PubMed Статья Google ученый

  • 69.

    Ellis PM, Shepherd FA, Millward M, Perrone F, Seymour L, Liu G et al (2014) Сравнение дакомитиниба с плацебо у предварительно получавших лечение пациентов с распространенным или метастатическим немелкоклеточным раком легкого (NCIC CTG BR . 26): двойное слепое рандомизированное исследование фазы 3. Lancet Oncol 15: 1379–1388

    CAS PubMed Статья Google ученый

  • 70.

    Jänne PA, Ou SH, Kim DW, Oxnard GR, Martins R, Kris MG et al (2014) Дакомитиниб в качестве лечения первой линии у пациентов с клинически или молекулярно выбранным распространенным немелкоклеточным раком легкого: многоцентровое открытое исследование фазы 2. Ланцет Онкол 15: 1433–1441

    PubMed Статья CAS Google ученый

  • 71.

    Cunningham D, Humblet Y, Siena S, Khayat D, Bleiberg H, Santoro A et al (2004) Монотерапия цетуксимабом и цетуксимаб плюс иринотекан при резистентном к иринотекану метастатическом колоректальном раке. N Engl J Med 351: 337–345

    CAS PubMed Статья Google ученый

  • 72.

    Price TJ, Peeters M, Kim TW, Li J, Cascinu S, Ruff P et al (2014) Сравнение панитумумаба и цетуксимаба у пациентов с резистентным к химиотерапии метастатическим колоректальным раком KRAS экзона 2 дикого типа (ASPECCT): рандомизированное, многоцентровое, открытое исследование фазы 3 не меньшей эффективности.Ланцет Онкол 15: 569–579

    CAS PubMed Статья Google ученый

  • 73.

    Bonner JA, Harari PM, Giralt J, Cohen RB, Jones CU, Sur RK et al (2010) Лучевая терапия плюс цетуксимаб при локорегионально распространенном раке головы и шеи: данные о 5-летней выживаемости из рандомизированного исследования фазы 3 и связь между сыпью, вызванной цетуксимабом, и выживаемостью. Ланцет Онкол 11: 21–28

    CAS PubMed Статья Google ученый

  • 74.

    Magrini SM, Buglione M, Corvò R, Pirtoli L, Paiar F, Ponticelli P et al (2016) Цетуксимаб и лучевая терапия в сравнении с цисплатином и лучевой терапией при местнораспространенном раке головы и шеи: рандомизированное исследование фазы II. J Clin Oncol 34: 427–435

    CAS PubMed Статья Google ученый

  • 75.

    Bonner JA, Harari PM, Giralt J, Azarnia N, Shin DM, Cohen RB et al (2006) Лучевая терапия плюс цетуксимаб для плоскоклеточного рака головы и шеи.N Engl J Med 354: 567–578

    CAS PubMed Статья Google ученый

  • 76.

    Ang KK, Zhang Q, Rosenthal DI, Nguyen-Tan PF, Sherman EJ, Weber RS ​​et al (2014) Рандомизированное испытание фазы III одновременного ускоренного облучения плюс цисплатин с цетуксимабом или без цетуксимаба для стадии III-IV головы и карцинома шеи: RTOG 0522. J Clin Oncol 32: 2940–2950

    CAS PubMed PubMed Central Статья Google ученый

  • 77.

    Lordick F, Kang YK, Chung HC, Salman P, Oh SC, Bodoky G et al (2013) Капецитабин и цисплатин с цетуксимабом или без него для пациентов с ранее нелеченным распространенным раком желудка (EXPAND): рандомизированная открытая фаза 3 испытание. Ланцет Онкол 14: 490–499

    CAS PubMed Статья Google ученый

  • 78.

    Kim ES, Neubauer M, Cohn A, Schwartzberg L, Garbo L, Caton J et al (2013) Доцетаксел или пеметрексед с цетуксимабом или без него при рецидивирующем или прогрессирующем немелкоклеточном раке легкого после применения платины терапия: открытое рандомизированное исследование фазы 3.Ланцет Онкол 14: 1326–1336

    CAS PubMed Статья Google ученый

  • 79.

    Primrose J, Falk S, Finch-Jones M, Valle J, O’Reilly D, Siriwardena A et al (2014) Системная химиотерапия с цетуксимабом или без него у пациентов с резектабельными колоректальными метастазами в печень: рандомизированный новый EPOC контролируемое испытание. Ланцет Онкол 15: 601–611

    CAS PubMed Статья Google ученый

  • 80.

    Vermorken JB, Stöhlmacher-Williams J, Davidenko I, Licitra L, Winquist E, Villanueva C et al (2013) Цисплатин и фторурацил с панитумумабом или без него у пациентов с рецидивирующей или метастатической плоскоклеточной карциномой головы и шеи (SPECTRUM) : открытое рандомизированное исследование фазы 3. Ланцет Онкол 14: 697–710

    CAS PubMed Статья Google ученый

  • 81.

    Leone F, Marino D, Cereda S, Filippi R, Belli C, Spadi R et al (2016) Панитумумаб в сочетании с гемцитабином и оксалиплатином не продлевает выживаемость при распространенном раке желчных путей KRAS дикого типа: a рандомизированное исследование фазы 2 (исследование Vecti-BIL).Рак 122: 574–581

    CAS PubMed Статья Google ученый

  • 82.

    Waddell T, Chau I, Cunningham D, Gonzalez D, Okines AF, Okines C et al (2013) Эпирубицин, оксалиплатин и капецитабин с панитумумабом или без него для пациентов с ранее нелеченным распространенным раком пищевода и пищевода (REAL3): рандомизированное открытое исследование фазы 3. Ланцет Онкол 14: 481–489

    CAS PubMed PubMed Central Статья Google ученый

  • 83.

    Motzer RJ, Porta C, Vogelzang NJ, Sternberg CN, Szczylik C, Zolnierek J et al (2014) Довитиниб против сорафениба для таргетного лечения третьей линии пациентов с метастатической почечно-клеточной карциномой: открытое рандомизированное исследование фазы 3. Ланцет Онкол 15: 286–296

    CAS PubMed Статья Google ученый

  • 84.

    Motzer RJ, Escudier B, Tomczak P, Hutson TE, Michaelson MD, Negrier S. et al (2013) Акситиниб против сорафениба в качестве терапии второй линии для лечения прогрессирующей почечно-клеточной карциномы: общий анализ выживаемости и обновленные результаты рандомизированное исследование фазы 3.Ланцет Онкол 14: 552–562

    CAS PubMed Статья Google ученый

  • 85.

    Cheng AL, Kang YK, Lin DY, Park JW, Kudo M, Qin S. et al (2013) Сунитиниб против сорафениба при распространенном гепатоцеллюлярном раке: результаты рандомизированного исследования фазы III. J Clin Oncol 31: 4067–4075

    CAS PubMed Статья Google ученый

  • 86.

    Motzer RJ, Hutson TE, Cella D, Reeves J, Hawkins R, Guo J et al (2013) Пазопаниб против сунитиниба при метастатической почечно-клеточной карциноме.N Engl J Med 369: 722–731

    CAS PubMed Статья Google ученый

  • 87.

    Motzer RJ, Hutson TE, Tomczak P, Michaelson MD, Bukowski RM, Rixe O et al (2007) Сунитиниб против интерферона альфа при метастатической почечно-клеточной карциноме. N Engl J Med 356: 115–124

    CAS PubMed Статья Google ученый

  • 88.

    Raymond E, Dahan L, Raoul JL, Bang YJ, Borbath I, Lombard-Bohas C et al (2011) Малат сунитиниба для лечения нейроэндокринных опухолей поджелудочной железы.N Engl J Med 364: 501–513

    CAS PubMed Статья Google ученый

  • 89.

    Gore ME, Szczylik C, Porta C, Bracarda S, Bjarnason GA, Oudard S. et al (2009) Безопасность и эффективность сунитиниба при метастатической почечно-клеточной карциноме: исследование с расширенным доступом. Ланцет Онкол 10: 757–763

    CAS PubMed Статья Google ученый

  • 90.

    Elisei R, Schlumberger MJ, Müller SP, Schöffski P, Brose MS, Shah MH et al (2013) Кабозантиниб при прогрессирующем медуллярном раке щитовидной железы.J Clin Oncol 31: 3639–3646

    CAS PubMed PubMed Central Статья Google ученый

  • 91.

    Tournigand C, Chibaudel B, Samson B, Scheithauer W., Vernerey D, Mésange P et al (2015) Бевацизумаб с эрлотинибом или без него в качестве поддерживающей терапии у пациентов с метастатическим колоректальным раком (GERCOR DREAM; OPTIMOX3): a рандомизированное открытое исследование фазы 3. Ланцет Онкол 16: 1493–1505

    CAS PubMed Статья Google ученый

  • 92.

    O’Brien SG, Guilhot F, Larson RA, Gathmann I, Baccarani M, Cervantes F et al (2003) Иматиниб в сравнении с интерфероном и низкими дозами цитарабина при недавно диагностированном хроническом миелолейкозе в хронической фазе. N Engl J Med 348: 994–1004

    PubMed Статья Google ученый

  • 93.

    Demetri GD, von Mehren M, Blanke CD, Van den Abbeele AD, Eisenberg B, Roberts PJ et al (2002) Эффективность и безопасность мезилата иматиниба при запущенных стромальных опухолях желудочно-кишечного тракта.N Engl J Med 347: 472–480

    CAS PubMed Статья Google ученый

  • 94.

    Raymond E, Brandes AA, Dittrich C, Fumoleau P, Coudert B, Clement PM et al (2008) Фаза II исследования иматиниба у пациентов с рецидивирующими глиомами различной гистологии: Европейская организация по исследованию и лечению Групповое исследование рака головного мозга. J Clin Oncol 26: 4659–4665

    CAS PubMed PubMed Central Статья Google ученый

  • 95.

    Shaw AT, Kim DW, Nakagawa K, Seto T, Crinó L, Ahn MJ et al (2013) Кризотиниб по сравнению с химиотерапией при распространенном ALK-положительном раке легкого. N Engl J Med 368: 2385–2394

    CAS PubMed Статья Google ученый

  • 96.

    Shaw AT, Ou SH, Bang YJ, Camidge DR, Solomon BJ, Salgia R et al (2014) Crizotinib при немелкоклеточном раке легкого с перестройкой ROS1. N Engl J Med 371: 1963–1971

    PubMed PubMed Central Статья CAS Google ученый

  • 97.

    Camidge DR, Bang YJ, Kwak EL, Iafrate AJ, Varella-Garcia M, Fox SB et al (2012) Активность и безопасность кризотиниба у пациентов с ALK-положительным немелкоклеточным раком легкого: обновленные результаты фазы 1 изучать. Ланцет Онкол 13: 1011–1019

    CAS PubMed PubMed Central Статья Google ученый

  • 98.

    Соломон Б.Дж., Мок Т., Ким Д.В., Ву Ю.Л., Накагава К., Мехайл Т. и др. (2014) Кризотиниб первой линии по сравнению с химиотерапией при ALK-положительном раке легкого.N Engl J Med 371: 2167–2177

    PubMed Статья CAS Google ученый

  • 99.

    Sekulic A, Migden MR, Oro AE, Dirix L, Lewis KD, Hainsworth JD et al (2012) Эффективность и безопасность висмодегиба при распространенной базально-клеточной карциноме. N Engl J Med 366: 2171–2179

    CAS PubMed PubMed Central Статья Google ученый

  • 100.

    Basset-Seguin N, Hauschild A, Grob JJ, Kunstfeld R, Dréno B, Mortier L et al (2015) Vismodegib у пациентов с распространенной базально-клеточной карциномой (STEVIE): предварительно запланированный промежуточный анализ международное открытое испытание.Ланцет Онкол 16: 729–736

    CAS PubMed Статья Google ученый

  • 101.

    Rugo HS (2016) Дозировка и значение безопасности для онкологов при введении эверолимуса пациентам с раком молочной железы, положительным по рецепторам гормонов. Clin рака груди 16: 18–22

    CAS PubMed Статья Google ученый

  • 102.

    Rugo HS, Pritchard KI, Gnant M, Noguchi S, Piccart M, Hortobagyi G et al (2014) Частота и динамика нежелательных явлений, связанных с эверолимусом, у женщин в постменопаузе с гормонально-положительным раком груди на поздней стадии: инсайты от БОЛЕРО-2.Энн Онкол 25: 808–815

    CAS PubMed PubMed Central Статья Google ученый

  • 103.

    Sonis ST (2009) Мукозит: влияние, биология и терапевтические возможности орального мукозита. Oral Oncol 45: 1015–1020

    CAS PubMed Статья Google ученый

  • 104.

    Sonis ST (2004) Патобиология мукозита. Nat Rev Cancer 4: 277–284

    CAS PubMed Статья Google ученый

  • 105.

    Nishimura N, Nakano K, Ueda K, Kodaira M, Yamada S, Mishima Y et al (2012) Проспективная оценка частоты и тяжести орального мукозита, вызванного традиционной химиотерапией при солидных опухолях и злокачественных лимфомах. Support Care Cancer 20: 2053–2059

    PubMed Статья Google ученый

  • 106.

    Elad S, Raber-Durlacher JE, Brennan MT, Saunders DP, Mank AP, Zadik Y et al (2015) Базовый уход за полостью рта для гематологических онкологических пациентов и реципиентов трансплантации гемопоэтических стволовых клеток: позиционный документ совместная рабочая группа Многонациональной ассоциации поддерживающей терапии при раке / Международного общества онкологии полости рта (MASCC / ISOO) и Европейского общества трансплантации крови и костного мозга (EBMT).Support Care Cancer 23: 223–236

    PubMed Статья Google ученый

  • 107.

    Лалла Р.В., Боуэн Дж., Бараш А., Элтинг Л., Эпштейн Дж., Киф Д.М. и др. (2014) Клинические рекомендации MASCC / ISOO по лечению мукозита, вторичного по отношению к терапии рака. Рак 120: 1453–1461

    PubMed PubMed Central Статья Google ученый

  • 108.

    Peterson ME (2013) Управление нежелательными явлениями у пациентов с гормональным рецептор-положительным раком молочной железы, получавших эверолимус: наблюдения из клинических испытаний фазы III.Support Care Cancer 21: 2341–2349

    PubMed PubMed Central Статья Google ученый

  • 109.

    McGuire DB, Fulton JS, Park J, Brown CG, Correa ME, Eilers J et al (2013) Систематический обзор базового ухода за полостью рта для лечения мукозита полости рта у онкологических больных. Support Care Cancer 21: 3165–3177

    PubMed Статья Google ученый

  • 110.

    Peterson DE, O’Shaughnessy JA, Rugo HS, Elad S, Schubert MM, Viet CT et al (2016) Повреждение слизистой оболочки полости рта, вызванное мишенью ингибиторов рапамицина у млекопитающих: новые перспективы патобиологии и влияние на клиническую практику .Cancer Med 5: 1897–1907

    CAS PubMed PubMed Central Статья Google ученый

  • 111.

    Руго Х.С., Сеневиратне Л., Бек Дж. Т., Гласпи Дж. А., Пегеро Дж. А., Плуард Т. Дж. И др. (2016) Профилактика стоматита эверолимус / экземестан у женщин в постменопаузе с метастатическим раком груди, положительным по рецепторам гормонов, с помощью жидкости для полоскания рта на основе дексаметазона: результаты исследования SWISH. Встреча ASCO Ann, плакат, 3–7 июня 2016 г. Чикаго, Иллинойс

  • 112.

    Porta C, Osanto S, Ravaud A, Climent MA, Vaishampayan U, White DA et al (2011) Управление побочными эффектами, связанными с использованием эверолимуса, у пациентов с запущенной почечно-клеточной карциномой. Eur J Cancer 47: 1287–1298

    CAS PubMed Статья Google ученый

  • 113.

    Zecha JA, Raber-Durlacher JE, Nair RG, Epstein JB, Elad S, Hamblin MR et al (2016) Низкоуровневая лазерная терапия / фотобиомодуляция в лечении побочных эффектов химиолучевой терапии в области головы и шеи рак: часть 2: предлагаемые приложения и протоколы лечения.Support Care Cancer 24: 2793–2805

    PubMed Статья Google ученый

  • 114.

    Paplomata E, Zelnak A, O’Regan R (2013) Everolimus: профиль побочных эффектов и лечение токсичности при раке груди. Лечение рака груди 140: 453–462

    CAS PubMed Статья Google ученый

  • 115.

    Porta C, Paglino C, Imariso I, Canipari C, Chen K, Neary M et al (2011) Безопасность и схемы лечения ингибиторов мультикиназы у пациентов с метастатической почечно-клеточной карциномой в онкологическом центре третичного уровня в Италии.BMC Cancer 11: 105–113

    CAS PubMed PubMed Central Статья Google ученый

  • 116.

    Квитковски В.Е., Prowell TM, Ибрагим А., Фаррелл А.Т., Джастис Р. (2010) Mitchell SS et al. Резюме одобрения FDA: темсиролимус как средство лечения прогрессирующей почечно-клеточной карциномы Онколог 15: 428–435

    CAS PubMed Google ученый

  • 117.

    Tuccori M, Lapi F, Testi A, Ruggiero E, Moretti U, Vannacci A et al (2011) Изменения вкуса и запаха, вызванные лекарственными средствами: оценка случая / отсутствия случая в итальянской базе данных спонтанных нежелательных явлений отчет о реакции на наркотики.Drug Saf 34: 849–859

    CAS PubMed Статья Google ученый

  • 118.

    Mosel DD, Bauer RL, Lynch DP, Hwang ST (2011) Устные осложнения при лечении онкологических больных. Устный доклад 17: 550–559

    CAS PubMed Статья Google ученый

  • 119.

    Zabernigg A, Gamper EM, Giesinger JM, Rumpold G, Kemmler G, Gattringer K et al (2010) Изменения вкуса у онкологических больных, получающих химиотерапию: игнорируемый побочный эффект? Онколог 15: 913–920

    CAS PubMed PubMed Central Статья Google ученый

  • 120.

    Имаи Х, Соеда Х, Комине К., Оцука К., Шибата Х (2013) Предварительная оценка распространенности дисгевзии, вызванной химиотерапией, у японских пациентов с раком. BMC Palliat Care 12:38

    PubMed PubMed Central Статья Google ученый

  • 121.

    Эпштейн Дж. Б., Бараш А. (2010) Расстройства вкуса у онкологических больных: патогенез и подход к оценке и лечению. Oral Oncol 46: 77–81

    PubMed Статья Google ученый

  • 122.

    Nagraj SK, Naresh S, Srinivas K, Renjith George P, Shrestha A, Levenson D et al (2014) Вмешательства для управления нарушениями вкуса. Кокрановская база данных Syst Rev 11: CD010470

    Google ученый

  • 123.

    Kim DW, Jung YS, Park HS, Jung HD (2013) Остеонекроз челюсти, связанный с эверолимусом: клинический случай. Br J Oral Maxillofac Surg 51: e302 – e304

    PubMed Статья Google ученый

  • 124.

    Hamadeh IS, Ngwa BA, Gong Y (2015) Остеонекроз челюсти, вызванный лекарствами. Лечение рака Ред. 41: 455–464

    CAS PubMed Статья Google ученый

  • 125.

    Lacouture ME, Anadkat MJ, Bensadoun RJ, Bryce J, Chan A, Epstein JB et al (2011) Руководство по клинической практике для профилактики и лечения дерматологической токсичности, связанной с ингибитором EGFR. Support Care Cancer 19: 1079–1095

    PubMed PubMed Central Статья Google ученый

  • 126.

    Lacouture ME, Lai SE (2006) Синдром PRIDE (папулопустулы и / или паронихия, регуляторные аномалии роста волос, зуда и сухости из-за ингибиторов рецепторов эпидермального фактора роста). Br J Dermatol 155: 852–854

    CAS PubMed Статья Google ученый

  • 127.

    Chen P, Wang L, Liu B, Zhang HZ, Liu HC, Zou Z (2011) Таргетная терапия EGFR в сочетании с химиотерапией для лечения распространенного немелкоклеточного рака легкого: метаанализ.Eur J Clin Pharmacol 67: 235–243

    CAS PubMed Статья Google ученый

  • 128.

    Burotto M, Manasanch EE, Wilkerson J, Fojo T (2015) Гефитиниб и эрлотиниб при метастатическом немелкоклеточном раке легкого: метаанализ токсичности и эффективности рандомизированных клинических испытаний. Онколог 20: 400–410

    CAS PubMed PubMed Central Статья Google ученый

  • 129.

    Melosky B, Hirsh V (2014) Управление распространенными токсичностями при метастатическом НМРЛ, связанными с терапией против рака легких с EGFR-TKI. Фронт Oncol 4: 238

    PubMed PubMed Central Google ученый

  • 130.

    Miroddi M, Sterrantino C, Simonelli I, Ciminata G, Phillips RS, Calapai G (2015) Риск диареи 3-4 степени и мукозита у пациентов с колоректальным раком, получающих схемы моноклональных антител против EGFR: мета анализ 18 рандомизированных контролируемых клинических исследований.Crit Rev Oncol Hematol 96: 355–371

    PubMed Статья Google ученый

  • 131.

    Lv ZC, Ning JY, Chen HB (2014) Эффективность и токсичность добавления цетуксимаба к химиотерапии при лечении метастатического колоректального рака: метаанализ 12 рандомизированных контролируемых исследований. Tumor Biol 35: 11741–11750

    CAS PubMed Статья Google ученый

  • 132.

    Bonner JA, Giralt J, Harari PM, Baselga J, Spencer S, Bell D et al (2016) Ассоциация вируса папилломы человека и статуса p16 с мукозитом и дисфагией у пациентов с раком головы и шеи, получавших лучевую терапию с цетуксимабом или без него: оценка из регистрационный пробный этап 3. Eur J Cancer 64: 1–11

    CAS PubMed Статья Google ученый

  • 133.

    Tejwani A, Wu S, Jia Y, Agulnik M, Millender L, Lacouture ME (2009) Повышенный риск дерматологической токсичности высокой степени при терапии радиацией и ингибиторами рецепторов эпидермального фактора роста.Рак 115: 1286–1299

    CAS PubMed Статья Google ученый

  • 134.

    Lacouture ME, Maitland ML, Segaert S, Setser A, Baran R, Fox LP et al (2010) Предложенная шкала оценки дерматологических побочных эффектов ингибитора EGFR, специфичная для дерматологических побочных эффектов, из группы исследования токсичности кожи MASCC. Support Care Cancer 18: 509–522

    PubMed Статья Google ученый

  • 135.

    Pryor DI, Burmeister E, Burmeister BH, Poulsen MG, Porceddu SV (2011) Отчетливые модели стоматита при одновременном применении цетуксимаба и лучевой терапии плоскоклеточного рака головы и шеи.Oral Oncol 47: 984–987

    CAS PubMed Статья Google ученый

  • 136.

    Zhu G, Lin JC, Kim SB, Bernier J, Agarwal JP, Vermorken JB et al (2016) Рекомендации азиатских экспертов по управлению воздействием радиации на кожу и слизистые оболочки с добавлением цетуксимаба или химиотерапии или без них. , при лечении плоскоклеточного рака головы и шеи. BMC Рак 16:42

    PubMed PubMed Central Статья CAS Google ученый

  • 137.

    Kollmannsberger C, Bjarnason G, Burnett P, Creel P, Davis M, Dawson N. et al (2011) Сунитиниб при метастатической почечно-клеточной карциноме: рекомендации по управлению не сердечно-сосудистой токсичностью. Онколог 16: 543–553

    CAS PubMed PubMed Central Статья Google ученый

  • 138.

    Perren TJ, Swart AM, Pfisterer J, Ledermann JA, Pujade-Lauraine E, Kristensen G et al (2011) Испытание фазы 3 бевацизумаба при раке яичников.N Engl J Med 365: 2484–2496

    CAS PubMed Статья Google ученый

  • 139.

    Ибрагим Е.М., Казказ Г.А., Абуэльхаир К.М., Байер А.М., Эльмасри О.А. (2013) Нежелательные явления сунитиниба при метастатической почечно-клеточной карциноме: метаанализ. Int J Clin Oncol 18: 1060–1069

    CAS PubMed Статья Google ученый

  • 140.

    Edmonds K, Hull D, Spencer-Shaw A, Koldenhof J, Chrysou M, Boers-Doets C et al (2012) Стратегии оценки и управления побочными эффектами сорафениба и других таргетных методов лечения почечно-клеточная и гепатоцеллюлярная карцинома: рекомендации Европейской целевой группы медсестер.Eur J Oncol Nurs 16: 172–184

    PubMed Статья Google ученый

  • 141.

    Gavrilovic IT, Balagula Y, Rosen AC, Ramaswamy V, Dickler MN, Dunkel IJ et al (2012) Характеристики событий слизистой оболочки полости рта, связанных с лечением бевацизумабом. Онколог 17: 274–278

    CAS PubMed PubMed Central Статья Google ученый

  • 142.

    Hubiche T, Valenza B, Chevreau C, Fricain JC, Del Giudice P, Sibaud V (2013) Географический язык, индуцированный ингибиторами ангиогенеза.Онколог 18: e16 – e17

    PubMed PubMed Central Статья Google ученый

  • 143.

    Rosen AC, Gavrilovic IT, Balagula Y, Ramaswamy V, Dickler MN et al (2013) Географический язык, индуцированный ингибиторами ангиогенеза: в ответ. Онколог 18: e18

    PubMed PubMed Central Статья Google ученый

  • 144.

    Thomas L, Lai SY, Dong W, Feng L, Dadu R, Regone RM et al (2014) Sorafenib при метастатическом раке щитовидной железы: систематический обзор.Онколог 19: 251–258

    CAS PubMed PubMed Central Статья Google ученый

  • 145.

    Christodoulou C, Pervena A, Klouvas G, Galani E, Falagas ME, Tsakalos G et al (2009) Комбинация бисфосфонатов и антиангиогенных факторов вызывает остеонекроз челюсти чаще, чем одни бисфосфонаты. Онкология 76: 209–211

    CAS PubMed Статья Google ученый

  • 146.

    Ponzetti A, Pinta F, Spadi R, Mecca C, Fanchini L, Zanini M et al. (2016) Остеонекроз челюсти, связанный с афлиберцептом, иринотеканом и фторурацилом: внимание к ротовой полости. Tumori 102 (Дополнение 2)

  • 147.

    Fusco V, Santini D, Armento G, Tonini G, Campisi G (2016) Остеонекроз челюсти за пределами применения антирезорбтивных (нацеленных на кости) агентов: новые горизонты в онкологии. Мнение эксперта по наркотикам Saf 15: 925–935

    CAS PubMed Статья Google ученый

  • 148.

    Ruggiero SL, Dodson TB, Fantasia J, Goodday R, Aghaloo T, Mehrotra B et al (2014) Позиционный документ Американской ассоциации челюстно-лицевых хирургов по поводу медикаментозного остеонекроза челюсти — обновление 2014 года. J Oral Maxillofac Surg 72: 1938–1956

    PubMed Статья Google ученый

  • 149.

    Gaudin E, Seidel L, Bacevic M, Rompen E, Lambert F (2015) Возникновение и индикаторы риска медикаментозного остеонекроза челюсти после удаления зубов: систематический обзор и метаанализ.J Clin Periodontol 42: 922–932

    PubMed Статья Google ученый

  • 150.

    Хан А.А., Моррисон А., Хэнли Д.А., Фелзенберг Д., МакКоли Л.К., О’Райан Ф. и др. (2015) Диагностика и лечение остеонекроза челюсти: систематический обзор и международный консенсус. J Bone Miner Res 30: 3–23

    PubMed Статья Google ученый

  • 151.

    Goodday RH (2015) Профилактические стратегии для пациентов из группы риска медикаментозного остеонекроза челюсти.Oral Maxillofac Surg Clin North Am 27: 527–536

    PubMed Статья Google ученый

  • 152.

    Rosenbaum SE, Wu S, Newman MA, West DP, Kuzel T, Lacouture ME (2008) Дерматологические реакции на многоцелевой ингибитор тирозинкиназы сунитиниб. Support Care Cancer 16: 557–566

    CAS PubMed Статья Google ученый

  • 153.

    Гомес Фернандес С., Сендагорта Кудос Е., Касадо Верриер Б., Фейто Родригес М., Суарес Агуадо Дж., Видауррасага Диас де Аркая С. (2010) Извержение орального лихеноида, связанное с лечением иматинибом.Eur J Dermatol 20: 127–128

    PubMed Google ученый

  • 154.

    Amitay-Laish I, Stemmer SM, Lacouture ME (2011) Побочные кожные реакции, вторичные по отношению к ингибиторам тирозинкиназы, включая мезилат иматиниба, нилотиниб и дазатиниб. Dermatol Ther 24: 386–395

    PubMed Статья Google ученый

  • 155.

    Zhang JA, Yu JB, Li XH, Zhao L (2015) Оральные и кожные лихеноидные высыпания с изменениями ногтей из-за лечения иматинибом у китайского пациента с хроническим миелоидным лейкозом.Энн Дерматол 27: 228–229

    PubMed PubMed Central Статья Google ученый

  • 156.

    Wahiduzzaman M, Pubalan M (2008) Оральная и кожная лихеноидная реакция с изменениями ногтей вторичными по отношению к иматинибу: отчет о случае и обзор литературы. Dermatol Online J 14:14

    CAS PubMed Google ученый

  • 157.

    Pascual JC, Matarredona J, Miralles J, Conesa V, Borras-Blasco J (2006) Оральная и кожная лихеноидная реакция на иматиниб: сообщение о двух случаях.Int J Dermatol 45: 1471–1473

    PubMed Статья Google ученый

  • 158.

    Эна П., Кьяролини Ф., Сидди Г.М., Коссу А. (2004) Оральная лихеноидная сыпь, вторичная по отношению к иматинибу (Гливек). J Dermatolog Treat 15: 253–255

    CAS PubMed Статья Google ученый

  • 159.

    Basso FG, Boer CC, Correa MEP, Torrezan M, Cintra ML, Gallotini de Magalhaes MHC et al (2009) Поражения кожи и полости рта, связанные с терапией мезилатом иматиниба.Support Care Cancer 17: 465–468

    PubMed Статья Google ученый

  • 160.

    Фитцпатрик С.Г., Хирш С.А., Гордон С.К. (2014) Злокачественная трансформация красного плоского лишая полости рта и поражение лихеноидом полости рта: систематический обзор. J Am Dent Assoc 145: 45–56

    PubMed Статья Google ученый

  • 161.

    Wong M, Sade S, Gilbert M, Klieb HB (2011) Меланоз полости рта после ингибирования тирозинкиназы иматинибом при хроническом миелогенном лейкозе: отчет о случае и обзор литературы.Dermatol Online J 17: 4

    PubMed Google ученый

  • 162.

    Khoo TL, Catalano A, Supple S, Chong L, Yeoh SC, Yeung S et al (2013) Гиперпигментация твердого неба, связанная с терапией иматинибом при хроническом миелоидном лейкозе с генетической вариацией протоонкогена c-KIT. Лимфома лейка 54: 186–188

    CAS PubMed Статья Google ученый

  • 163.

    Yu YH, Shere Y, Vigneswaran N (2012) Случай месяца о оральной и челюстно-лицевой патологии. Небный меланоз, связанный с терапией мезилатом иматиниба. Tex Dent J 129 (764–5): 786–788

    Google ученый

  • 164.

    Mattsson U, Halbritter S, Mörner Serikoff E, Christerson L, Warfvinge G (2011) Оральная пигментация твердого неба, связанная с терапией мезилатом иматиниба: отчет о трех случаях. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 111: e12 – e16

    CAS PubMed Статья Google ученый

  • 165.

    Li CC, Malik SM, Blaeser BF, Dehni WJ, Kabani SP, Boyle N et al (2012) Пигментация слизистой оболочки, вызванная иматинибом: отчет о трех случаях. Голова Шея Патол 6: 290–295

    PubMed Статья Google ученый

  • 166.

    Юань А., Ву С.Б. (2015) Побочные эффекты лекарственных препаратов в полости рта. Oral Surg Oral Med Oral Pathol Oral Radiol 119: 35–47

    PubMed Статья Google ученый

  • 167.

    Balagula Y, Pulitzer MP, Maki RG, Myskowski PL (2011) Пигментные изменения у пациента, получавшего иматиниб. J Drugs Dermatol 10: 1062–1066

    PubMed Google ученый

  • 168.

    Boutros C, Tarhini A, Routier E, Lambotte O, Ladurie FL, Carbonnel F et al (2016) Профили безопасности анти-CTLA-4 и анти-PD-1 антител по отдельности и в комбинации. Нат Рев Клин Онкол 13: 473–486

    CAS PubMed Статья Google ученый

  • 169.

    Freeman-Keller M, Kim Y, Cronin H, Richards A, Gibney G, Weber JS (2016) Ниволумаб при резектированной и неоперабельной метастатической меланоме: характеристики иммунных побочных эффектов и связь с исходами. Clin Cancer Res 22: 886–894

    CAS PubMed Статья Google ученый

  • 170.

    Herbst RS, Baas P, Kim DW, Felip E, Pérez-Gracia JL, Han JY et al (2016) Сравнение пембролизумаба и доцетаксела для ранее леченных PD-L1-положительных немелкоклеточных легких рак (KEYNOTE-010): рандомизированное контролируемое исследование.Ланцет 387: 1540–1550

    CAS PubMed Статья Google ученый

  • 171.

    Hofmann L, Forschner A, Loquai C, Goldinger SM, Zimmer L, Ugurel S et al (2016) Кожные, желудочно-кишечные, печеночные, эндокринные и почечные побочные эффекты терапии анти-PD-1. Eur J Cancer 60: 190–209

    CAS PubMed Статья Google ученый

  • 172.

    Schaberg KB, Novoa RA, Wakelee HA, Kim J, Cheung C, Srinivas S. et al (2016) Иммуногистохимический анализ лихеноидных реакций у пациентов, получавших терапию анти-PD-L1 и анти-PD-1.Дж. Кутан Патол 43: 339–346

    PubMed Статья Google ученый

  • 173.

    Lacouture ME, Duvic M, Hauschild A, Prieto VG, Robert C, Schadendorf D et al (2013) Анализ дерматологических событий у пациентов с меланомой, получавших вемурафениб. Онколог 18: 314–322

    CAS PubMed PubMed Central Статья Google ученый

  • 174.

    Boussemart L, Routier E, Mateus C, Opletalova K, Sebille G, Kamsu-Kom N et al (2013) Проспективное исследование кожных побочных эффектов, связанных с ингибитором BRAF вемурафенибом: исследование 42 пациентов.Ann Oncol 24: 1691–1697

    CAS PubMed Статья Google ученый

  • 175.

    Gençler B, Gönül M (2016) Кожные побочные эффекты ингибиторов BRAF при запущенной меланоме: обзор литературы. Дерматол Рес Прак 2016: 5361569

    PubMed PubMed Central Google ученый

  • 176.

    Оберхольцер PA, Kee D, Dziunycz P, Sucker A, Kamsukom N, Jones R et al (2012) Мутации RAS связаны с развитием кожных плоскоклеточных опухолей у пациентов, получавших ингибиторы RAF.J Clin Oncol 30: 316–321

    CAS PubMed Статья Google ученый

  • 177.

    Chu EY, Wanat KA, Miller CJ, Amaravadi RK, Fecher LA, Brose MS et al (2012) Различные кожные побочные эффекты, связанные с терапией ингибитором BRAF: клинико-патологическое исследование. J Am Acad Dermatol 67: 1265–1272

    CAS PubMed PubMed Central Статья Google ученый

  • 178.

    Mangold AR, Bryce A, Sekulic A (2014) Гиперплазия десны, ассоциированная с вемурафенибом, у пациента с метастатической меланомой. J Am Acad Dermatol 71: e205 – e206

    PubMed Статья Google ученый

  • 179.

    Pileri A, Cricca M, Gandolfi L, Misciali C, Casadei B, Zinzani PL et al (2015) Побочное действие вемурафениба на слизистую оболочку. J Eur Acad Dermatol Venereol 30: 1053–1055

    PubMed Статья Google ученый

  • 180.

    Flaherty KT, Infante JR, Daud A et al (2012) Комбинированное ингибирование BRAF и MEK при меланоме с мутациями BRAF V600. N Engl J Med 367: 1694–1703

    CAS PubMed PubMed Central Статья Google ученый

  • 181.

    Chang AL, Solomon JA, Hainsworth JD, Goldberg L, McKenna E, Day BM et al (2014) Исследование расширенного доступа пациентов с распространенной базально-клеточной карциномой, получавших лечение ингибитором пути Hedgehog, висмодегиб.J Am Acad Dermatol 70: 60–69

    CAS PubMed Статья Google ученый

  • 182.

    Эпштейн Дж. Б., Смутцер Г., Доти Р. Л. (2016) Понимание влияния изменения вкуса при оказании онкологической помощи. Support Care Cancer 24: 1917–1931

    PubMed Статья Google ученый

  • 183.

    Sibaud V, Niec RE, Schindler K, Busam KJ, Roché H, Modi S. et al (2014) Адо-трастузумаб-эмтанзин-ассоциированные телеангиэктазии при метастатическом раке молочной железы: серия случаев.Лечение рака груди 146: 451–456

    PubMed Статья Google ученый

  • 184.

    Sibaud V, Vigarios E, Combemale P, Lamant L, Lacouture ME, Lacaze JL et al (2015) Телангиэктазии, связанные с T-DM1: потенциальная роль во вторичных кровотечениях. Энн Онкол 26: 436–437

    CAS PubMed Статья Google ученый

  • Микробиота слизистой оболочки и слюны, связанная с рецидивирующим афтозным стоматитом | BMC Microbiology

  • 1.

    Аас Дж. А., Пастер Б. Дж., Стокс Л. Н., Олсен И., Дьюхёрст Ф. Э. Определение нормальной бактериальной флоры полости рта. J Clin Microbiol. 2005; 43: 5721–32.

    Артикул PubMed PubMed Central Google ученый

  • 2.

    Скалли С., Феликс Д.Х. Устная медицина — обновление для практикующего стоматолога. Афтозные и другие распространенные язвы. Бр Дент Дж. 2005; 199: 259–64.

    CAS Статья PubMed Google ученый

  • 3.

    Слебиода З., Шпонар Э., Ковальска А. Этиопатогенез рецидивирующего афтозного стоматита и роль иммунологических аспектов: обзор литературы. Arch Immunol Ther Exp (Warsz). 2014; 62: 205–15.

    CAS Статья Google ученый

  • 4.

    Гувер К.И., Олсон Дж. А., Гринспен Дж. С.. Гуморальные ответы и перекрестная реактивность на стрептококки viridans при рецидивирующем афтозном изъязвлении. J Dent Res. 1986; 65: 1101-4.

  • 5.

    Riggio MP, Lennon A, Ghodratnama F, Wray D.Отсутствие связи между Streptococcus oralis и рецидивирующим афтозным стоматитом. J Oral Pathol Med. 2000; 29: 26–32.

    CAS Статья PubMed Google ученый

  • 6.

    Хасан А., Чайлдерстон А., Первин К., Шинник Т., Мидзусима Ю., Ван дер Зи Р. и др. Распознавание уникального пептидного эпитопа микобактериального антигена белка теплового шока человека 65-60 Т-клетками пациентов с рецидивирующими язвами полости рта. Clin Exp Immunol.1995; 99: 392–7.

    CAS Статья PubMed PubMed Central Google ученый

  • 7.

    Адлер И., Муньо А., Агуас С., Харада Л., Диас М., Ленс А. и др. Helicobacter pylori и патология полости рта: связь с желудочной инфекцией. Мир J Gastroenterol. 2014; 20: 9922–35.

    Артикул PubMed PubMed Central Google ученый

  • 8.

    Mansour-Ghanaei F, Asmar M, Bagherzadeh AH, Ekbataninezhad S.Инфекция Helicobacter pylori при поражениях полости рта у пациентов с рецидивирующим афтозным стоматитом. Med Sci Monit. 2005; 11: CR576–9.

    PubMed Google ученый

  • 9.

    Marchini L, Campos MS, Silva AM, Paulino LC, Nobrega FG. Бактериальное разнообразие афтозных язв. Oral Microbiol Immunol. 2007. 22: 225–31.

    CAS Статья PubMed Google ученый

  • 10.

    Vavricka SR, Schoepfer A, Scharl M, Lakatos PL, Navarini A, Rogler G.Внекишечные проявления воспалительного заболевания кишечника. Воспаление кишечника. 2015; 21: 1982–92.

    Артикул PubMed PubMed Central Google ученый

  • 11.

    Саид Х.С., Суда В., Накагоме С., Чинен Х., Осима К., Ким С. и др. Дисбиоз микробиоты слюны при воспалительном заболевании кишечника и его связь с оральными иммунологическими биомаркерами. ДНК Res. 2014; 21: 15–25.

    CAS Статья PubMed PubMed Central Google ученый

  • 12.

    Хиджази К., Лоу Т., Мехарг С., Берри С.Х., Фоли Дж., Держи ГЛ. Микробиом слизистой оболочки у пациентов с рецидивирующим афтозным стоматитом. J Dent Res. 2015; 94: 87С – 94С.

    CAS Статья PubMed PubMed Central Google ученый

  • 13.

    Bankvall M, Sjöberg F, Gale G, Wold A, Jontell M, Östman S. Микробиота полости рта пациентов с рецидивирующим афтозным стоматитом. J Oral Microbiol. 2014; 6: 25739.

    PubMed Google ученый

  • 14.

    Сеуди Н., Бергмайер Л.А., Дробневски Ф., Пастер Б., Форчун Ф. Микробное сообщество слизистой оболочки полости рта и слюны при синдроме Бехчета и рецидивирующем афтозном стоматите. J Oral Microbiol. 2015; 7: 27150.

    PubMed Google ученый

  • 15.

    Chun J, Kim KY, Lee JH, Choi Y. Анализ микробных сообществ полости рта мышей дикого типа и мышей с дефицитом toll-подобного рецептора 2 с использованием пиросеквенатора 454 GS FLX Titanium. BMC Microbiol. 2010; 10: 101.

    Артикул PubMed PubMed Central Google ученый

  • 16.

    Laheij AM, de Soet JJ, Veerman EC, Bolscher JG, van Loveren C. Влияние бактерий полости рта на миграцию эпителиальных клеток in vitro. Медиаторы Inflamm. 2013; 2013: 154532.

    Артикул PubMed PubMed Central Google ученый

  • 17.

    Сегата Н., Хааке С.К., Маннон П., Лимон К.П., Уолдрон Л., Геверс Д. и др.Состав бактериального микробиома пищеварительного тракта взрослого человека на основе семи образцов поверхности рта, миндалин, горла и стула. Genome Biol. 2012; 13: R42.

    CAS Статья PubMed PubMed Central Google ученый

  • 18.

    Wolfgang WJ, Passaretti TV, Jose R, Cole J, Coorevits A, Carpenter AN, et al. Neisseria oralis sp. nov., выделенный из здорового десневого налета и клинических образцов. Int J Syst Evol Microbiol. 2013; 63: 1323–8.

    CAS Статья PubMed PubMed Central Google ученый

  • 19.

    Чаудхари Х.Дж., Пэн Г., Ху М., Хе И, Ян Л., Ло И и др. Генетическое разнообразие эндофитных диазотрофов дикого риса Oryza alta и идентификация нового диазотрофа Acinetobacter oryzae sp. ноя Microb Ecol. 2012; 63: 813–21.

    CAS Статья PubMed Google ученый

  • 20.

    Vos M, Velicer GJ. Изоляция по расстоянию в спорообразующей почвенной бактерии Myxococcus xanthus. Curr Biol. 2008; 18: 386–91.

    CAS Статья PubMed Google ученый

  • 21.

    Зейферт Х., Дейксхорн Л., Гернер-Смидт П., Пельцер Н., Тьернберг И., Ваничутт М. Распространение видов Acinetobacter на коже человека Сравнение методов фенотипической и генотипической идентификации. J Clin Microbiol. 1997; 35: 2819–25.

    CAS PubMed PubMed Central Google ученый

  • 22.

    Turton JF, Shah J, Ozongwu C, Pike R. Распространенность видов Acinetobacter, отличных от A. baumannii, среди клинических изолятов Acinetobacter: данные о новых видах. J Clin Microbiol. 2010; 48: 1445–9.

    Артикул PubMed PubMed Central Google ученый

  • 23.

    Joossens M, Huys G, Cnockaert M, De Preter V, Verbeke K, Rutgeerts P, et al. Дисбиоз фекальной микробиоты у пациентов с болезнью Крона и их здоровых родственников.Кишечник. 2011; 60: 631–7.

    Артикул PubMed Google ученый

  • 24.

    Willing BPDJ, Halfvarson J, Andersson AF, Lucio M, Zheng Z, Jarnerot G, et al. Исследование пиросеквенирования у близнецов показывает, что микробный профиль желудочно-кишечного тракта зависит от фенотипа воспалительного заболевания кишечника. Гастроэнтерология. 2010; 139: 1844–54.

    Артикул PubMed Google ученый

  • 25.

    Murad CF, Sassone LM, Faveri M, Hirata Jr R, Figueiredo L, Feres M. Микробное разнообразие устойчивых инфекций корневых каналов исследовано с помощью гибридизации ДНК-ДНК в шахматном порядке. Дж. Эндод. 2014; 40: 899–906.

    CAS Статья PubMed Google ученый

  • 26.

    Li A, Tambyah P, Chan D, Leong KK. Capnocytophaga sputigena empyema. J Clin Microbiol. 2013; 51: 2772–4.

    Артикул PubMed PubMed Central Google ученый

  • 27.

    Gomez-Garces JL, Alos JI, Sanchez J, Cogollos R. Бактериемия, вызванная множественной лекарственной устойчивостью Capnocytophaga sputigena. J Clin Microbiol. 1994; 32: 1067–9.

    CAS PubMed PubMed Central Google ученый

  • 28.

    Гриффен А.Л., Билл С.Дж., Кэмпбелл Дж.Х., Файерстоун Н.Д., Кумар П.С., Ян З.К. и др. Отчетливые и сложные бактериальные профили при пародонтите и здоровье человека, выявленные пиросеквенированием 16S. ISME J. 2012; 6: 1176–85.

    CAS Статья PubMed PubMed Central Google ученый

  • 29.

    Хансен Р., Рассел Р.К., Рейфф К., Луис П., Макинтош Ф., Берри С.Х. и др. Микробиота педиатрической ВЗК de novo: увеличение Faecalibacterium prausnitzii и снижение бактериального разнообразия при болезни Крона, но не при язвенном колите. Am J Gastroenterol. 2012; 107: 1913–22.

    CAS Статья PubMed Google ученый

  • 30.

    Йе Й, Карлссон Дж., Агхольм М.Б., Уилсон Дж. А., Роос А., Энрикес-Нормарк Б. и др. Динамика бактериального сообщества полости рта у педиатрических пациентов со злокачественными новообразованиями в отношении мукозита полости рта, связанного с химиотерапией — проспективное исследование.Clin Microbiol Infect. 2013; 19: E559–67.

    CAS Статья PubMed PubMed Central Google ученый

  • 31.

    Huber T, Faulkner G, Hugenholtz P. Bellerophon: программа для обнаружения химерных последовательностей при множественном выравнивании последовательностей. Биоинформатика. 2004; 20: 2317–9.

    CAS Статья PubMed Google ученый

  • 32.

    Чун Дж., Ли Дж. Х., Юнг Й, Ким М., Ким С., Ким Б. К. и др.EzTaxon: веб-инструмент для идентификации прокариот на основе последовательностей гена 16S рибосомной РНК. Int J Syst Evol Microbiol. 2007. 57: 2259–61.

    CAS Статья PubMed Google ученый

  • 33.

    Hamady M, Lozupone C, Knight R. Fast UniFrac: содействие высокопроизводительному филогенетическому анализу микробных сообществ, включая анализ данных пиросеквенирования и PhyloChip. ISME J. 2010; 4: 17–27.

    CAS Статья PubMed PubMed Central Google ученый

  • 34.

    Консорциум проекта микробиома человека. Структура, функции и разнообразие микробиома здорового человека. Природа. 2012; 486: 207–14.

    Артикул Google ученый

  • 35.

    Шин Дж., Джи С., Чой Ю. Способность бактерий полости рта индуцировать разрушающие ткань молекулы нейтрофилов человека. Oral Dis. 2008. 14: 327–34.

    CAS Статья PubMed Google ученый

  • 36.

    Ким И, Джо А.Р., да Джанг Х, Чо Й.Дж., Чун Дж, Мин Б.М. и др. Toll-подобный рецептор 9 опосредует индуцированную бактериями полости рта экспрессию IL-8 в эпителиальных клетках десен.