Содержание

анатомия строения и назначение зубов

Вернуться к списку статей

Ротовая полость представляет собой важнейшую часть нашего организма. Мы разговариваем, пьем, принимаем пищу, ослепительно улыбаемся. Но все это возможно только в том случае, когда каждый элемент этой системы находится в идеальном состоянии. Именно поэтому человеку важно знать, из чего состоит полость рта.

Ежедневный уход за зубами – основа их здоровья

Продукция, предназначенная для гигиены ротовой полости, постоянно совершенствуется. Улучшаются не только средства для ухода в быту, но и препараты, инструменты и оборудование для профессионалов. В стоматологической клинике CrocoDent есть все самое лучшее, чтобы помочь вам сохранить свои зубы здоровыми и красивыми.

Существуют заболевания, приводящие к развитию различных стоматологических проблем. В запущенных формах из-за них зубы могут даже выпасть. Вот почему так важно ежедневное соблюдение правил гигиены ротовой полости. И большинство из нас старается заботиться о своих зубах как следует. Если человек начинает делать это с раннего детства, то сможет сохранить их здоровыми до преклонных лет.

Зубной налет

Это вещество представляет собой липкую бактериальную субстанцию, обволакивающую зубы, десна и стоматологические конструкции. Если ее своевременно не счищать, продукты жизнедеятельности бактерий приведут к гингивиту, воспалению десенных тканей и кариесу. Контактируя с пищей, микроорганизмы продуцируют кислоту, вызывающую разрушение эмали.

Кроме того, налет на зубах – это еще и причина заболеваний пародонта. Они могут завершиться тяжелым инфицированием, сопровождающимся повреждением челюстных костей и разрушением опорных тканей вокруг зубов.

Наилучшие решение – удаление налета до начала его уплотнения и появления серьезных проблем. Зубная щетка эффективно удаляет зубной налет и с зубов, и с линии десен, и ниже нее. Использование зубной нити позволяет избавиться от бактериальной пленки в межзубных промежутках.

Рекомендуется проводить комплексную гигиену ротовой полости, и вместе с зубной пастой, щеткой и нитью применять другие гигиенические средства – ополаскиватели и ирригаторы – устройства для орошения полости рта. Но ежедневная чистка является процедурой, без которой не обойтись, если вы намерены сохранить свои зубы здоровыми.

Зубы и их строение
  1. Резцы

Это передние зубы. Они острые и имеют долотообразную форму. Их основное предназначение – откусывать куски пищи. Резцов 8 – 4 в верхнем и 4 в нижнем зубном ряду.

  1. Клыки

Это клинообразные зубы, стоящие после резцов. Они разрывают и удерживают куски пищи. Другие их названия – «тройки» и «глазные зубы».

  1. Премоляры

Это жевательные зубы, разрывающие и измельчающие пищу. Они выделяются двумя заостренными выступами. Другое их название – малые коренные зубы.

  1. Моляры

Это жевательные зубы, измельчающие пищу. Их поверхность имеет несколько бугорков, помогающих тщательно пережевывать еду.

  1. Коронка

Это видимая – верхняя часть тела зуба. Ее формой определяется и его функция. Резцы похожи на долото и участвуют в процессе откусывания кусков пищи. Клыки похожи на пики и помогают отрывать и удерживать эти куски. Премоляры и моляры имеют плоскую поверхность, что позволяет им тщательно перетирать и измельчать еду.

  1. Линия десны

Это зона соприкосновения зубов с деснами. Именно здесь, если вы не будете правильно и ежедневно пользоваться средствами по уходу за полостью рта, скапливается зубной налет. Он является рассадником болезнетворных бактерий, вызывающих гингивит и заболевания десен.

  1. Корень зуба

Видимая часть зуба составляет всего 1/3 от всего тела этого органа, все остальное приходится на корень. Его окружает альвеолярная кость. Главная задача корня – удерживать зуб в исходном положении.

  1. Эмаль

Она покрывает тело зуба снаружи. Эта ткань богата минералами и отличается повышенной прочностью. Именно она, если за зубами плохо ухаживать, первой оказывается под угрозой развития кариеса.

  1. Дентин

Это основная зубная ткань, которая располагается сразу под эмалью. Она представляет собой миллионы микроскопических трубок, соединяющихся с пульпой. Проникнув сквозь эмаль, кариес начинает разрушать дентин, вот почему так важно вовремя диагностировать и лечить это заболевание.

  1. Пульпа

Она состоит из нервов и кровеносных сосудов и располагается в центральной части зуба. Когда кариес разрастается и достигает пульпы, человек начинает чувствовать боль – развивается пульпит; лечение пульпита у детей обязательно (заявку на консультацию можно оставить на сайте детской стоматологии), потому что запущенная форма воспалительного процесса может потребовать процедуры депульпации с последующей обработкой корневых каналов.

Если у человека совершенно здоровые белые зубы, он прекрасно выглядит, уверен в себе, не боится открыто улыбаться, не стесняется в общении из-за неприятного запаха изо рта, правильно пережевывает пищу. Здоровые зубы – залог успеха и благополучия!

Записаться на прием

Карта сайта

Согласие на обработку персональных данных

Согласие на обработку персональных данных Настоящим в соответствии с Федеральным законом № 152-ФЗ «О персональных данных» от 27.07.2006 года свободно, своей волей и в своем интересе выражаю свое безусловное согласие на обработку моих персональных данных ГБПОУ РО «РБМК», зарегистрированным в соответствии с законодательством РФ по адресу: 344006, г. Ростов-на-Дону, ул. Пушкинская, 173″б» (далее по тексту — Оператор). Персональные данные — любая информация, относящаяся к определенному или определяемому на основании такой информации физическому лицу. Настоящее Согласие выдано мною на обработку следующих персональных данных: — Имя; — E-MAIL. Согласие дано Оператору для совершения следующих действий с моими персональными данными с использованием средств автоматизации и/или без использования таких средств: сбор, систематизация, накопление, хранение, уточнение (обновление, изменение), использование, обезличивание, а также осуществление любых иных действий, предусмотренных действующим законодательством РФ как неавтоматизированными, так и автоматизированными способами. Данное согласие дается Оператору для обработки моих персональных данных в следующих целях: — предоставление мне услуг/работ; — направление в мой адрес уведомлений, касающихся предоставляемых услуг/работ; — подготовка и направление ответов на мои запросы; — направление в мой адрес информации, в том числе рекламной, о мероприятиях/товарах/услугах/работах Оператора. Настоящее согласие действует до момента его отзыва путем направления соответствующего уведомления на электронный адрес [email protected] В случае отзыва мною согласия на обработку персональных данных Оператор вправе продолжить обработку персональных данных без моего согласия при наличии оснований, указанных в пунктах 2 – 11 части 1 статьи 6, части 2 статьи 10 и части 2 статьи 11 Федерального закона №152-ФЗ «О персональных данных» от 27.07.2006 г.

Принимаю Не принимаю

Строение и функции ротовой полости человека | ОБЖ. Реферат, доклад, сообщение, краткое содержание, лекция, шпаргалка, конспект, ГДЗ, тест

Раздел:

Системы органов человека

Как ты думаешь, почему мы одну еду любим, другую нет? Первым в организме встречает пищу наш язык. У всех нас на языке имеется множество маленьких выпук­лостей, которые называются вкусовыми сосочками. Именно благодаря им мы ощущаем вкус пищи — без них вся еда казалась бы нам одинаковой. Таких вкусовых со­сочков около тысячи, но каждый участок языка чувству­ет лучше один вкус: кончик — сладкое, задняя часть — горькое, боковые части — кислое, боковые части и кон­чик языка — соленое.

Вкусовые сосочки могут распознавать вкус только жидких веществ, поэтому необходимо, чтобы слюна смочила все, что мы пробуем. Попробуй, проглоти, не разжевав, черствый хлеб. Все горло обдерешь. А если хлеб долго жевать, он хорошо смочится слюной, и про­глотить его будет не трудно. Но слюна не только смачи­ватель, она — первая, кто в нашей машине пищеварения пищи приступает к разборке еды. Это специалист по топливу. Из еды она освобождает только углеводы.

Но это не все! Слюна еще и санитар. Она уничтожа­ет вредных микробов, которыми кишат немытые ово­щи, фрукты.

Важная роль в процессе переработки пищи принад­лежит и зубам. Ты знаешь, что не все зубы одинако­вые: острые клыки служат для раскусывания пищи; большие и малые, широкие и плоские коренные зубы измельчают куски пищи, а резцы — это зубы с тонкими и острыми краями. Материал с сайта http://worldofschool.ru

  • Первыми вырастают молочные зубы. После 6 лет начи­нают расти 32 постоянных зуба, которые остаются у че­ловека на всю жизнь.
  • Остатки пищи, скопившиеся между зубами, создают благоприятные условия для образования мельчайших организмов — бактерий, которые вызывают кариес. При этом бактерии разрушают эмаль зуба, а затем и весь зуб.
  • Чтобы не ходить к зубному врачу и предотвра­тить образование слоя бактерий, вызывающих ка­риес, есть единственный способ — содержать зубы в чистоте. Их нужно чистить каждый день от десны к верхушке зуба с наружной и внутрен­ней стороны в течение нескольких минут. Луч­ше всего чистить зубы утром после завтрака, вечеромперед сном. После каждого приема пищи надо полоскать рот кипяченой водой.
На этой странице материал по темам:
  • Микробиология и экология пищеварения лекции

  • Ротовая полость человека доклад з класс

  • Строение ротовой полости языка, вкусовой сосочек схема

  • Доклад строение ротовой полости кратко

  • Строение ротовой полости человека

Вопросы по этому материалу:
  • Что происходит с пищей во рту?

  • Почему язык называют «охранником»?

Важная тема: строение ротовой полости человека

Очень важным органом для человека является – рот. Функции, которые он выполняет, влияют на весь процесс пищеварения. Мы подробно ознакомим вас с устройством ротовой полости и остановимся на описании выполняемой им работы. Из школьного курса анатомии нам известно, что рот, состоит из двух частей; преддверие рта – губы, а затем зубы и десны, и сама ротовая полость. Туда входят; язык, твердое и мягкое небо, щеки, слюнные железы.

Содержание:

Десны и зубы

Всем известно, что зубы являются главными героями в процессе жевания и перемалывания пищи. Согласно своим исполняемым ролям, зубы во рту человека, делятся на виды:

  1. Резцы – передние 4 зуба, исполняют роль откусывания самых больших кусков.
  2. Клыки – их роль состоит в разламывании пищи и отделении на кусочки, имеют второе название «глазные зубы».
  3. Малые и большие коренные зубы – исполняют роль пережевывания и перетирания пищи.

Люди употребляют еду разного происхождения, и растительную, и животную. На этом основании сделан вывод, люди, существа всеядные.

Это возможно благодаря расположению зубов, и устройству ротовой полости, которое делает кардинальное отличие людей от животных.

Все зубы имеют одинаковое строение: мягкая сердцевина, дентин. Сердцевина состоит из кровеносных сосудов и нервов, а твердое вещество (кость), является дентином. Основная функция, этого вещества состоит из защиты зубов от микроповреждений. Для этого он «окрашен» эмалью, которая абсолютна нечего не чувствует. Кроме того эмаль, не знает себе равных по крепости в организме человека. Она состоит из сплава минеральных веществ (солей фосфора и кальция), насыщенными органическими веществами. Самая большая концентрация кальция наблюдается у дентина, где содержатся нервные волокна.

Строение языка

Человеческий язык, это мышечная масса с нежно Розовым цветом, на котором расположены вкусовые рецепторы. На самом верху языка, и по его краям, находятся сосочки, отвечающие за вкус всего, что поступает к нам в рот. Не секрет, что именно рот является первым пунктом, где начинается первоначальная обработка пищи и адсорбирование микроорганизмов и вредных веществ. Самую главную роль здесь берет на себя язык, накапливая на своей поверхности все вредные вещества, которые образуют известный каждому налет. Обязательно, в профилактических целях, нужно очищать язык от налета, что избавит от неприятного запаха и возможных инфекций. На корне языка, нет сосочков, там имеются миндалины. Которые выполняют важную роль в защите организма человека, становясь на пути микробов, они не дают проникнуть им внутрь.

Строение неба

Часть ротовой полости, которая находится сверху, называется небо. Небо сложено из 2 составляющих, твердое и мягкое. Слизистая оболочка покрывает обе части, проходя через твердое небо к мягкому небу, она постепенно превращается в десны. Передняя сторона неба образует рудиментарные образования (небные альвеолы), ими человек не пользуется в полной мере, а животные наоборот используют их для поедания пищи. У неба есть еще одна роль, кроме образования верхней части рта, она является барьером между носом и носоглоткой. Своеобразной стенкой барьера, является маленький язычок, который перекрывает доступ в носоглотку во время процесса пищеварения.

Строение слизистой оболочки

Вся ротовая полость человека обтянута слизистой оболочкой, которая имеет отличительную особенность, регенераторная способность. Слизистая обороняет ротовую полость от воздействий внешней среды. Химические, механические, температурные факторы не могут на нее воздействовать. Строение слизистой оболочки простое; в нижней части рта — на щеках, и губах, она образует складки; в верхней части – крепится к костям. Главные роли слизистой оболочки:

  • Защитная роль – неприятно, но факт, что во рту человека скапливается множество вирусов и бактерий. Слизистая оболочка задерживает, препятствует размножению и удаляет все вредные микроорганизмы с полости рта.
  • Чувствительная роль – Благодаря нахождению на своей поверхности множеству рецепторов, отвечающих за ощущения (вкусовые, болевые, температурные), она сигнализирует обо всех событиях, которые сопровождают прием пищи.
  • Всасывающая роль – Благодаря этой способности, мы имеем возможность принимать лекарственные препараты «под язык». Слизистая оболочка прекрасно всасывает белковые и минеральные соединения.

Заметили ошибку? Выделите ее и нажмите Ctrl+Enter, чтобы сообщить нам.


Расскажите друзьям! Расскажите об этой статье своим друзьям в любимой социальной сети с помощью социальных кнопок. Спасибо!

Поделиться

Поделиться

Твит

Телеграм

Класс

Вотсап

Урок биологии 9 класс по теме «Строение и функции пищеварительной системы. Пищеварение в ротовой полости»

МОБУ СОШ с. Оленевка

Открытый урок на тему:

«Строение и функции пищеварительной системы. Пищеварение в ротовой полости»

9 класс

Подготовила учитель химии Макарова Ольга Николаевна

2018 год

Строение и функции пищеварительной системы. Пищеварение в ротовой полости.

Цели: 1. Показать особенности строения пищеварительной системы человека, раскрыть процессы пищеварения в ротовой полости; 2. Развить умения самостоятельно работать с текстом и рисунками учебника, извлекая из них нужную информацию.

Задачи:

1. Сформировать у учащихся практическую направленность в изучении данной темы.

2. Разъяснить влияние курения на пищеварение в ротовой полости; 3. Сформулировать правила ухода за ротовой полостью и зубами.

Оборудование: таблица «Строение органов пищеварения», компьютер, скелет, зеркало, череп человека или животного, зубная щётка, зубные палочки.

Ход урока

I.Проверка знаний.

1. Какое значение для организма имеет пища? (в составе пищи находятся вещества, необходимые для выполнения физической и умственной работы, поддержания температуры тела, а также для роста и восстановления разрушающихся тканей и других функций).

2. Какие органические и неорганические соединения организм получает с пищей? (белки, жиры, углеводы, вода, минеральные соли).

3. Каковы основные функции органов пищеварения? (секреторная, двигательная и всасывательная).

4. Где происходит всасывание питательных веществ? (всасывательная функция выполняется слизистой оболочкой отдельных участков пищеварительной системы).

5. Укажите роль воды в клетке. (вода – универсальный растворитель; в виде водных растворов вещества поступают в клетку, выводятся из клетки, перемещаются внутри клетки. В водной среде или при участии воды протекает большая часть реакций в клетке).

II. Изучение нового материала.

Учитель.

Важнейшее условие здорового образа жизни — соблюдение санитарно-гигиенических норм и правил, позволяющих предупредить возникновение различных заболеваний. Самые массовые из них — стоматологические, т.е. болезни зубов и полости рта. Пожалуй, нет человека, не знакомого с ними. Они далеко не безобидны и могут быть причиной серьезных аллергических реакций, воспалительных процессов в ряде органов. Разрушенные и больные зубы, воспалительные процессы в деснах и челюстях — постоянный источник инфекции и интоксикации организма. Поэтому так

важно с детства выработать устойчивые навыки правильного и регулярного ухода за зубами.

Сегодня на уроке мы познакомимся с основами гигиены полости рта и профилактики стоматологических заболеваний.

Сначала познакомимся со строением пищеварительной системы, а затем более подробно остановимся на строении ротовой полости, а также изучим основные правилами ухода за зубами.

Пищеварительный канал подразделяется на ротовую полость, глотку, пищевод, желудок, тонкую и толстую кишку. К органам пищеварения относятся также слюнные железы, печень, поджелудочная железа. (использование таблицы).

Пища вначале попадает в ротовую полость, которую ограничивают верхняя и нижняя челюсти. В лунках челюстей находятся

зубы. У новорожденных зубов нет. Примерно к 6-му месяцу начинают появляться молочные зубы. К 10—12 годам молочные зубы заменяются постоянными. У взрослых людей по 28 — 32 постоянных зуба. Последние зубы — зубы мудрости — вырастают к 20—22 годам.

У каждого зуба имеются выступающая в ротовую полость коронка, шейка и находящийся в глубине челюсти корень. Внутри зуба имеется полость. Коронка зуба покрыта твердой эмалью, служащей для предохранения зуба от стирания, проникновения микробов. Большую часть коронки, шейки и корня составляет дентин — плотное, похожее на кость вещество. В полости зуба разветвляются кровеносные сосуды и нервные окончания. Мягкая часть в центре зуба называется

пульпой.

Строение зубов связано с выполняемыми функциями.

Вопрос классу: какие функции выполняют зубы? Спереди на верхней и нижней челюстях располагается по 4 плоских резца. Позади резцов находятся клыки — длинные, глубокосидящие зубы. Как и резцы, они имеют простые одиночные корни. Резцы и клыки служат для откусывания пищи. Позади клыков с каждой стороны имеются по 2 малых и по 3 больших коренных зуба. У коренных зубов бугристая жевательная поверхность и корни с несколькими отростками. С помощью коренных зубов пища дробится и размельчается.

При болезни зубов

нарушается пищеварение, так как в этом случае в желудок попадает недостаточно пережеванная и не подготовленная к дальнейшей химической обработке пища. Вот почему так важно следить за зубами.

На экране видны изображения различных типов зубов. Ученики дают им названия, а также называют части зуба.

Учащийся.

А сейчас вы узнаете, как правильно ухаживать за зубами.

Уход за зубами. Потребление сырых овощей и фруктов (например, моркови, яблок) способствует естественному очищению зубов. Однако оно, как правило, бывает недостаточным.

В слюне содержатся различные минеральные соли и органические вещества. Смешиваясь с остатками пищи, они образуют налет, который через определенное время твердеет и превращается в зубной камень. Для того чтобы этот налет удалить, применяют зубную пасту или зубной порошок.

Чистить зубы рекомендуется два раза в день — утром и вечером. Щетку следует вести от десны к коронке. При боковых движениях слева направо и справа налево очищаются лишь верхние части коронок, что недостаточно.

Кроме того, не проводится массаж десен, а без него они нередко начинают кровоточить. Чистить зубы рекомендуется не только с внешней, но и с внутренней стороны.

После еды нередко между зубами остаются частицы пищи. Их надо удалить зубочисткой из пластмассы или дерева. Можно воспользоваться зубной нитью. Металлическими предметами, например иголками, пользоваться нельзя: возможно повреждение эмали. После еды следует полоскать рот.

Учащиеся в роли врача и медсестры демонстрируют на скелете правила чистки зубов.

Учащийся.

Заболевания зубов. Эмаль твердое, но хрупкое вещество. Она легко разрушается, если после горячей пищи сразу употреблять холодную. Смена горячего и холодного воздуха происходит и при курении табака. Заглатывая горячий дым и обжигаясь, курильщик следом вдыхает холодный воздух, чтобы предотвратить ожог. Чем больше при этом контраст температур, тем большая вероятность повреждения эмали. Кроме того, табачный деготь оседает на зубах, образуя желтый налет, который через некоторое время превращается в зубной камень.

Нарушение эмали приводит к заболеванию кариесом. На месте повреждения образуется углубление — дупло. Оно постепенно доходит до пульпы зуба, и инфекция проникает в нее, вызывая воспаление — пульпит. Признаки пульпита — зубная боль, повышенная чувствительность зуба к температуре пищи. Если зуб вовремя не вылечить, он разрушится. Большое разрушающее воздействие на зубы оказывает молочная кислота, образующаяся при брожении углеводов. Кроме того, сахар является хорошей средой для микробов, находящихся в полости рта. Вредно также грызть леденцы, орехи. Это может привести к механическим повреждениям зубов. При недостатке фтора в питьевой воде зубы разрушаются быстрее. Поэтому в некоторые сорта зубной пасты вводят соли фтора.

Учитель.

Какие компоненты входят в состав зубной пасты, которой вы пользуетесь? Определите, какую роль они играют в профилактике кариеса. (проблемная ситуация).

Ученик.

Фторирование зубов — неотъемлемая часть гигиенических процедур. Однако фтор не столь безопасен, как может показаться на первый взгляд. Хотя фторирование зубов рекомендовано взрослым и детям, даже привычная зубная паста таит опасность. Как правильно использовать это изобретение 20-го века? В природе фтор и его соединения — фториды — присутствуют в небольших количествах в растения и животных. В растениях фтор участвует в биохимических процессах, а в организме животных и человека участвует в построении твердой основы зубов и костной ткани. Нарушения в структуре зубов (кариес) или хрупкость костей могут служить тревожным «звонком» при недостатке фтора, поэтому важно доставлять его в организм в достаточных количествах.

Интересно, что фтор можно получить как с водой из-под крана, так и в составе питьевой воды, которая продается в магазинах. Фториды могут даже присутствовать и в газированных напитках, и в соках из концентрата, ведь эти продукты выполнены на питьевой воде. Несмотря на успех фторирования воды, все-таки главным источником фтора для поддержания здоровья зубов считается зубная паста.

Современные зубные пасты в большинстве случаев содержат фторид натрия, либо монофторфосфат натрия.

Фториды защищают зубную эмаль, предотвращая появления кариеса и разрушение зубной основы. Фтор препятствует разрушению зуба, делая его более твёрдым, устойчивым к действию кислот.

Выраженное защитное действие фтора привело к развитию нового медицинского направления — фторотерапии, в ходе которой человек получает соединения фтора для восстановления зубов и предотвращения дальнейшего разрушения. Потребление фторированной воды и применение зубной пасты — обычные гигиенические процедуры. Помимо них, поступление фтора в организм возможно в кабинете зубного врача: фториды наносят на поверхность зубов в виде геля или жевательной пластинки.

Фториды в избыточных количествах токсичны для человека. Дантисты рекомендуют, чтобы порция зубной пасты не превосходила размер горошины. В то же время статистика показывает, что больше половины людей намного превышают эту рекомендацию, выдавливая из тюбика длинную полоску зубной пасты.

Длительный переизбыток фтора приводит к фторозу. Ионы фтора в организме оседают не только в зубах, но и в костной ткани. Здесь фтор также адсорбирует минералы, и поначалу укрепляют кости. Впоследствии переизбыток минералов приводит к недостатку органических соединений в костной ткани, поэтому она становится необычайно хрупкой. Уже в 1972 году медицинские исследования показали четкую связь между потреблением фтора и увеличением частоты переломов костей. Ситуация усугубляется тем, что фтор практически не выводится из организма.

Правила безопасности.

• Прежде всего, четко следуйте рекомендациям по применению. Не используйте большие количества средства, не держите на зубах более 2-3х минут, не заглатывайте.
• Особую осторожность следует соблюдать детям. Хотя содержание фторидов в детских зубных пастах снижено, дети часто используют больше зубной пасты, чем необходимо. Напомните им о размере горошины.
• Отправляясь в путешествие, поинтересуйтесь, каково в этой местности содержание фтора в воде. В некоторых областях естественная пресная вода настолько богата фтором, что использование фторированной зубной пасты приведет к переизбытку фторидов в организме.
• Используйте дополнительные гигиенические средства с фтором только по рекомендации врача.

Ученик. Зубная паста – это полноценное лекарство для зубов и дёсен. Как любое другое лекарство, она должна применяться строго курсами. Длительность курсов зависит от конкретной пасты.
Обычно используют лечебную пасту, прописанную стоматологом, утром и вечером в течение месяца, после чего месяц чистят зубы любой другой пастой, не обладающей ярко выраженными лечебными свойствами. Затем курс повторяют до достижения желаемого эффекта (уменьшение кровоточивости дёсен, запаха изо рта, осветление эмали и т.д.).
Существует другой подход к этому же вопросу. Он предполагает использование сразу двух паст. Утром применяют практически любую пасту, удовлетворяющую любым соображениям (цена, цвет тюбика, запах, вкус и т.д.), а вечером чистят зубы той пастой, которую рекомендовал стоматолог. Паста для ежедневного применения не должна содержать сильных антибактериальных веществ, сильных перекисей, обладающих отбеливающим эффектом.


Зубная паста – это лекарство для всех. Возьмите на заметку приведённые выше рекомендации и заботьтесь о своих зубах и дёснах. Однако не переусердствуйте и обязательно посещайте стоматолога как минимум дважды в год. Будьте здоровы! Учитель.

В ротовой полости пища разжевывается, увлажняется слюной и превращается в пищевой комок. Перемешивание пищи в ротовой полости осуществляется языком и мышцами щек. Слизистая оболочка ротовой полости воспринимает температуру, вкус и другие качества пищи. Возбуждение от чувствительных окончаний — рецепторов — доходит до центров продолговатого мозга. В результате по законам рефлекса начинают последовательно включаться в работу слюнные, желудочные и поджелудочная железы, затем происходит акт жевания и глотания. Пережеванная и увлажненная пища языком проталкивается в глотку и в результате сокращения мышц продвигается дальше в пищевод

Вопросы для обсуждения: 1. Из каких частей состоит зуб? (коронка, шейка и корень).

2. Что происходит с зубной эмалью при ковырянии в зубах металлическими предметами? (это ведёт к появлению в эмали трещин, через которые в полость зуба проникают проникают микроорганизмы).

3. Как называется мягкая часть зуба? (пульпа).

Рассмотрим более подробно строение ротовой полости.

Сверху она ограничена твердым и мягким небом, сбоку щеками, снизу диафрагмой рта. Вход в ротовую полость ограничивают губы. Губы участвуют в захвате пищи и определении ее качества. Изнутри полость покрыта слизистой оболочкой – расположенные здесь железы выделяют слюну. В ротовой полости расположены так же жевательные мышцы, которые могут развивать усилия до 400кг.

Сообщение ученика. (показывает на таблице расположение слюнных желез). Оказывается в нашем организме более 6 миллионов слюнных железок. Самые крупные из них это: околоушные, подъязычные, подчелюстные. За сутки у человека выделяется более 1 литра слюны. Она состоит из 99,4% воды и имеет слабощелочную реакцию. Соли щелочных металлов нейтрализуют кислоты гниения, которые образуются при остатков пищи во рту под влиянием микробов. Избыток щелочных солей в слюне приводит к образованию зубного камня. В слюне находятся ферменты амилаза и лизоцим, которые участвуют в расщеплении пищи.

Лабораторная работа «Строение ротовой полости. Зубы. Слюнные железы».

Цель работы: путем наблюдений ознакомиться со строением ротовой полости и расположением зубов.

Оборудование: зеркало, череп человека, черепа позвоночных животных или челюсти с зубами (кошки, собаки, кролика, овцы и т. д.)

Ход работы

1) Рассмотрите с помощью зеркала свои органы ротовой полости, сравните их с изображенными на рисунках в учебнике на с. 175, твердое и мягкое небо, язычок, миндалины. Мягкое небо лучше видно при резком выдохе.

2) Вспомните строение зубов различных отрядов млекопитающих. Найдите различные зубы на раздаточном материале. Какова функция зубов различной формы?

3) Прочитайте в учебнике материал о расположении и строении зубов и порядок их появления у ребенка. Рассмотрите различные зубы у себя.

4) Какие болезни зубов вы знаете и как их предупредить?

5) Сделайте подряд несколько глотательных движений. Почему наступает момент, когда вы не сможете это сделать? Изучите на себе расположение слюнных желез:

а) сожмите пальцами щеки впереди ушей — рот заполняется слюной — это работа парных околоушных желез;

6) слегка сожмите кожу под нижней челюстью — слюна выделяется из подчелюстной железы;

в) подъязычная железа находится глубоко, но можно увидеть её работу. Для этого возьмите зеркало, откройте рот и захватите верхними зубами кончик языка и резко отогните язык вверх.

Видно выделение слюны. Выход протока железы находится под уздечкой языка, которая соединяет середину нижней стороны языка с дном ротовой полости. Иногда можно видеть небольшое отверстие протока железы.

6) Приложите руку к гортани и сделайте глотательное движение. Почувствуйте, что гортань поднимается вверх, а потом возвращается вниз. Почему пища при глотании не попадает в трахею? Почему во время еды нельзя разговаривать, смеяться? (работу можно выполнить дома, ход работы кратко записать в тетради).

III. Закрепление.

Тест.

1. В каком порядке расположены органы пищеварения?

а) ротовая полость – желудок – пищевод — толстая кишка — тонкая кишка — толстая кишка;
б) ротовая полость – пищевод — желудок — тонкая кишка — толстая кишка – прямая кишка;
в) ротовая полость – пищевод — желудок – толстая кишка — тонкая кишка – прямая кишка.

2. В ротовой полости происходит:

а) завершение переваривания пищи;
б) механическая переработка пищи и начальное расщепление крахмала;
в) переваривание жиров.

3. Каким веществом покрыта коронка зуба:

а) прочным цементом;
б) дентином;
в) эмалью.

4. Всего у взрослого человека:

а) 32 зуба;
б) 36 зубов;
в) 30 зубов.

5. Язык участвует:

а) в механической обработке пищи;
б) в химической обработке пищи;
в) в механической обработке и опробывании пищи.

6. Как называется мягкая часть зуба?

а) эмаль; б) пульпа; в) десна.

7. Как правильно пользоваться зубной пастой? а) можно использовать любую пасту в любых количествах; б) количество пасты должно быть размером с горошину; в) нужно выдавливать длинную полоску зубной пасты.

Ответы: 1б, 2б, 3в, 4а, 5в, 6б, 7б.

  1. Домашнее задание. Стр. 174 (учебник), стр. 179 (вопросы после параграфа), лаб. работа.

Литература.

1.Сонин Н.И. Сапин М.Р. Биология. Человек. 8 класс. М.; Дрофа:,2009. 2. Козачек Т.В. Биология 8 класс. Поурочные планы по учебнику Сонина Н.И. и Сапина М. Р. Волгоград: Учитель, 2007. – 328 с.

3. Жилина В.В. Здоровый образ жизни. Предупреждение стоматологических заболеваний. Журнал «Биология в школе». №5 1990г.

4. Колесов Д.В.Здоровье и укрепляющие его факторы. М.: Журнал «Биология в школе». №3 1995.

Ротовая полость и глотка, подготовка к ЕГЭ по биологии

Пищеварение

Мы приступаем к изучению нового раздела — пищеварительной системы, представляющей собой систему органов, деятельность которых направлена на осуществление механического и химического пищеварения.

Пищеварение — совокупность физико-химических процессов пищеварительного тракта, в результате которых из пищи образуются питательные вещества. Механическое пищеварение заключается в измельчении пищи, а химическое — расщеплении полимеров до мономеров.

Механическая обработка пищи осуществляется с помощью зубов, а также мышечного компонента пищеварительного тракта. Химическая обработка — за счет особых биологически активных веществ — ферментов. Ферменты образуются в клетках железистого эпителия пищеварительных желез.

Ферменты

Ферменты (лат. fermentum — «закваска») или энзимы (греч. en — приставка, означающая нахождение внутри + zyme — закваска, дрожжи) — сложные белковые соединения, которые ускоряют химические реакции в живых системах (в пищеварительном тракте — реакции расщепления).

Каждый фермент активен в определенной среде, в зависимости от кислотности: к примеру, ферменты желудка, активные в кислой среде, попадая в кишечник — в слабощелочную среду, теряют свою активность.

Потеря ферментами активности связана с изменением конформации белковых молекул (ферментов) в зависимости от среды (лат. conformatio — форма, построение; пространственное расположение атомов в молекуле).

Денатурация (лат. de — отсутствие, отмена + лат. natura — природные свойства) — процесс нарушения нативной конформации биологических макромолекул (нативная — от лат. nativus — врoждённый) .

При нагревании ферментов (белков) начинаются процессы необратимой денатурации и потери активности: температурный оптимум ферментов организма человека 36-39°C.

Низкие температуры (даже очень низкие) вызывают обратимую денатурацию белков. После охлаждения в нормальных условиях белки способны восстановить свою структуру и активность.

Ротовая полость

Ротовая полость является началом пищеварительной системы. Верхняя стенка ротовой полости образована мягким небом (складка слизистой оболочки, разделяющая полость рта и глотку) и твердым небом (костная стенка, разделяющая ротовую и носовую полости).

Передние и задние небные дужки мягкого неба ограничивают тонзиллярную нишу (лат. tonsilla — миндалина), в которой располагается орган иммунной системы — небная миндалина, образованная лимфоидной тканью.

На границе ротовой полости и глотки имеется скопление лимфатических структур, в его состав входят различные миндалины (небная, глоточная, трубная, язычная). Миндалины — важная часть иммунитета: они помогают бороться с микробами и могут увеличиваться в размерах при различных заболеваниях.

В совокупности миндалины образуют лимфатическое глоточное кольцо.

Пищеварение начинается уже в ротовой полости. Здесь в результате жевательных движений нижней челюсти (относительно неподвижной верхней челюсти) пища измельчается. Нельзя недооценивать важность этого процесса, так как именно тщательное пережевывание пищи является залогом ее дальнейшего успешного переваривания. Жевание обеспечивает:

  • Измельчение пищи
  • Стимуляцию рефлекторного отделение слюны
  • Перемешивание пищи и слюны, ослизнение и формирование пищевого комка
  • Стимуляцию моторной и секреторной деятельности ЖКТ (опыты И.П. Павлова)
Зубы

В норме у человека от 28 до 32 зубов (отсутствие зубов мудрости является вариантом нормы: зубы мудрости — рудименты). Первый комплект зубов человека называется — молочные зубы, с 6-7 лет до 12-13 они заменяются постоянными зубами.

Зубная формула человека записывается 2123. Такая формула означает, что на одной половине (!) челюсти находятся 2 резца, 1 клык, 2 малых коренных зуба (премоляра) и 3 больших коренных зуба (моляра — от лат. molares — коренные).

Корни зубов погружены в альвеолярные лунки верхней и нижней челюстей. Альвеола — от лат. alveolus — ячейка, углубление.

Зуб состоит из трех частей: коронки, шейки и корня. Снаружи коронка зуба покрыта эмалью, под эмалью располагается дентин — костное вещество зуба. Цемент (лат. cementum — битый камень) — специфическая костная ткань, покрывающая корень и шейку зуба человека.

Пульпа (лат. pulpa- мякоть, мясистая часть) — рыхлая волокнистая соединительная ткань. Пульпа заполняет полость зуба, содержит большое количество нервных окончаний, кровеносных и лимфатических сосудов.

Эмаль развивается из эктодермы; дентин, цемент и пульпа — из мезодермы (в рамках школьного курса), если академически точно — из мезенхимы (мезенхима частично образуется из мезодермы).

Эмаль — внешняя защитная оболочка коронковой части зубов человека, представляет собой затвердевшие выделения эпителиальных клеток, покрывающих коронку зуба. Чередование холодного и горячего может привести к нарушению целостности эмали: в ней возникают трещины.

Через дефекты эмали (стертости, повреждения) происходит инфицирование основного — костного вещества зубов — дентина; распространение инфекционного процесса ведет к развитию кариеса.

Слюнные железы

У человека имеется 3 пары крупных слюнных желез: околоушная, подчелюстная и подъязычная, выделяющие секрет — слюну. Помимо механической обработки, пища в ротовой полости обрабатывается ферментами, содержащимися в секрете слюнных желез: амилазой и мальтазой. Они гидролизуют углеводы, содержащиеся во рту, к примеру, амилаза расщепляет крахмал до олигосахаридов различной длины.

Секрет слюнных желез содержит муцин — слизистый компонент, который способствует образованию пищевого комка. Важно помнить, что ротовая полость контактирует с внешней средой, и сюда постоянно попадают микробы: вирусы, бактерии. Для нейтрализации микробов в слюне имеется лизоцим — бактерицидное вещество.

Запомните важный момент, который пригодится в дальнейшем: если пища находится в ротовой полости и раздражает рецепторы языка, то выделение слюны — безусловный рефлекс. Если же слюна выделяется в ответ на внешний вид, запах пищи (но ее нет в ротовой полости), то такой рефлекс считается условным.

В ротовой полости расположен орган вкуса — вкусовые луковицы. Вкусовые луковицы — комплексы клеток, которые содержат хеморецепторы. На языке вкусовые луковицы лежат внутри вкусовых сосочков языка.

Спешу опровергнуть миф, который гласит, что разные участки языка различают только определенные вкусовые ощущения — сладкое, горькое, соленое, кислое. На самом деле внутри каждого вкусового сосочка имеются разные типы вкусовых луковиц, поэтому такая точка зрения неверна.

Заболевания

Кариес (от лат. caries — гниение) — патологический процесс, заключающийся в разрушении твердых тканей зуба вследствие дистрофического (нарушение питания) или инфекционного процесса в кости или надкостнице. Кариес зубов — одно из самых распространенных заболеваний человека.

Широко известна ангина — инфекционное заболевание, протекающее в виде острого воспаление глоточного кольца (чаще всего поражаются небные миндалины). Они увеличиваются в размерах, могут покрываться пленкой, гноем.

Глотка

Сформировавшийся в ротовой полости пищевой комок перемещается языком в направлении ротоглотки. Перемещаясь, пищевой комок попадает на корень языка и раздражает его рецепторы, после чего запускается механизм глотания.

Глотание — сложно-рефлекторный мышечный акт, в результате которого пищевой комок проталкивается из ротоглотки в пищевод, после чего достигает желудка. При глотании надгортанник рефлекторно закрывает вход в гортань, чтобы частицы пищи не попали в дыхательную систему.

© Беллевич Юрий Сергеевич 2018-2022

Данная статья написана Беллевичем Юрием Сергеевичем и является его интеллектуальной собственностью. Копирование, распространение (в том числе путем копирования на другие сайты и ресурсы в Интернете) или любое иное использование информации и объектов без предварительного согласия правообладателя преследуется по закону. Для получения материалов статьи и разрешения их использования, обратитесь, пожалуйста, к Беллевичу Юрию.

Страница не найдена |

Страница не найдена |

404. Страница не найдена

Архив за месяц

ПнВтСрЧтПтСбВс

21222324252627

28      

       

       

       

     12

       

     12

       

      1

3031     

     12

       

15161718192021

       

25262728293031

       

    123

45678910

       

     12

17181920212223

31      

2728293031  

       

      1

       

   1234

567891011

       

     12

       

891011121314

       

11121314151617

       

28293031   

       

   1234

       

     12

       

  12345

6789101112

       

567891011

12131415161718

19202122232425

       

3456789

17181920212223

24252627282930

       

  12345

13141516171819

20212223242526

2728293031  

       

15161718192021

22232425262728

2930     

       

Архивы

Мар

Апр

Май

Июн

Июл

Авг

Сен

Окт

Ноя

Дек

Метки

Настройки
для слабовидящих

рот | Определение, анатомия и функция

рот , также называемый полость рта или ротовая полость , в анатомии человека отверстие, через которое пища и воздух попадают в тело. Рот открывается наружу губами и впадает в горло сзади; его границы определяются губами, щеками, твердым и мягким небом и голосовой щелью. Она делится на два отдела: преддверие, область между щеками и зубами и собственно полость рта.Последний отдел в основном заполнен языком, крупной мышцей, прочно прикрепленной к дну рта языковой уздечкой. Помимо своей основной роли в приеме и начальном переваривании пищи, рот и его структуры играют важную роль у людей в формировании речи.

Основными структурами рта являются зубы, которые разрывают и измельчают проглоченную пищу на мелкие кусочки, пригодные для пищеварения; язык, который размещает и перемешивает пищу, а также несет сенсорные рецепторы для вкуса; и небо, которое отделяет рот от носовой полости, обеспечивая отдельные проходы для воздуха и для пищи.Все эти структуры, наряду с губами, участвуют в образовании звуков речи, изменяя прохождение воздуха через рот.

Британская викторина

Человеческое тело: правда или вымысел?

Насколько глубоки ваши знания о внутреннем устройстве человека? Проверьте это с помощью этого теста.

Ротовая полость и преддверие полностью выстланы слизистыми оболочками, содержащими множество мелких желез, которые вместе с тремя парами слюнных желез омывают рот жидкостью, сохраняя его влажным и свободным от пищи и другого мусора.Специализированные мембраны образуют как десны (десны), окружающие и поддерживающие зубы, так и поверхность языка, на которой мембрана более шероховатая по текстуре, содержащая множество мелких сосочков, удерживающих вкусовые сосочки. Влажная среда рта и ферменты в его выделениях помогают размягчать пищу, облегчая глотание и запуская процесс пищеварения. См. также переваривание.

Редакторы Британской энциклопедии Эта статья была недавно отредактирована и дополнена Адамом Зейданом.

Анатомия и развитие полости рта и глотки: моторика желудочно-кишечного тракта онлайн

Верх страницы

Ключевые точки

  • Полость рта и ротоглотка представляют собой пространства, ограниченные как твердыми, так и мягкими тканями.
  • Полость рта имеет мышечные и костные границы, но глотка представляет собой мышечную трубку.
  • Эмбриологическое/эволюционное определение полезно для понимания влияния врожденных дефектов.
  • Сложные и внешне идиосинкразические эмбриологические паттерны являются результатом четко определенных эволюционных процессов, производящих тонкий анатомический паттерн.
  • Функциональный подход к анатомии может выявить нормальную, хроническую или травматическую дисфункцию.
  • Функционально ротовая полость и ротоглотка являются путями, по которым проходит пища, их границами являются мышцы, перемещающие пищу.
  • Понимание анатомии ротоглотки является основой современной клинической практики.
  • Хотя наше понимание общей анатомии вряд ли изменится в будущем, успехи в клиническом лечении основаны на прочном фундаменте анатомических знаний.
Верх страницы

Введение

Полость рта и глотка представляют собой анатомические пространства, ограниченные твердыми и мягкими тканями (рис. 1). Форма этих двух пространств изменяется при нормальной физиологической функции окружающих структур во время речи, глотания и дыхания. Полость рта ограничена спереди губами, сбоку — щеками, сверху — твердым небом, снизу — слизистой оболочкой, покрывающей верхнюю поверхность языка, и листком мышц, прикрепляющихся к внутренней стороне нижней челюсти, включая подбородочно-подъязычный, челюстно-подъязычной и двубрюшной.Хотя в первую очередь это пространство, через которое перемещаются пища и воздух, в этом пространстве находится несколько структур, включая верхний и нижний зубной ряд, язык, слюнные железы, железы слизистой оболочки и слизистую ткань, покрывающую твердое небо, которая несет морщины. Полость рта переходит в полость глотки, более сложное и несколько неправильное пространство.

Рисунок 1: Виды полости рта и глотки.

a: Сагиттальный вид по срединной линии. б: вид сзади на полость рта и глотку.В этом виде позвоночник удален, так что вид находится в глотке. Пищевод и глотка были вскрыты, чтобы показать соединения полости носа, полости рта, гортани и пищевода с глоткой. Стрелка (b, внизу слева) представляет собой путь, по которому пища проходит через грушевидные углубления, расположенные по обе стороны от отверстия гортани.

Границами глотки являются рот и носовые хоаны спереди; мягкое небо, или велум, и части основания черепа сверху; задняя часть языка внизу; и констрикторы глотки сзади.В своем переднем/нижнем аспекте глотка соединяется с гортанью; прилегающая нижняя часть часто упоминается как «гипофаринкс» или «гортаноглотка». В своей передней/верхней части глотка соединяется с носовой полостью, и эта верхняя часть называется носоглоткой. Средняя часть глотки, где она соединяется с полостью рта, называется ротоглоткой. Таким образом, язык лежит как в ротовой полости, так и в глотке. В глотке обнаруживаются различные миндалины, состоящие из лимфоидной ткани.Глоточная миндалина находится на своде носоглотки. Небные миндалины представляют собой двусторонние образования в ротоглотке, а язычные миндалины лежат на задней части языка.

Существует несколько способов описания специфики и деталей этих пространств и структур, которые их ограничивают. Один классический подход основан на эмбриологии и истории развития этих пространств. 1, 2, 3 Поскольку эмбриология следует эволюционному происхождению этих пространств, она обладает достоинством очерчивания эволюционных ограничений пространств и объяснения некоторых недостатков дизайна в отношении функции.Этот подход очень полезен для тех, кто работает с влиянием морфологических врожденных аномалий на функцию, а также с исправлением этих аномалий. Функциональный подход, начинающийся с физиологии и механики структур с последующим описанием сенсорного и моторного картирования соответствующих структур, полезен для применения анатомии к пониманию нормальной функции, а также хронической и травматической дисморфологии.

Существует множество превосходных текстов по анатомии, изобилующих подробными сведениями. 4, 5, 6, 7 Исторически сложилось так, что анатомические атласы содержат морфологические подробности, выходящие за рамки доступных в текстах. Последние разработки в области обработки изображений и публикации продолжают эту традицию. 1, 8, 9, 10 Поскольку сущность анатомии мало изменилась за прошедшие годы, некоторые старые тексты по-прежнему актуальны и полезны. 11, 12, 13 Кроме того, существует множество текстов с более физиологичным взглядом, в которых некоторые части анатомии объединены с более конкретной функциональной направленностью. 12, 14, 15, 16, 17, 18 Наконец, существует множество текстов, подробно описывающих эмбриологическую историю конечных взрослых структур. 2, 3, 12

Этот обзор не дублирует эти источники, а скорее обеспечивает организацию и обзор, чтобы ученые-основатели, клиницисты и другие заинтересованные читатели могли использовать эти детали по своему усмотрению. Информация в этом обзоре взята из многих из этих источников.Иногда между этими источниками возникают противоречия (например, в их описании иннервации двигательных нервов к мышцам глотки), и мы попытались указать на такие противоречия. Таким образом, мы представляем как эмбриологический обзор, так и функциональный обзор этих пространств и связанных с ними структур.

Верх страницы

Эмбриологический обзор

Костный череп взрослых формируется из сложного набора эмбриологических предшественников множества тканей. В общем, кости скелета млекопитающих имеют два разных происхождения на гистологическом уровне: либо предварительно сформированные в хряще (эндохондральная кость), либо прямое окостенение мезенхимы (перепончатая кость).Почти все посткраниальные кости являются эндохондральными, но многие кости головы и шеи являются перепончатыми костями.

Перепончатые кости, включая теменные, височные и лобные кости, а также части затылочных костей, образуют свод черепа и происходят из костного панциря ранних рыб. Верхняя и нижняя челюсти, а также части неба и скуловой кости также образуются путем прямого окостенения.

Эндохондральные кости черепа имеют несколько различных источников хрящевых шаблонов.Кости основания черепа, лежащие в основе головного мозга, являются эволюционными потомками хондрокраниума, хрящевой структуры, окружавшей мозг у ранних позвоночных. У человека эти ткани изначально представляют собой набор капсул (обонятельных, зрительных и слуховых), которые сливаются с набором срединных эмбриональных хрящевых структур (прехордальный хрящ, гипофизарный хрящ и парахордальный хрящ). Вместе они образуют решетчатую кость, тело, малые и большие крылья клиновидной кости, каменистую часть височной кости и основание затылочной кости.

Другие кости, образованные из хрящей, являются производными глоточных дуг, сложных структур, эволюционно возникших из структур, которые поддерживали и содержали жабры у ранних позвоночных. Этот набор из пяти последовательных структур, также называемых жаберными дугами, проходит спереди назад. Они начинают формироваться на 22-й день развития человека (начало четвертой недели) в области головы и шеи, но обнаруживаются у всех зародышей млекопитающих. Каждая дуга содержит внешнее покрытие из эктодермальной ткани; среднее ядро ​​​​мезодермальной ткани, которое образует нерв, мышцу и хрящ; и внутренний покров энтодермы.Хрящи из дужек образуют многочисленные структуры ротоглотки: кости среднего уха, шиловидный отросток, подъязычную кость, хрящи гортани (табл. 1). Ткань в каждой из дуг также становится мышцей, нервом и кровеносными сосудами (таблица 1). В общем, первая дуга становится челюстями, вторая дуга становится аспектами лица и уха, третья дуга становится структурами, связанными с подъязычной костью и верхней частью глотки, а четвертая и шестая дуги (пятая дуга исчезает) становятся структурами, связанными с гортанью и нижней частью глотки. .Многочисленные и подробные карты различных тканей, а также сенсорных полей существуют во многих текстах по эмбриологии. 2, 3

Формирование лица, неба и верхних структур полости рта основано на динамике развития первой дуги. Первая дуга рано распадается на две узнаваемые части: нижнечелюстную и верхнечелюстную части. К концу четвертой недели развития они, в свою очередь, образуют пять отчетливых вздутий: два верхнечелюстных, два нижнечелюстных и одно верхнее срединное вздутие: лобно-носовой отросток.В эти ткани проникают клетки, называемые клетками нервного гребня, которые ответственны за рост этих опухолей. В конце концов слияние этих вздутий образует внешнее лицо. Небольшая щель становится ртом, а утолщения эктодермы по средней линии в конечном итоге становятся ямками, которые впоследствии станут носовыми ходами. Выросты этих тканей также становятся небом.

Ткань глоточных дуг также отвечает за формирование слизистой оболочки языка. Сложные закономерности как общего, так и специального ощущения языка являются отражением его сложного развития.Мезодерма первой дуги образует передние две трети языка до слепого отверстия, тогда как мезодерма третьей и четвертой дуг формирует заднюю одну треть. Дополнительная ткань из затылочных сомитов вносит вклад в мускулатуру языка. Эта ткань, изначально расположенная позади глоточных дуг, иннервируется черепным нервом (ЧН) XII, подъязычным нервом.

Пространства между дужками снаружи называются щелями, внутри карманами. Наружная щель между первыми двумя дугами способствует формированию наружного слухового прохода.Остальные расщелины поглощаются в процессе развития. Соответствующий внутренний мешок между первыми двумя арками становится барабанной полостью и слуховой или евстахиевой трубой. Остальные мешочки вносят вклад в железистую ткань головы и шеи. К ним относятся небные миндалины из второго кармана, нижние паращитовидные железы и вилочковая железа из третьего кармана, верхние паращитовидные железы из четвертого кармана и ультражаберное тело из самой нижней части четвертого кармана. После формирования эти ткани мигрируют в свои взрослые места во время нормального развития.

Эти эмбриологические взаимоотношения, не говоря уже об анатомии взрослого человека, кажутся лишь незначительно структурированными. То есть, хотя черепные нервы пронумерованы от I до XII, поля их иннервации перекрываются, а не строго сверху вниз или спереди назад. У организмов, сохраняющих более примитивную анатомию, таких как ранние хордовые и даже некоторые рыбы, амфибии и рептилии, взрослые структуры организованы серийно и точно отражают эмбриологический порядок дуг, так что структуры, поставляемые CN II, всегда впереди. поставляемые CN III.Значительная эволюционная реорганизация областей головы и шеи приводит к тому, что модель млекопитающих больше не является линейной и четко организованной. 19

Эволюционная история, породившая эти модификации, завораживает. Здесь действуют два различных фактора: ограничение и адаптация. Эволюция редко создает морфологию, оптимальную для функции. Вместо этого, чтобы справиться с вызовами изменяющейся среды и конкуренцией со стороны других организмов, отбор оперирует вариациями, порожденными мутациями и часто небольшими генетическими изменениями, которые приводят к более значительным изменениям в программе развития организма. 20 Таким образом, существующие формы, такие как жаберные или глоточные дуги, создают ограничения. Однако, приспосабливаясь к новым условиям, таким как обитание на суше и дыхание воздухом, организмы модифицируют старые структуры для выполнения новых функций. 21 Последующая адаптация к эндотермии («теплокровность»), потребность в более высоком потреблении энергии и разделение глотания и дыхания еще больше изменили существующую морфологию. 22, 23, 24, 25

Тем не менее полезно оценить эволюционную связь, которая проявляется в эмбриональном развитии человека.Существует множество клинических состояний, которые, по-видимому, влияют на различные структуры. При этом пораженные структуры объединяет эмбриологическое происхождение (табл. 1). Эти проблемы, часто называемые синдромами первой и второй дуги, включают синдром Гольденхара, нижнечелюстно-лицевые дизостозы, такие как синдромы Тричера-Коллинза или Халлерманна-Шрайффа, и синдромы Ди Джорджи. 26

Верх страницы

Анатомические структуры взрослого человека

Существует функциональная ось (пищевой путь), которая следует по пути проглоченной пищи от рта на переднем конце, двигаясь кзади через ротовую полость в ротоглотку, а затем вниз через гортаноглотку, в пищеводное отверстие.

Кости, окружающие первую часть пищевого пути, включают верхнюю и нижнюю челюсть, кости, несущие зубной ряд, и твердое небо, состоящее из небного отростка верхней челюсти и верхнечелюстного отростка небных костей. Черепное основание, образующее крышу глотки, представляет собой тело крыловидной кости, эндохондральной кости. Последняя часть пищевого пути определяется мышцей, но подъязычная кость и хрящи гортани являются структурами глоточной дуги, которые закрепляют эту мышцу.

Другими важными твердыми тканями полости рта являются зубы. Зубной ряд человека, уходящий корнями в верхнюю и нижнюю челюсть, состоит из 32 зубов в четырех квадрантах, левом и правом, верхнем и нижнем. Люди рождаются беззубыми, а первые молочные зубы прорезываются примерно через 6–8 месяцев после рождения. В каждом квадранте по пять молочных зубов: медиальный и латеральный резцы, клык, первый и второй моляры. Эти зубы заменяются постоянными или взрослыми зубами, и, кроме того, два премоляра и третий моляр прорезываются как часть взрослого зубного ряда.Все, кроме третьего моляра, находятся на месте примерно к 12 годам. Третий моляр у современных людей прорезывается намного позже и часто вообще не прорезывается.

Мышцы, образующие стенки ротовой полости, устроены проще, чем те, что образуют стенки глотки. Круговая мышца рта, которая окружает отверстие рта и функционирует как сфинктер, закрывающий его, является передней границей ротовой полости. Другими мышцами, которые контролируют губы и, следовательно, вход в полость рта, являются лабиальные мышцы: поднимающая верхнюю губу, опускающая угол рта и рисорная мышца.Сторонами ротовой полости можно считать зубной ряд, когда рот закрыт и челюсть приподнята, или щечную мышцу, образующую щеки. Они считаются поверхностными мимическими мышцами и получают моторное питание от ветвей CN VII, лицевого нерва.

Жевательные мышцы, хотя и не образуют границ ротовой полости или глотки, имеют решающее значение для движения челюстей и, следовательно, для ротовой функции. Многие из этих мышц иннервируются V3 (нижнечелюстная ветвь тройничного нерва): височная, жевательная, медиальная крыловидная и латеральная крыловидная.

Нижней границей полости рта может считаться либо язык, либо мышцы ротового дна, отвечающие за открывание челюсти. Язык представляет собой мышечный гидростат, 27 структура с мышцами, но без скелетной опоры, способная двигаться. Она состоит из четырех наружных мышц — подбородочно-язычной (XII), подъязычно-язычной (XII), шилоязычной (XII) и небно-язычной (X или XI) — и трех групп внутренних волокон — вертикальных, поперечных и продольных — все они иннервируются подъязычной мышцей. нерв (XII).Подбородочно-язычная мышца — это внешняя мышца, поскольку она берет начало на нижней челюсти; однако его вставка сливается с внутренними волокнами без четкой демаркации. Нервное снабжение языка состоит из трех частей. Двигательная иннервация, подробно описанная выше, представляет собой общий сенсорный компонент, который включает язычный нерв (V3) к передним двум третям, ветви языкоглоточного нерва (IX) к задней одной трети и небольшую область у основания, снабжаемую внутренний гортанный нерв (Х). Особое ощущение вкуса обеспечивается барабанной струной, ветвью лицевого нерва (VII), в переднюю часть и языкоглоточным нервом (IX) и внутренней гортанью (X) в заднюю треть.

Мышцы ротового дна представляют собой листы параллельной волокнистой ткани, идущие от подъязычной кости к нижней челюсти, и включают двубрюшные (V3 и VII), челюстно-подъязычные (V3) и подбородочно-подъязычные (XII и C1). На оральной стороне или внутри подбородочно-подъязычной мышцы лежит одна из мышц языка, подбородочно-язычная (XII). Общая чувствительность ротовой полости определяется ветвями тройничного нерва (V). Верхние отделы, включая небо и зубы, иннервируются ветвями верхнечелюстного нерва (V2), а нижние отделы включают слизистую дна полости рта от нижнечелюстного нерва (V3).Существует значительное вегетативное иннервирование железистой ткани в ротовой полости. Симпатические части происходят от уровня Т1 спинного мозга, синапсов в верхнем шейном ганглии, а постганглионарные нервы проходят с кровеносными сосудами в ткань-мишень. Парасимпатические структуры являются ветвями лицевого нерва (VII), но распространяются вместе с ветвями V2 или V3 в верхнюю или нижнюю части ротовой полости. Считается, что двубрюшная мышца является основной мышцей открывания челюсти, тогда как подбородочно-подъязычная мышца является основной мышцей, поднимающей подъязычную кость.Щитоподъязычная мышца сближает щитовидный хрящ с подъязычной костью при глотании; таким образом, синергетическое сокращение этих мышц объясняет подъем гортанно-подъязычной кости при глотании.

По мере обработки пищи путем растирания твердой пищи или транспортировки жидкостей она покидает ротовую полость и попадает в глотку. Границами между этими двумя пространствами являются место соединения твердого и мягкого нёба, отверстие слепой кишки, обозначающее границу между передними двумя третями и задней одной третью языка, и, что наиболее важно, небно-глоточная складка зева, содержащая небно-глоточные мышцы. Х или XI).Эта мышца берет начало спереди и сверху как от твердого неба, так и от апоневроза мягкого неба, а затем направляется книзу/кзади в стенку глотки. Небно-глотка функционально отделяет ротовую полость от ротоглотки.

Мягкое небо является верхней границей ротоглотки и состоит из нескольких мышц, соединяющихся в апоневроз: мышц, напрягающих небные мышцы (V3), поднимающих небные мышцы (X или XI), небно-глотки (X или XI), язычка (X или XI) ) и небно-язычный (X или XI).Основным подъемником мягкого неба является levator veli palatini, но все эти мышцы играют важную роль в открытии или закрытии дыхательных путей во время глотания. Задняя и боковые стенки глотки образованы группами мышц, известными под общим названием констрикторы глотки. Эти мышцы, объединяющиеся в задний шов по средней линии, включают верхний, средний и нижний констрикторы, все они снабжаются ветвями блуждающего нерва (X). Внутри мышечной трубки, образованной констрикторами глотки, и частью ее стенки расположено несколько продольных мышц.Шилофарингеус отходит от шиловидного отростка в стенку глотки, а небно-глоточный отходит от мягкого неба в эту стенку. Эти продольные мышцы также отвечают за поддержание глоточной части дыхательных путей и могут играть роль в укорочении глотки при глотании (путем поднятия гортаноглотки). Дистальным концом глотки является верхний пищеводный сфинктер (ВЭС, X или XI), который состоит из нижней части нижнего констриктора и, по мнению большинства авторов, поверхности перстневидного хряща.В некоторых источниках эту мышцу делят на перстнеглоточную и щитоглоточную мышцы. Перстнеглоточная мышца уникальна тем, что в ее поперечной части нет срединного шва. Эта мышца тонически активна между глотками, удерживая УПС закрытым. Неясно, способствуют ли этому закрытию сфинктера нижние волокна щитоглотки и верхние волокна мускулатуры пищевода. UES представляет собой конец пути пищи через глотку и точку входа болюса в пищевод.

Чувствительные нервы глотки иннервируются главным образом языкоглоточным и блуждающим нервами (IX и X). Ветви этих нервов, включая глоточную ветвь языкоглоточного (IX), небольшие ветви от наружного и верхнего гортанных нервов, а также глоточные ветви, оба от блуждающего (X), образуют глоточное сплетение, лежащее на стенке глотки. Исключением являются участки носоглотки, куда входят ветви верхнечелюстного нерва (V2). Глоточное сплетение также удерживает двигательные нейроны в мышцах-констрикторах глотки.

Кровоснабжение полости рта и глотки осуществляется ветвями наружной сонной артерии. Ветви наружной сонной артерии, кровоснабжающие структуры полости рта и глотки, — это восходящая глоточная а., язычная а., лицевая а., задняя ушная а., поверхностная височная а. и многочисленные ветви верхнечелюстной а. Венозный отток осуществляется через множество притоков, включая лицевой, язычный и глоточный vv.

Верх страницы

Изменения в развитии

Как постоянные, так и дискретные изменения происходят в анатомии ротовой полости и глотки в ходе постнатального развития.Наиболее анатомически значимым изменением является прорезывание молочных зубов примерно через 6 месяцев после рождения. Однако процесс перехода от жидкой диеты к твердой пище у людей происходит постепенно, и отлучение от груди часто происходит в течение многих месяцев. Многочисленные другие непрерывные изменения происходят в течение этого периода времени. Наиболее функционально значимым изменением является опускание гортани и связанные с этим изменения в защите дыхательных путей. 15, 28, 29 У младенцев верхнее расположение гортани приводит к тому, что ее отверстие находится в носоглотке.Это интранаральное положение означает, что младенцы, как и почти все млекопитающие, не являющиеся человеком, считаются имеющими облигатное носовое дыхание. 15 Однако существуют патологические состояния, такие как гипертрофия аденоидов, которые приводят к оральному дыханию. 30 Несмотря на «замыкание» гортани в носоглотку, дыхание при глотании равномерно останавливается. 31, 32 Изменения гортани связаны с увеличением размера ротоглотки по сравнению с носоглоткой, изменениями угла базикрания и другими тонкими изменениями морфологии глотки, которые продолжаются в подростковом возрасте. 28, 33

Верх страницы

Актуальность анатомии для клинической практики

Опущение подъязычной кости и гортани в раннем постнатальном развитии имеет важное значение для глотания и дыхания, а также для коммуникации. Неонатальное положение гортани окончательно отделяет дыхательные пути от пищевых путей во время спокойного дыхания. Попадание пищи, скапливающейся в ротовой полости и ротоглотке, в гортаноглотку или гортань предотвращается непосредственным контактом надгортанника и гортани с обволакивающими тканями зева и мягкого неба.Этот контакт ненадолго прерывается во время глотания, когда мягкое небо приподнимается, а надгортанник загибается вниз, но затем быстро восстанавливается после глотания. Интранаральное положение гортани также препятствует потоку воздуха через рот и тем самым ограничивает вокализацию. Гортань оттягивается вниз во время детского плача, имитируя положение взрослого человека.

Опускание гортани имеет важное значение для речи, поскольку оно позволяет воздуху проходить через гортань, глотку и ротовую полость. Речь, очевидно, несет огромную пользу для человеческого общения.Тогда возникает вопрос, учитывая преимущество опущенной гортани для речи, почему это опущение не происходит внутриутробно. Конечно, есть вопросы, касающиеся коркового развития, необходимого для речи, и доказательства того, что это развитие происходит постнатально. Но постнатальное развитие мозговой способности к устной речи не требует, чтобы развитие периферических структурных механизмов речи происходило также постнатально. Нет необходимости отделять дыхательные пути от пищевых путей внутриутробно, потому что оба они заполнены амниотической жидкостью.Но новорожденный должен приспособиться к огромным изменениям в окружающей среде в момент рождения, с необходимостью быстрого наполнения обоих легких воздухом. Внутриносовая гортань обеспечивает верхние дыхательные пути, структурно изолированные от ротовой полости, с полужестким хрящевым каркасом для верхних дыхательных путей. Это упрощает задачу установления и поддержания проходимости дыхательных путей и снижает вероятность обструкции дыхательных путей. Действительно, относительно слабые мышцы глотки и мягкого неба новорожденного могут нуждаться в этой структурной поддержке для поддержания целостности дыхательных путей для дыхания, особенно во время сна.Неспособность поддерживать проходимость дыхательных путей является причиной обструктивного апноэ сна.

Вопрос безопасности при глотании также имеет решающее значение. Координация сосания, глотания и дыхания у новорожденного развита не полностью, что создает риск глотательной аспирации. Внутриносовая гортань предотвращает попадание болюса в гортань до и после проглатывания и, таким образом, снижает риск обструкции дыхательных путей и/или загрязнения проглоченным молоком или другим материалом.

Верх страницы

Заключение

Хотя наше понимание общей анатомии существенно не изменилось за десятилетия, понимание этой анатомии является основой современной клинической практики.Дисморфологию можно оценить только по отношению к нормальной морфологии. Обсуждения нормальных и ненормальных функций опираются на общий словарь и общую карту структур. Анатомия полости рта и глотки особенно сложна, учитывая ограничения эволюции и развития, которые диктуют морфологические отношения взрослых. Хотя в области общей анатомии вряд ли произойдут революционные изменения в будущем, наши достижения в области клинического лечения основаны на прочном фундаменте анатомических знаний.

Содержание, связанное со статьей

  • Верхний пищеводный сфинктерОбзор Физиология полости рта, глотки и верхнего пищеводного сфинктераОбзор Верхний пищеводный сфинктерКлинические нарушения верхнего пищеводного сфинктера
  • Ротовая и глоточная моторика > физиологияСинопсис Физиология ротовой, глоточной и пищеводной моторикиОбзор Физиология ротовой полости, глотки и верхнего пищеводного сфинктераОбзор Верхний пищеводный сфинктерАнатомия и развитие и физиология гортаниАнатомия, развитие и физиология легкихРоль коры головного мозга в контроле глотанияЭлектрофизиологическая характеристика глотания генератор паттернов в стволе мозгаНейральные цепи и медиаторы, регулирующие глотание в стволе мозгаКоординация дыхания и глотанияРефлекторное взаимодействие глотки, пищевода и дыхательных путейГлотание и кормление у младенцев и детей раннего возрастаОбзор Физиология моторики пищевода
  • Гортань > физиологияОбзор Физиология полости рта, глотки и верхнего пищеводного сфинктераОбзор Анатомия и развитие и физиология гортани
  • Полость рта и глотка > анатомия и физиологияОбзор Физиология полости рта, глотки и верхнего пищеводного сфинктераОбзор Анатомия и развитие и физиология гортани
  • Подвижность верхнего пищеводного сфинктера > физиологияСинопсис Физиология ротовой, глоточной и пищеводной моторикиОбзор Физиология ротовой полости, глотки и верхнего пищеводного сфинктераОбзор Верхний пищеводный сфинктерАнатомия и развитие и физиология гортаниАнатомия, развитие и физиология легкихРоль коры головного мозга в контроле глотанияЭлектрофизиологическая характеристика глотания Генератор паттернов в стволе мозга Нервные цепи и медиаторы, регулирующие глотание в стволе мозга Координация дыхания и глотания Рефлекторное взаимодействие глотки, пищевода и дыхательных путей Обзор Нарушения моторики ротового, глоточного и верхнего пищеводного сфинктеров Физиология моторики пищевода
  • Гортань > анатомия и развитиеОбзор Физиология полости рта, глотки и верхнего пищеводного сфинктераОбзор Анатомия, развитие и физиология гортани

Слизистая оболочка полости рта человека: развитие, структура и функция

Предисловие vii

1 Функции слизистой оболочки полости рта 3

1.1 Слизистая оболочка полости рта: что это такое и что она делает? 3

1.2 Функции оральной слизистой оболочки 5

Ссылки 7

2 Организация устной слизистой оболочки 9

2.1 Клинические особенности 10

2.2 Комплектующие ткани и железы 14

Ссылки 16

3 Оральный эпителий 19

3.1 Гистологическое строение эпителия полости рта 20

3.2 Пролиферация и обмен эпителия 24

3.3 Молекулярная и клеточная организация перорального эпителия 29 20009

3.4 без кератиноцитов в пероральном эпителий 41

Ссылки 50

4 Интерфейс между эпителием и соединительной тканью 53

4.1 Организация нормального интерфейса 55

4.2 Imment -опосредованные субэпителиальные пузырчатые болезни (IMSEBDS) 57

Литература 58

5 Соединительная ткань 59

5.1 Собственная пластинка пластинки 59

5.2 кровоснабжение 68

5.3 нерв питания 70

Ссылки 74

6 региональные различия в оральной слизистой оболочке 77 97

6.1 структурные вариации в разных областях 77

6.2 Устанавливаются в полости рта 85

Ссылки 97

7 Развитие и старение слизистой оболочки полости рта 99

7.1 Стадии развития слизистой оболочки полости рта 100

7.2 Контроль развития слизистой оболочки: эпителиально-мезенхимальное взаимодействие 104

7.3 стажировки 106

Ссылки 109

Ссылки 109

8 Барьерные функции оральной слизистой оболочки 113

8.1 Барьер проницаемости 114

8.2 Иммунологический барьер Функция оральной слизистой оболочки 122

Ссылки 135

9 Гомологии в структуре и функционируют среди слизистых муко : слизистая рта, пищевода и влагалища 145

9.1 Пищевод 145

9.2 Влагалище 147

9.3 Организация тканей пищевода и влагалища 147

9.4 не кератиноцитов в эзофагеальном и вагинальном слизистой оболочке 153

9.5 намногают контурные клетки 154

ссылки 154

ссылки 154

индекс 159

оральные микробиомы: все большее значение в полости рта и целого тела

  • ADLER CJ, Dobney k , Weyrich LS, Kaidonis J, Walker AW, Haak W, Bradshaw CJ, Townsend G, Sołtysiak A, Alt KW et al (2013) Секвенирование древнего кальцифицированного зубного налета показывает изменения в микробиоте полости рта с диетическими сдвигами неолита и промышленной революции.Нат Жене 45(4):450–455

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Аньелло М., Маркес Дж., Сен Л., Миттермюллер Б., Хуанг А., Чайханасакул Тран Н., Ши В., Хе Х., Шрот Р.Дж. (2017) Микробиом, связанный с тяжелым кариесом у детей коренных народов Канады. Дж. Дент Рез. 96 (12): 1378–1385. https://doi.org/10.1177/22034517718819

    ПабМед Статья КАС Google ученый

  • Ан Дж., Ян Л., Пастер Б.Дж., Ганли И., Моррис Л., Пей З., Хейс Р.Б. (2011) Профили микробиома полости рта: пиросеквенирование 16S рРНК и сравнение анализов микрочипов.PLoS ONE 6(7):e22788

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Ahn J, Chen CY, Hayes RB (2012) Оральный микробиом и риск рака полости рта и желудочно-кишечного тракта. Cancer Causes Control 23(3):399–404

    PubMed ПабМед Центральный Статья Google ученый

  • Все микробные таксоны полости рта человека (2018 г.) http://www.homd.org/index.php?name=HOMD

  • Amer A, Galvin S, Healy CM, Moran GP (2017)Микробиом потенциально злокачественной лейкоплакии полости рта демонстрирует обогащение Fusobacterium , Leptotrichia , Campylobacter и Campylobacter и Front Microbiol 8:2391–2400

    PubMed ПабМед Центральный Статья Google ученый

  • An JY, Darveau R, Kaeberlein M (2018) Здоровье полости рта в геронауке: модели животных и старение полости рта. Геронаука 40(1):1–10

    PubMed Статья Google ученый

  • Anukam KC, Agbakoba NR (2017) Сравнительное исследование состава микробиома полости рта здоровых нигерийских женщин в постменопаузе, пременопаузе и препубертатном возрасте с использованием методов метагеномики 16s rnna.Нигер J Clin Pract 20(10):1250

    PubMed Статья КАС Google ученый

  • Atarashi K, Suda W, Luo C, Kawaguchi T, Motoo I, Narushima S, Kiguchi Y, Yasuma K, Watanabe E, Tanoue T (2017) Эктопическая колонизация оральными бактериями в кишечнике вызывает индукцию и воспаление клеток Th2 . Science 358(6361):359–365

    PubMed Статья КАС Google ученый

  • Baumgart M, Dogan B, Rishniw M, Weitzman G, Bosworth B, Yantiss R, Orsi RH, Wiedmann M, McDonough P, Kim SG et al (2007) Независимый от культуры анализ слизистой оболочки подвздошной кишки показывает избирательное увеличение инвазивного Escherichia coli новой филогении относительно истощения Clostridiales при болезни Крона, поражающей подвздошную кишку.ISME J 1:403–418

    PubMed Статья КАС Google ученый

  • Bewley AF, Farwell DG (2017)Лейкоплакия полости рта и плоскоклеточный рак полости рта. Clin Dermatol 35(5):461–467

    PubMed Статья Google ученый

  • Блэнтон Дж.М., Кирега А.Т., Ян Л., Чен Т., Леонетти С., Таннер А., Уэйд В., Пастер Б.Дж., Дьюхерст Ф.Е., Изард Дж. (2012) Микробиом ротовой полости человека: отчет о состоянии.В: Встреча AADR, Тампа

  • Блод С., Шлихтинг Н., Шюлин С., Сутткус А., Пеукерт Н., Стингу С.С., Хирш С., Элгер В., Лахер М., Бюлиген У. и др. (2017). Резервуар для острого детского аппендицита? Int J Colorectal Dis 33(2):209–218

    PubMed Статья Google ученый

  • Brito IL, Yilmaz S, Huang K, Xu L, Jupiter SD, Jenkins AP, Naisilisili W, Tamminen M, Smillie CS, Wortman JR et al (2016) Мобильные гены в микробиоме человека структурированы от глобальных до индивидуальных Весы.Природа 535(7612):435–439

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Браун Л.Р., Фромм В.Дж., Хэндлер С.Ф., Уиткрофт М.Г., Джонстон Д.А. (1976) Влияние миссий Skylab на клинические и микробиологические аспекты гигиены полости рта. J Am Dent Assoc 93(2):357–363

    PubMed Статья КАС Google ученый

  • .salivarius ATCC 27945. Genome Announc 5(24):e00536-17

  • Caballero S, Pamer EG (2015)Опосредованное микробиотой воспаление и антимикробная защита в кишечнике. Annu Rev Immunol 33:227–256

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Casarin RC, Barbagallo A, Meulman T, Santos VR, Sallum EA, Nociti FH, Duarte PM, Casati MZ, Goncalves RB (2013)Поддесневое биоразнообразие у пациентов с неконтролируемым диабетом 2 типа и хроническим пародонтитом.J Periodontal Res 48(1):30–36

    PubMed Статья КАС Google ученый

  • Chen T, Yu WH, Izard J, Baranova OV, Lakshmanan A, Dewhirst FE (2010) База данных микробиомов полости рта человека: доступный в Интернете ресурс для исследования таксономической и геномной информации о микробах полости рта. База данных (Оксфорд) 2010: baq013

  • Cianciola LJ, Park BH, Bruck E, Mosovich L, Genco RJ (1982) Распространенность заболеваний пародонта при инсулинозависимом сахарном диабете (ювенильный диабет).J Am Dent Assoc 104: 653–660

    PubMed Статья КАС Google ученый

  • Corrêa JD, Calderaro DC, Ferreira GA, Mendonça SM, Fernandes GR, Xiao E, Teixeira AL, Leys EJ, Graves DT, Silva TA (2017) Дисбиоз поддесневой микробиоты при системной красной волчанке: связь с пародонтальным статусом. Микробиом 5:34–46

    PubMed ПабМед Центральный Статья Google ученый

  • Costalonga M, Herzberg MC (2014)Микробиом полости рта и иммунобиология заболеваний пародонта и кариеса.Immunol Lett 162 (2 части A): 22–38

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Костелло Э.К., Лаубер К.Л., Хамади М., Фиерер Н., Гордон Дж.И., Найт Р. (2009)Изменение бактериального сообщества в средах обитания человека в пространстве и времени. Science 326(5960):1694–1697

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Костелло Э.К., Релман Д.А. (2014)Здоровье населения: незрелость микробного сообщества кишечника.Природа 510(7505):344–345

    PubMed Статья КАС Google ученый

  • Cullinan MP, Westerman B, Hamlet SM, Palmer JE, Faddy MJ, Lang NP, Seymour GJ (2001) Продольное исследование полиморфизмов гена интерлейкина-1 и заболеваний пародонта у взрослого населения в целом. J Clin Periodontol 28:1137–1144

    PubMed Статья КАС Google ученый

  • Данг А.Т., Коттон С., Санкаран-Уолтерс С., Ли К.С., Ли С.И., Дандекар С., Пастер Б.Дж., Джордж М.Д. (2012) Доказательства увеличения патогенного следа в лингвальном микробиоме нелеченых ВИЧ-инфицированных пациентов.BMC Microbiol 12:153

    PubMed ПабМед Центральный Статья КАС Google ученый

  • de Araújo MF, Etchebehere RM, de Melo MLR, Beghini M, Severino VO, de Castro Cobo E, Rocha Rodrigues DB, de Lima Pereira SA (2017) Анализ CD15, CD57 и HIF-1α в биоптатах пациентов с периимплантитом. Pathol Res Pract 213(9):1097–1101

    PubMed Статья КАС Google ученый

  • Dewhirst FE, Chen T, Izard J, Paster BJ, Tanner AC, Yu WH, Lakshmanan A, Wade WG (2010) Микробиом ротовой полости человека.J Bacteriol 192(19):5002–5017

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Дин Т., Шлосс П.Д. (2014)Динамика и ассоциации типов микробных сообществ в организме человека. Природа 509(7500):357–360

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Emrich LJ, Shlossman M, Genco RJ (1991) Пародонтоз при инсулиннезависимом сахарном диабете.J Periodontol 62:123–131

    PubMed Статья КАС Google ученый

  • Эрен А.М., Борисы Г.Г., Хусэ С.М., Марк Уэлч Д.Л. (2014)Олиготипический анализ микробиома полости рта человека. Proc Natl Acad Sci USA 111(28):E2875–E2884

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Fan X, Алексеенко А.В., Ву Дж., Петерс Б.А., Джейкобс Э.Дж., Гапстур С.М., Purdue MP, Abnet CC, Stolzenberg-Solomon R, Miller G et al (2016) Микробиом ротовой полости человека и предполагаемый риск рака поджелудочной железы: популяционное вложенное исследование случай-контроль.Gut 67(1):120–127

    PubMed Статья Google ученый

  • Фардини Ю., Чанг П., Дамм Р., Джоши Н., Хан Ю.В. (2010) Передача различных бактерий полости рта в плаценту мыши: доказательства того, что микробиом полости рта является потенциальным источником внутриутробной инфекции. Infect Immun 78(4):1789–1796

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Ford AC, Moayyedi P, Hanauer SB (2013) Язвенный колит.BMJ 346:f432

    PubMed Статья Google ученый

  • Galvão-Moreira LV, de Andrade CM, de Oliveira JFF, Bomfim MRQ, Figueiredo PMS, Branco-de-Almeida LS (2017)Половые различия в слюнных параметрах восприимчивости к кариесу у здоровых людей. Здоровье полости рта Prev Dent 16(1):71–77

    Google ученый

  • Gaugler J, James B, Johnson T, Scholz K, Weuve J (2016) Отчет об ассоциации с болезнью Альцгеймера; Факты и цифры болезни Альцгеймера.Болезнь Альцгеймера 12:459–509

    Статья Google ученый

  • Ge X, Rodriguez R, Trinh M, Gunsolley J, Xu P (2013) Оральный микробиом глубоких и мелких зубных карманов при хроническом пародонтите. PLoS ONE 8(6):1–10

    Google ученый

  • Gentschew L, Ferguson LR (2012) Роль питания и микробиоты в восприимчивости к воспалительным заболеваниям кишечника. Mol Nutr Food Res 56: 524–535

    PubMed Статья КАС Google ученый

  • Голизаде П., Эслами Х., Юсефи М., Асгарзаде М., Агазаде М., Кафил Х.С. (2016)Роль микробиома полости рта при раке полости рта: обзор.Biomed Pharmacother 84:552–558

    PubMed Статья КАС Google ученый

  • Goodson JM, Groppo D, Halem S, Carpino E (2009) Является ли ожирение бактериальным заболеванием полости рта? J Dent Res 88 (6): 519–523

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Gordon JI, Klaenhammer TR (2011) Встреча с нашими микробами. Proc Natl Acad Sci USA 108 (Приложение 1): 4513–4515

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Griffen AL, Beall CJ, Firestone ND, Gross EL, Difranco JM, Hardman JH, Vriesendorp B, Faust RA, Janies DA, Leys EJ (2011) CORE: филогенетически созданная база данных 16S рДНК основного микробиома полости рта .PLoS ONE 6(4):e19051

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Hajishengallis G (2015) Пародонтит: от микробного иммунного подрыва к системному воспалению. Nat Rev Immunol 15:30–44

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Han YW, Wang X (2013) Мобильный микробиом: бактерии полости рта при внеротовых инфекциях и воспалении.J Dent Res 92: 485–491

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Han YW, Redline RW, Li M, Yin L, Hill GB, McCormick TS (2004) Fusobacterium nucleatum вызывает преждевременные и доношенные мертворождения у беременных мышей: влияние бактерий полости рта на преждевременные роды. Infect Immunity 72(4):2272–2279

    Статья КАС Google ученый

  • Han YW, Fardini Y, Chen C, Iacampo KG, Peraino VA, Shamonki JM, Redline RW (2010) Мертворождение в срок, вызванное оральным Fusobacterium nucleatum .Obstet Gynecol 115 (2 часть 2): 442

    PubMed ПабМед Центральный Статья Google ученый

  • Hansson GK (2005) Воспаление, атеросклероз и заболевание коронарных артерий. N Engl J Med 352:1685–1695

    PubMed Статья КАС Google ученый

  • Hao W, Xu H, Chen X, Zhou Q, Zhang P, Chen F, Qin M (2015) Изменения микробного богатства зубного налета и привычек поведения в полости рта во время развития кариеса у маленьких китайских детей.Caries Res 49(2):116–123

    PubMed Статья КАС Google ученый

  • Heron SE, Elahi S (2017)ВИЧ-инфекция и ослабленный иммунитет слизистых оболочек: оральные проявления и системное воспаление. Фронт Иммунол 8:241

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Holt SC, Ebersole J, Felton J, Brunsvold M, Kornman KS (1988)Имплантация Bacteroides gingivalis нечеловекообразным приматам вызывает прогрессирование периодонтита.Science 239(4835):55–57

    PubMed Статья КАС Google ученый

  • Домашняя страница HOMD (2016 г.) http://www.homd.org/?name=HOMD

  • Hu XS, Zhang Q, Hua H, Chen F (2016a) Изменения в микробиоте слюны при лейкоплакии полости рта и раке полости рта. Oral Oncol 56: e6–e8

    PubMed Статья Google ученый

  • Hu X, Zhang Q, Hua H, Chen F (2016b) Изменения в микробиоте слюны при лейкоплакии полости рта и раке полости рта.Oral Oncol 56:6–8

    Статья Google ученый

  • Консорциум проектов микробиома человека (2012 г.) Структура, функции и разнообразие микробиома здорового человека. Природа 486(7402):207–214

    Артикул КАС Google ученый

  • Обзор проекта микробиома человека (2017 г.) http://commonfund.nih.gov/hmp/overview

  • Jenkinson HF, Lamont RJ (2005) Оральные микробные сообщества при болезни и здоровье.Trends Microbiol 13(12):589

    PubMed Статья КАС Google ученый

  • Джорт П., Тернер К. Х., Гумус П., Низам Н., Будунели Н., Уайтли М. (2014) Метатранскриптомика микробиома полости рта человека в норме и при болезни. MBio 5(2):e01012–e01014

    PubMed ПабМед Центральный Статья Google ученый

  • Хосе Ф.А., Хейман М.Б. (2008)Внекишечные проявления воспалительного заболевания кишечника.J Pediatr Gastroenterol Nutr 46:124–133

    PubMed ПабМед Центральный Статья Google ученый

  • Kaistha A, Levine J (2014)Воспалительное заболевание кишечника: классическое аутоиммунное заболевание желудочно-кишечного тракта. Curr Probl Pediatr Adolesc Health Care 44:328–334

    PubMed Статья Google ученый

  • Kamer AR, Craig RG, Pirraglia E, Dasanayake AP, Norman RG, Boylan RJ, Nehorayoff A, Glodzik L, Brys M, de Leon MJ (2009) ФНО-альфа и антитела к пародонтальным бактериям различают пациентов с болезнью Альцгеймера и нормальные предметы.J Нейроиммунол 216:92–97

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Хор Б., Гардет А., Ксавьер Р.Дж. (2011)Генетика и патогенез воспалительного заболевания кишечника. Природа 474:307–317

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Koren O, Spor A, Felin J, Fåk F, Stombaugh J, Tremaroli V, Behre CJ, Knight R, Fagerberg B, Ley RE et al (2011) Микробиота полости рта, кишечника и бляшек человека у пациентов с атеросклерозом .Proc Natl Acad Sci 108 (Приложение 1): 4592–4598

    PubMed Статья Google ученый

  • Kuczynski J, Lauber CL, Walters WA, Parfrey LW, Clemente JC, Gevers D, Knight R (2012) Экспериментальные и аналитические инструменты для изучения микробиома человека. Nat Rev Genet 13(1):47–58

    Статья КАС Google ученый

  • Лафори Г.И., Сабогал М.А., Кастильо Д.М., Ринкон М.В., Гомес Л.А., Лесмес Ю.А., Шамброне Л. (2017) Профили микробиома и микробной биопленки периимплантита: систематический обзор.J Periodontol 88(10):1066–1089

    PubMed Статья Google ученый

  • Лассаль Ф., Спаньолетти М., Фумагалли М., Шоу Л., Дайбл М., Уокер С., Томас М.Г., Бамберг Мильяно А., Баллу Ф. (2017) Пероральные микробиомы охотников-собирателей и традиционных фермеров выявляют сдвиги в балансе комменсалов и патогенов нагрузки, связанные с диетой. Мол Экол 27(1):182–195

    PubMed Статья Google ученый

  • Lee WH, Chen HM, Yang SF, Liang C, Peng CY, Lin FM, Tsai LL, Wu BC, Hsin CH, Chuang CY et al (2017) Бактериальные изменения микробиоты слюны и их связь с раком полости рта.Научный отчет 7:1–11

    Статья КАС Google ученый

  • Leonardi I, Li X, Semon A, Li D, Doron I, Putzel G, Bar A, Prieto D, Rescigno M, McGovern DPB et al (2018) Мононуклеарные фагоциты CX3CR1+ контролируют иммунитет к кишечным грибкам. Science 359(6372):232–236

    PubMed Статья КАС ПабМед Центральный Google ученый

  • Li Y, Saxena D, Chen Z, Liu G, Abrams WR, Phelan JA, Norman RG, Fisch GS, Corby PM, Dewhirst F et al (2014) ВИЧ-инфекция и микробное разнообразие в слюне.J Clin Microbiol 52(5):1400–1411

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Либби П., Ридкер П.М., Мазери А. (2002) Воспаление и атеросклероз. Тираж 105(9):1135–1143

    PubMed Статья КАС Google ученый

  • Lindheim L, Bashir M, Münzker J, Trummer C, Zachhuber V, Pieber TR, Gorkiewicz G, Obermayer-Pietsch B (2016) Микробиом слюны при синдроме поликистозных яичников (СПКЯ) и его связь с параметрами, связанными с заболеванием : пилотное исследование.Front Microbiol 7:1270

    PubMed ПабМед Центральный Статья Google ученый

  • Ling Z, Liu X, Cheng Y, Jiang X, Jiang H, Wang Y, Li L (2015) Снижение разнообразия микробиоты полости рта у пациентов с хроническим заболеванием печени, вызванным вирусом гепатита B: пилотный проект. Научный представитель 5:17098

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Lirajunior R, Boström EA (2018) Соединение полости рта и кишечника: на шаг ближе к комплексному представлению о желудочно-кишечном тракте? Иммунол слизистых оболочек.https://doi.org/10.1038/mi.2017.116

    Артикул Google ученый

  • Лю Б., Фаллер Л.Л., Клитгорд Н., Мазумдар В., Годси М., Соммер Д.Д., Гиббонс Т.Р., Треанген Т.Дж., Чанг Ю.К., Ли С. и др. (2012) Глубокое секвенирование микробиома полости рта выявляет признаки пародонтита. PLoS ONE 7(6):e37919

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Лоди Г., Скалли С., Карроццо М., Гриффитс М., Сугерман П.Б., Тонгпрасом К. (2005) Текущие разногласия по поводу красного плоского лишая полости рта: отчет о международном консенсусном совещании.Часть 1. Вирусные инфекции и этиопатогенез. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 100:40–51

    PubMed Статья Google ученый

  • Лукас Лопес Р., Гранде Бургос М.Дж., Гальвес А., Перес Пулидо Р. (2017) Желудочно-кишечный тракт человека и микробиота полости рта при воспалительных заболеваниях кишечника: обзор состояния науки. Apmis 125(1):3–10

    PubMed Статья Google ученый

  • Ma C, Chen F, Zhang Y, Sun X, Tong P, Si Y, Zheng S (2015) Сравнение микробных профилей полости рта детей с тяжелым кариесом в раннем детстве и детей без кариеса с использованием идентификации микробов ротовой полости человека микрочип.PLoS ONE 10(3):e0122075

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Мадианос П.Н., Бобетсис Ю.А., Оффенбахер С. (2013)Неблагоприятные исходы беременности (АПО) и заболевания пародонта: патогенетические механизмы. J Clin Periodontol 40(s14):181–194

    Google ученый

  • McInnes IB, Schett G (2007)Цитокины в патогенезе ревматоидного артрита.Nat Rev Immunol 7:429–442

    PubMed Статья КАС Google ученый

  • McInnes IB, Schett G (2011) Патогенез ревматоидного артрита. N Engl J Med 365:2205–2219

    PubMed Статья КАС ПабМед Центральный Google ученый

  • Меткалф Дж.Л., Урселл Л.К., Найт Р. (2014) Зубной налет древнего человека хранит множество биологических данных.Нат Жене 46(4):321–323

    PubMed Статья КАС Google ученый

  • Meurman J (2010)Микробиота полости рта и рак. J Oral Microbiol 2:1–10

    Статья КАС Google ученый

  • Miklossy J (1993) Болезнь Альцгеймера — спирохетоз. NeuroReport 4:841–848

    PubMed Статья КАС Google ученый

  • Митчелл Льюис Д., Энгебретсон С.П., Чен Дж., Ламстер И.Б., Папапану П.Н. (2001)Пародонтальные инфекции и преждевременные роды: ранние результаты исследования группы молодых женщин из числа меньшинств в Нью-Йорке.Eur J Oral Sci 109(1):34–39

    PubMed Статья КАС Google ученый

  • Nagy K, Sonkodi I, Szöke I, Nagy E, Newman H (1998) Микрофлора, связанная с раком полости рта человека. Oral Oncol 34(4):304–308

    PubMed Статья КАС Google ученый

  • Нойман М.Г., Нанау Р.М. (2012)Воспалительные заболевания кишечника: роль диеты, микробиоты, образа жизни.Перевод Res 160:29–44

    PubMed Статья Google ученый

  • Огава Т., Хиросе Й., Хонда-Огава М., Сугимото М., Сасаки С., Киби М., Кавабата С., Икебе К., Маэда Й. (2018) Состав микробиоты слюны у пожилых людей. Научный представитель 8(1):414

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Okada Y, Wu D, Trynka G, Raj T, Terao C, Ikari K, Kochi Y, Ohmura K, Suzuki A, Yoshida S et al (2014) Генетика ревматоидного артрита способствует открытию биологии и лекарств.Природа 506:376–381

    PubMed Статья КАС Google ученый

  • Пастер Б.Дж., Олсен И., Аас Дж.А., Дьюхерст Ф.Е. (2006) Разнообразие бактерий в пародонтальном кармане человека и других участках полости рта. Пародонтол. 2000(42):80–87

    Статья Google ученый

  • Peters BA, Wu J, Pei Z, Yang L, Purdue MP, Freedman ND, Jacobs EJ, Gapstur SM, Hayes RB, Ahn J (2017) Состав микробиома полости рта отражает предполагаемый риск рака пищевода.Рак Res 77 (23): 6777–6787

    PubMed Статья КАС Google ученый

  • Питерс Б.А., Ву Дж., Пей З., Ян Л., Пердью М.П., ​​Фридман Н.Д., Джейкобс Э.Дж., Гапстур С.М., Хейс Р.Б., Ан Дж. (2009) Проект микробиома человека NIH. Genome Res 19(12):2317–2323

    Статья КАС Google ученый

  • Филип Н., Сунеджа Б., Уолш Л.Дж. (2018) Экологические подходы к профилактике кариеса зубов: смена парадигмы или заблуждение? Caries Res 52(1–2):153–165

    PubMed Статья Google ученый

  • Pickard JM, Zeng MY, Caruso R, Núñez G (2017)Микробиота кишечника: роль в колонизации патогенов, иммунных реакциях и воспалительных заболеваниях.Immunol Rev 279:70–89

    PubMed Статья КАС ПабМед Центральный Google ученый

  • Pihlstrom BL, Michalowicz BS, Johnson NW (2005) Заболевания пародонта. Ланцет 366:1809–1820

    PubMed Статья Google ученый

  • Plaza-Díaz J, Ruiz-Ojeda FJ, Gil-Campos M, Gil A (2018) Иммуноопосредованные механизмы действия пробиотиков и синбиотиков при лечении кишечных заболеваний у детей.Питательные вещества. https://doi.org/10.3390/nu10010042

    ПабМед ПабМед Центральный Статья Google ученый

  • Пул С., Синграо С.К., Кесавалу Л., Кертис М.А., Крин С. (2013)Определение наличия факторов пародонтопатической вирулентности в краткосрочной посмертной мозговой ткани болезни Альцгеймера. J Alzheimers Dis 36: 665–677

    PubMed КАС Статья Google ученый

  • Пожитков А.Е., Леру Б.Г., Рэндольф Т.В., Бейклер Т., Флеммиг Т.Ф., Ноубл П.А. (2015) На пути к трансплантации микробиома в качестве терапии пародонтита: исследовательское исследование микробной сигнатуры пародонтита в сравнении со здоровьем полости рта, кариесом и адентией.BMC Oral Health 15:125

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Qin N, Yang F, Li A, Prifti E, Chen Y, Shao L, Guo J, Le Chatelier E, Yao J, Wu L et al (2014)Изменения микробиома кишечника человека при циррозе печени. Природа 513(7516):59–64

    PubMed Статья КАС Google ученый

  • Radford-Smith G, Pandeya N (2006) Связь между генотипом NOD2/CARD15 и фенотипом при болезни Крона — мы уже там? World J Gastroenterol 12:7097–7103

    PubMed ПабМед Центральный Статья Google ученый

  • Raychaudhuri S, Sandor C, Stahl EA, Freudenberg J, Lee HS, Jia X, Alfredsson L, Padyukov L, Klareskog L, Worthington J et al (2012) Пять аминокислот в трех белках HLA объясняют большую часть ассоциации между MHC и серопозитивным ревматоидным артритом.Нат Жене 44: 291–296

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Reddy RM, Weir WB, Barnett S, Heiden BT, Orringer MB, Lin J, Chang AC, Carrott PW, Lynch WR, Beer DG et al (2018) Повышенная дисперсия микробиома полости рта и желудка коррелирует с несостоятельностью анастомоза при эзофагэктомии . Ann Thorac Surg 105(3):865–870

    PubMed Статья Google ученый

  • Reichart PA, Schmidt-Westhausen AM, Khongkhunthian P, Strietzel FP (2016) Зубные имплантаты у пациентов с заболеваниями слизистой оболочки полости рта — систематический обзор.J Oral Rehabil 43:388–399

    PubMed Статья КАС Google ученый

  • Ривьер Г.Р., Ривьер К.Х., Смит К.С. (2002)Молекулярные и иммунологические доказательства оральной трепонемы в мозге человека и их связи с болезнью Альцгеймера. Oral Microbiol Immunol 17:113–118

    PubMed Статья КАС Google ученый

  • Rogers AB, Fox JG (2004) Воспаление и рак.I. Модели инфекционного рака желудочно-кишечного тракта и печени на грызунах. Am J Physiol Gastrointest Liver Physiol 286:G361–G366

    PubMed Статья КАС Google ученый

  • Roszyk E, Puszczewicz M (2017) Роль микробиома человека и отдельных бактериальных инфекций в патогенезе ревматоидного артрита. Ревматология 55(5):242–250

    PubMed ПабМед Центральный Статья Google ученый

  • Rylander H, Ramberg P, Blohme G, Lindhe J (1986) Распространенность заболеваний пародонта у молодых диабетиков.J Clin Periodontol 14:38–43

    Статья Google ученый

  • Саид Х.С., Суда В., Накагоме С., Чинен Х., Осима К., Ким С., Кимура Р., Ираха А., Исида Х., Фуджита Дж. и др. (2014) Дисбиоз слюнной микробиоты при воспалительных заболеваниях кишечника и его связь с пероральные иммунологические биомаркеры. DNA Res 21:15–25

    PubMed Статья КАС Google ученый

  • Сайкалы С.С. (2018) Рецидивирующие афтозные язвы: обзор потенциальных причин и новых методов лечения.J Дерматол Трет. https://doi.org/10.1080/09546634.2017.1422079

    Артикул Google ученый

  • Sparks Stein P, Steffen MJ, Smith C, Jicha G, Ebersole JL, Abner E, Dawson D III (2012) Сывороточные антитела к пародонтальным патогенам являются фактором риска болезни Альцгеймера. Альцгеймер Демент 8:196–203

    PubMed Статья КАС Google ученый

  • Thorstensson H, Hugoson A (1993)Опыт заболеваний пародонта у взрослых с длительным инсулинозависимым диабетом.J Clin Periodontol 20:352–358

    PubMed Статья КАС Google ученый

  • Topcuoglu N, Kulekci G (2015) Анализ десяти пародонтальных бактерий на основе микрочипов 16S рРНК у пациентов с различными формами пародонтита. Анаэробы 35:35–40

    PubMed Статья КАС Google ученый

  • Tsai CY, Tang CY, Tan TS, Chen KH, Liao KH, Liou ML (2016) Поддесневая микробиота у людей с тяжелым хроническим пародонтитом.J Microbiol Immunol Infect 51(2):226–234

    PubMed Статья Google ученый

  • Ussar S, Fujisaka S, Kahn CR (2016)Взаимодействие между генетикой хозяина и микробиомом кишечника при диабете и метаболическом синдроме. Мол. Metab 5:795–803

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Veloso FT (2011) Внекишечные проявления воспалительного заболевания кишечника: влияют ли они на лечение и исход? World J Gastroenterol 17:2702–2707

    PubMed ПабМед Центральный Статья Google ученый

  • Viatte S, Plant D, Raychaudhuri S (2013) Генетика и эпигенетика ревматоидного артрита.Nat Rev Rheumatol 9:141–153

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Wang K, Lu W, Tu Q, Ge Y, He J, Zhou Y, Gou Y, Van Nostrand JD, Qin Y, Li J et al (2016) Предварительный анализ микробиома слюны и их потенциальной роли в полости рта красный плоский лишай. Научный представитель 6: 22943–22952

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Wang Y, Zhang J, Chen X, Jiang W, Wang S, Xu L, Tu Y, Zheng P, Wang Y, Lin X et al (2017) Профилирование микробиоты полости рта при кариесе в раннем детстве с использованием одной молекулы секвенирование в реальном времени.Front Microbiol 8:2244

    PubMed ПабМед Центральный Статья Google ученый

  • Warinner C, Rodrigues JF, Vyas R, Trachsel C, Shved N, Grossmann J, Radini A, Hancock Y, Tito RY, Fiddyment S et al (2014) Патогены и иммунитет хозяина в полости рта древнего человека. Нат Жене 46(4):336–344

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Васфи Р., Абд Эль-Рахман О.А., Зафер М.М., Ашур Х.М. (2018) Пробиотик Lactobacillus sp.ингибируют рост, образование биопленки и экспрессию генов вызывающих кариес Streptococcus mutans . J Cell Mol Med 22(3):1972–1983

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Xiao E, Mattos M, Vieira GHA, Chen S, Corrêa JD, Wu Y, Albiero ML, Bittinger K, Graves DT (2017) Диабет усиливает экспрессию IL-17 и изменяет микробиом полости рта, повышая его патогенность. Клеточный микроб-хозяин 22(1):120–128

    PubMed Статья КАС ПабМед Центральный Google ученый

  • Xu H, Hao WJ, Zhou Q, Wang WH, Xia ZK, Liu C, Chen XC, Qin M (2014) Chen F Разнообразие бактериального микробиома зубного налета у детей младше 30 месяцев с кариесом или без него до прорезывания вторые молочные моляры.PLoS ONE 9(2):e89269

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Yang SF, Huang HD, Fan WL, Jong YJ, Chen MK, Huang CN, Chuang CY, Kuo YL, Chung WH, Su SC (2018) Композиционные и функциональные вариации микробиоты полости рта, связанные с мутационными изменениями в полости рта рак. Oral Oncol 77:1–8

    PubMed Статья Google ученый

  • Йео С.А., Диас С.С., Изенберг Д.А. (2018) Успехи в лечении системной красной волчанки.Медицина 46(2):84–92

    Google ученый

  • Zarco MF, Vess TJ, Ginsburg GS (2012)Микробиом полости рта в норме и болезни и потенциальное влияние на персонализированную стоматологическую медицину. Oral Dis 18(2):109–120

    PubMed Статья КАС Google ученый

  • Zhang X, Zhang D, Jia H, Feng Q, Wang D, Liang D, Wu X, Li J, Tang L, Li Y et al (2015) Микробиомы полости рта и кишечника нарушаются при ревматоидном артрите и частично нормализуется после лечения.Nat Med 21(8):895–905

    PubMed Статья КАС Google ученый

  • Zheng H, Xu LX, Wang ZC, Li LS, Zhang JN, Zhang Q, Chen T, Lin JX, Chen F (2015) Поддесневой микробиом у пациентов со здоровыми и больными зубными имплантатами. Научный представитель 5:10948

    PubMed ПабМед Центральный Статья КАС Google ученый

  • Характеристика микробиома полости рта человека и его связь с микробиомом окружающей среды, выявленная в рамках проекта Earth Microbiome Project

    1.Введение

    Полость рта является важным местом доставки и обмена веществ внутри и вне тела человека, а также воротами для проникновения в организм патогенов и токсических веществ. Микробы, обнаруженные в ротовой полости человека, в совокупности называются микробиомом полости рта [1–3]. Сложное и изменчивое взаимодействие микробов полости рта помогает организму бороться с внешними нежелательными раздражителями. Однако дисбаланс микробного сообщества в полости рта может привести к заболеваниям полости рта, таким как кариес, пародонтит, заболевания слизистой оболочки полости рта и системным заболеваниям, таким как желудочно-кишечные и неврологические заболевания [2,4–13].Следовательно, микробиом полости рта играет важную роль в поддержании баланса между микробными сообществами человека и здоровьем человека [14,15].

    Состав ротового микробиома сложен, и расширенная база данных микробиома полости рта человека (eHOMD) включает 770 микробных видов 230 родов в 16 бактериальных и архейных типах [16]. Из всех видов в этой базе данных 57% имеют официальное название, 13% не имеют названия, но культивируются, а 30% известны только как некультивируемые филотипы. Между ротовым, кишечным и кожным микробиомом новорожденных нет различий, но состав их ротового микробиома будет значительно меняться по мере увеличения возраста и изменения зубного ряда [17].Различия микробиомов у одного и того же человека в разные моменты времени в ротовой полости значительно ниже, чем в кишечнике, коже и других частях тела [18]. Влияние ранней среды обитания на формирование оральных микробов гораздо больше, чем генетические факторы [19]. Кроме того, образ жизни, социальные факторы и значение рН полости рта также влияют на состав микробиома полости рта [20].

    Проект микробиома Земли (EMP) направлен на то, чтобы собрать как можно больше микробных сообществ Земли, чтобы способствовать нашему пониманию взаимоотношений между микробами и окружающей средой, включая растения, животных и людей [21,22].Первые данные, опубликованные EMP, содержали 27 751 образец из 97 независимых исследований, представляющих различные типы окружающей среды, географические местоположения и химические реакции [23]. Все образцы были подвергнуты выделению и секвенированию ДНК, а также анализу бактериальной и архейной частей всей базы данных. Здесь мы использовали 447 наборов данных из образцов полости рта человека, опубликованных EMP, для изучения характеристик микробиома полости рта человека и его связи с микробиомом окружающей среды.

    2.Материалы и методы

    2.1 Сбор данных о пробах ротовой полости человека на основе данных EMP

    EMP разработала единый стандартный рабочий процесс, в котором используются существующие стандарты отчетности о пробах и данных, что позволяет собирать биомассу и метаданные в различных средах на Земле [23]. Образцы, представленные мировым сообществом экологов-микробиологов, использовались для проведения анализа микробиома. Выделение ДНК и секвенирование ампликона 16S рРНК проводили с использованием стандартных протоколов EMP [24].Данные последовательности были отфильтрованы по ошибкам и обрезаны до длины самого короткого цикла секвенирования (90 п.н.) с использованием программного обеспечения Deblur [25].

    Данные EMP содержат в общей сложности 97 исследований и 27 742 образца, которые доступны по адресу ftp://ftp.microbio.me/emp/release1. Мы получили 447 образцов ротовой полости человека в ходе исследования EMP для анализа их микробного разнообразия (дополнительные данные). Эти устные образцы взяты из 5 независимых исследований и включают население из Италии, Пуэрто-Рико, США и Венесуэлы [24,26,27].Мы также выбрали 216 образцов кишечника, 253 образца носа/глотки и 346 образцов кожи из исследования ЭМИ для проведения сравнительного анализа [24,26,28,29].

    2.2 Классификация EMP Ontology

    EMP классифицировала образцы в различных средах по соответствующим экологическим меткам [23]. Онтология EMP (EMPO) классифицировала микробную среду (уровень 3) как свободноживущую или связанную с хозяином (уровень 1), соленую или несолёную (если свободноживущая), животную или растительную (если связанную с хозяином) (уровень 2).Затем было сгенерировано подмножество, содержащее 10 000 образцов, которые обеспечивают равное (насколько это возможно) представление в разных средах (уровень EMPO 3) и во всех исследованиях в этих средах. В этом подмножестве каждая выборка должна иметь ≥5000 наблюдений в таблице наблюдений Deblur 90 bp.

    2.3 Сравнение с эталонными базами данных и базовыми анализами разнообразия

    Репрезентативные последовательности операционных таксономических единиц (OTU) были проанализированы с помощью алгоритма классификатора Ribosomal Database Project (RDP) с доверительным порогом 50% по сравнению с базой данных генов рРНК Silva 16S [ 30,31].

    Альфа-разнообразие было рассчитано с использованием входной таблицы BIOM Deblur 90 bp, разреженной до 5000 наблюдений для каждой выборки. Альфа-разнообразие включало наблюдаемые OTU (количество уникальных последовательностей тегов), индекс Шеннона (индекс разнообразия Шеннона), индекс chao1 (индекс Chao 1) и значение PD Веры (филогенетическое разнообразие Веры) [32–34].

    Группирование образцов было проведено в связи с условиями хранения с помощью анализа главных координат (PCoA) на основе расстояния подобия Брея-Кертиса.Кластеризация UPGMA (метод невзвешенных парных групп со средним арифметическим) была основана на расстоянии сходства Брея-Кертиса. Начальная загрузка с 1000 передискретизациями была выполнена для определения надежности кластеризации. Все эти анализы были выполнены с помощью статистического программного обеспечения PAST [35].

    Значимость различий оценивали с помощью дисперсионного анализа (ANOVA) с помощью программного пакета IBM SPSS Statistics.

    3. Результаты и обсуждение

    3.1 Состав микробиома полости рта человека

    Мы проанализировали секвенированные данные 447 образцов полости рта человека из 5 независимых исследований (дополнительные данные).Длина каждой секвенированной 16S рРНК из всех образцов была укорочена до 90 п.н., а затем из каждого образца было случайным образом извлечено 5000 наблюдаемых последовательностей для дальнейшего расчета. Во всех образцах были удалены неправильные последовательности с использованием алгоритма Deblur и рассчитаны OTU на уровне точности до одного нуклеотида.

    Результаты показали, что среднее количество наблюдаемых OTU бактерий и архей составило 73,81 ± 29,26 в образцах полости рта человека, при максимальном количестве 279 OTU и минимуме 25 OTU в одном образце.Индекс Chao1 относительно чувствителен к малочисленным видам. Среднее значение индекса Chao1 для образцов ротовой полости человека составило 89,20 ± 36,98 в диапазоне от 28,75 до 302,02. Индекс Шеннона может одновременно отражать видовое разнообразие и однородность сообщества. Среднее значение индекса Шеннона для образцов ротовой полости человека составило 3,64 ± 0,77, варьируя от 0,97 до 6,16. Значение PD Faith является хорошей мерой филогенетического разнообразия, а среднее значение PD Faith для образцов ротовой полости человека составило 11,99 ± 3,03, варьируя от 6.03 и 31.17. Эти результаты показали, что разнообразие микробиома ротовой полости человека значительно различается у разных людей.

    Таксономические результаты последовательностей генов 16S рРНК показали, что микробы в образцах ротовой полости человека принадлежали по крайней мере к 264 родам 17 типов бактерий и 2 родам 1 типа архей. Преобладающими типами микробиома ротовой полости человека были Firmicutes, Proteobacteria , Bacteroidetes , Fusobacteria и Actinobacteria со средней относительной численностью 37.81%, 30,11%, 17,76%, 9,07% и 4,75% соответственно. Кроме того, 0,02% последовательностей не могут быть классифицированы на уровне типа (рис. 1А). Общая относительная численность преобладающих 11 родов (> 1 %) составила 87,59 %, а Streptococcus (23,52 %), Neisseria (15,30 %), а также Haemophilus (13,21 %). средняя относительная численность среди этих 11 родов. При этом 4,80% последовательностей не были классифицированы на уровне рода (рис. 1Б). Эти 11 родов с высокой численностью в образцах полости рта человека были распределены между несколькими типами бактерий, 3 из них были Firmicutes , 2 из них были Proteobacteria , 2 из них были Bacteroidetes , 2 из них были Fusobacteria. , и 2 из них были Actinobacteria .Следовательно, микробиом ротовой полости человека также имеет высокую сложность видового состава.

    Рис. 1. Видовой состав микробиома полости рта человека.

    (A) Видовой состав микробиома полости рта человека на уровне типов. (B) Одиннадцать родов микробов ротовой полости человека с численностью более 1%. Результаты были рассчитаны на основе 447 пероральных образцов ЭМИ.

    3.2 Сравнение состава микробов ротовой полости человека с микроорганизмами кишечника, носа/глотки и кожи

    Помимо ротовой полости, кишечник, нос/глотка и кожа также являются важными местами обитания микробов человека.Используя данные, опубликованные EMP, мы сравнили различия между микробиомом полости рта человека и микробиомом кишечника, носа/глотки и кожи. Среди них микробные данные кишечника были получены из 216 образцов, данные носа/глотки были получены из 253 образцов, а данные кожи были получены из 346 образцов.

    Результаты показали, что разнообразие микробиома ротовой полости человека было значительно (ANOVA, p <0,01) ниже, чем микробиом кишечника, носа/глотки и кожи (дополнительная рис. 1). Среднее количество наблюдаемых OTU бактерий и архей составило 116.72 ± 39,64 в образцах кишечника человека, 288,76 ± 284,66 в образцах носа / глотки человека и 296,98 ± 176,87 в образцах кожи человека, каждый из которых был значительно выше, чем среднее значение, наблюдаемое в образцах полости рта человека. Средние значения индекса Chao1 для образцов кишечника, носа/глотки и кожи человека составили 140,29±49,75, 449,81±469,85 и 422,42±271,39 соответственно, что было значительно выше, чем 89,20±36,98 для образцов полости рта. В то время как средние индексы Шеннона для образцов кишечника, носа/глотки и кожи человека составляли 4.45±0,81, 4,27±2,00, 4,85±1,60 соответственно, что было значительно выше, чем 3,64±0,77 для перорального образца. Кроме того, средние значения PD Faith для образцов кишечника, носа/глотки и кожи человека составляли 15,30±4,35, 30,26±21,22, 31,30±14,53, что также было значительно выше, чем 11,99±3,03 для образцов полости рта.

    Результаты таксономии показали, что микробы в образцах кишечника человека представляли собой по крайней мере 288 родов 16 бактериальных типов и 5 родов 2 архейных типов, что немного больше, чем в пробах, взятых из ротовой полости.Однако микробы в образцах из носа/глотки представляли собой по крайней мере 832 рода 32 бактериальных типов и 11 родов 3 архейных типов. Микробы в образцах кожи представляли собой не менее 948 родов 32 бактериальных типов и 18 родов 3 архейных типов. Их микробное разнообразие намного больше, чем у пероральных образцов.

    Firmicutes был не только микробом с самой высокой численностью на уровне типа в микробиоме полости рта, но также имел более 30% численности в других местах тела, и особенно его численность в микробиоме кишечника достигала 49.41% (рис. 2А). Протеобактерии содержались более чем на 25% в микробиоме полости рта, носа/глотки и кожи, но только 3,99% в микробиоме кишечника. Bacteroidetes составлял 17,76% в микробиоме полости рта и 37,35% в микробиоме кишечника, но только 4,65% и 6,25% в микробиоме носа/глотки и кожи. Обилие Fusobacteria в микробиоме полости рта (9,07%) было значительно выше, чем в кишечнике (0,84%), носоглотке (0,52%) и коже (2.58%) микробиома. Обилие Actinobacteria в микробиоме полости рта (4,75%) было близко к микробиому кишечника (5,08%), но значительно ниже, чем в микробиоме носа/глотки (16,57%) и кожи (18,44%). Численность Cyanobacteria в микробиоме полости рта (0,27%) была выше, чем в микробиоме кишечника (0,02%), но ниже, чем в микробиомах носа/глотки (2,52%) и кожи (4,17%). Наконец, только 0,02% последовательностей 16S рРНК не были классифицированы на уровне типов в микробиоме полости рта, но последовательности 16S рРНК, которые не могут быть классифицированы на уровне типов, находятся в кишечнике гораздо чаще (1.89%), назальный/фарингеальный (0,41%) и кожный (0,26%) микробиомы.

    Рис. 2. Сравнение состава микробиомов полости рта, кишечника, носа/глотки и кожи человека.

    Распределение шести микробных типов с наибольшей численностью (A) и 11 родов с наибольшей численностью (B) микробиома полости рта на других частях тела. PCoA (C) и кластерный анализ (D) микробного состава из четырех различных частей ротовой полости человека, кишечника, носа/глотки и кожи.

    Для 11 родов с численностью более 1% в микробиоме полости рта их численность в микробиомах кишечника, носа/глотки и кожи была значительно ниже, чем в ротовой полости (рис.2Б). Например, численность Neisseria в ротовой полости составляла 15,30%, тогда как численность в микробиомах кишечника, носа/глотки и кожи составляла всего 0,003%, 1,20% и 1,94% соответственно. Кроме того, последовательности 16S рРНК, которые не могли быть классифицированы на уровне рода, также были значительно меньше в микробиоме ротовой полости (4,80%), чем в кишечном (13,92%), назальном/фарингеальном (31,56%) и коже (24,64%). ) микробиомы.

    Кроме того, мы выполнили анализ PCoA на основе расстояния Брея-Кертиса для 1262 образцов из полости рта, кишечника, носа/глотки и кожи человека и отобразили их на диаграмме рассеяния (рис.2С). Результаты показали, что микробиом образцов полости рта можно хорошо отличить от микробиомов образцов других частей тела, что указывает на то, что микробиом полости рта значительно отличается от других частей по видовому составу. Точно так же микробиом образцов кишечника также можно было бы хорошо отличить от микробиомов образцов других частей тела. Тем не менее, микробиомы образцов из носа/глотки и кожи во многом совпадают. Наименьшая дисперсия микробиома полости рта среди четырех микробиомов предполагает наименьшее разнообразие, что согласуется с индексом альфа-разнообразия.Кластерный анализ показал, что микробиомы носа/глотки и кожи были наиболее схожими, в то время как микробиом полости рта был более похож на микробиомы носа/глотки и кожи по сравнению с микробиомом кишечника (рис. 2D).

    Таким образом, приведенные выше результаты показали, что микробиом полости рта человека явно отличается от микробиома кишечника, носа/глотки и кожи. Оральный микробиом имел меньшее видовое разнообразие, меньше неизвестных видов и отличался видовым составом от других микробов, локализующихся на теле.

    3.3 Сравнение состава микробиома полости рта в разных странах

    Образцы микробиома полости рта человека были получены из 4 стран, включая 56 в Италии, 79 в Пуэрто-Рико, 270 в США и 42 в Венесуэле. Мы обнаружили, что разнообразие микробиома полости рта значительно различалось (ANOVA, p <0,01) среди населения этих четырех стран (дополнительная рис. 2). Что касается наблюдаемых бактериальных и архейных ОТЕ в полости рта, образцы из Италии (106.93 ± 25,04) и Венесуэле (93,57 ± 31,12) были значительно выше, чем в Пуэрто-Рико (67,84 ± 30,12) и США (65,61 ± 22,65). Точно так же результаты индекса Chao1, индекса Шеннона и значения PD Фейт также имели ту же особенность.

    По видовому составу для итальянских проб численность Rothia , Leptotrichia и Actinomyces явно превышала среднее значение каждого из них в пределах 4 стран (среднепопуляционное), в то время как численность Streptococcus и Haemophilus была ниже, чем в среднем по популяции (рис.3А). В образцах из Пуэрто-Рико количество Streptococcus было увеличено, а количество Neisseria , Prevotella , Veillonella и Porphyromonas уменьшилось. В образцах из США было увеличено содержание Neisseria , Fusobacterium и Oribacterium , а содержание Streptococcus и Gemella уменьшилось. В венесуэльских образцах численность Leptotrichia и Granulicatella увеличилась, а численность Haemophilus , Prevotella и Veillonella уменьшилась.Анализ PCoA, основанный на расстояниях Брея-Кертиса, показал, что образцы из США хорошо отличались от других стран, тогда как образцы из Венесуэлы частично перекрывались с образцами из Италии и Пуэрто-Рико (рис. 3Б). Кластерный анализ показал, что образцы из Италии были наиболее сходны по микробному составу с образцами из Венесуэлы, за ними следуют образцы из Пуэрто-Рико, а образцы из США были самыми уникальными (рис. 3С).

    Рис. 3. Сравнение состава микробиома полости рта в четырех разных странах.

    (A) Сравнение микробного состава полости рта у населения четырех стран. (B) Анализ PCoA для оральных микробов из населения в разных странах. (C) Кластерный анализ оральных микробов для населения в разных странах. Италия, Пуэрто-Рико, США и Венесуэла были проанализированы и представлены синим, светло-красным, зеленым и темно-красным цветом соответственно. Всего было использовано 447 образцов, и анализ проводился на основе расстояния Брея-Кертиса.

    Наконец, мы сравнили различия микробного разнообразия в полости рта, кишечнике, носу/глотке и коже в разных странах, используя образцы из США и Венесуэлы. Каждая страна имеет более 20 образцов для каждого места тела. Что касается наблюдаемых OTU бактерий и архей, образцы из полости рта и кишечника в популяции США были значительно ниже (ANOVA, p<0,01), чем в Венесуэле, образцы из носа/глотки в популяции США были значительно ниже (ANOVA, p<0,01). 0.01) выше, чем в Венесуэле, тогда как образцы кожи не показали значительных (ANOVA, p>0,05) различий между двумя странами (дополнительная рис. 3). Точно так же результаты индекса Chao1, индекса Шеннона и значения PD Фейт также показали ту же особенность. Эти результаты показали, что население с высоким микробным разнообразием полости рта не всегда обладало более высоким микробным разнообразием других частей тела, чем остальная часть населения.

    3.4 Ассоциация микробов полости рта человека с микробами окружающей среды

    Ряд микробов обменивался с внешней средой через ротовую полость человека.Поэтому мы попытались дополнительно проанализировать связь между микробами полости рта и микробами окружающей среды. EMP классифицировала образцы в различных средах по соответствующим экологическим этикеткам. Эти экологические метки были сначала разделены на две категории: свободноживущие и связанные с хозяином, а затем подразделены на 17 подкатегорий, обозначенных как уровень 3 EMPO. образцы из глотки и кожи и экологические этикетки EMPO (рис.4). Результаты показали, что самой близкой экологической меткой EMPO к образцам полости рта человека была секреция животных, самой близкой к образцам носа/глотки и кожи человека была поверхность животного, а самой близкой к образцам кишечника человека была дистальная часть кишечника животного. Кроме того, экологические этикетки EMPO, которые были близки к образцам из полости рта человека, в основном относятся к типу, связанному с хозяином, но также включают две свободно живущие среды: несолевой аэрозоль и поверхность. Аэрозоль и поверхность являются двумя типами сред, наиболее тесно контактирующих с человеком.Если быть точным, аэрозоль представляет собой аэрозольную пыль или жидкость. Поверхность представляет собой биопленку с влажной (<5 psu) или сухой поверхности, древесины, пыли и микробного мата.

    Рис. 4. Кластерный анализ микробного состава образцов полости рта, кишечника, носа/глотки и кожи человека и экологических этикеток EMPO.

    Дерево построено по методу UPGMA с использованием расстояния подобия Брея-Кертиса. Начальная загрузка с 1000 передискретизациями была выполнена для определения надежности кластеризации. Полость рта, нос/глотка, кожа и кишечник были выделены серыми, светло-зелеными, оранжево-красными и фиолетовыми твердыми сферами соответственно.

    Для 11 родов с численностью более 1% в микробиоме полости рта их численность на всех экологических этикетках EMPO была явно ниже, чем в полости рта. Например, количество Streptococcus составляло 23,52% в ротовой полости, 5,07% в аэрозоле (не солевом растворе), 4,22% на поверхности животных, 3,02% на поверхности (не солевом растворе) и 1,35% в проксимальных отделах кишечника животных. и 0,58% в дистальных отделах кишечника животных и так далее. Интересно, что все 11 родов имели самую высокую численность в аэрозоле (не засоленном) из девяти свободноживущих сред, а также занимали второе место по численности на поверхности (не засоленной).Далее мы обнаружили, что численность этих 11 родов в различных средах имеет явно положительную корреляцию. Таким образом, состав ротовых микробов, представленных этими 11 родами, был специфичен и имел определенное сходство с микробным составом свободноживущих аэрозольных и поверхностных сред.

    Axenic Культура бактерии-кандидата подкласса TM7 из полости рта человека и взаимодействия биопленки с другими бактериями полости рта

    ВВЕДЕНИЕ

    В полости рта человека обитает широкий спектр бактерий, по текущим оценкам насчитывается до 1000 видов (1).Использование независимых от культуры методов анализа микробиома полости рта позволило по-новому взглянуть на сложность микробных сообществ полости рта (2, 3). Однако значительная часть микроорганизмов из ротовой полости человека остается некультивируемой (4). Это имеет значение как для исследований здоровья и болезней человека, так и для таксономической классификации, которая требует аксенического культивирования. Когда ранее некультивируемые бактерии были культивированы (5, 6) или одомашнены (4), стало возможным исследовать их взаимодействие с другими микроорганизмами полости рта (7) или получить точные геномные последовательности (8).Бактерии-кандидаты деления TM7 были впервые обнаружены на немецком торфяном болоте (9) и встречаются в различных средах по всему миру (9, 10). Бактерии-кандидаты деления TM7 также были обнаружены в ряде участков тела человека, включая кожу (10), дистальный отдел пищевода (11), кишечник (12) и ротовую полость (3, 13–18). Первоначально TM7 был обнаружен в относительно низком количестве в образцах населения полости рта (13), но в более позднем исследовании высокое содержание TM7 в поддесневом налете, по-видимому, коррелирует с заболеванием пародонта (3).Однако трудно оценить свойства этих организмов в норме и при болезни, поскольку они были некультивируемыми, без представителей чистой культуры. Филогенетический анализ показал, что существует три подразделения, основанные на клонах гена 16S рРНК. Основным морфотипом реакторного шлама были неразветвленные по Граму филаменты длиной до 200 мкм, каждый филамент состоял из плотно упакованных клеток и клеточной стенки с трехслойным внешним видом и окружен оболочкой (9). В других исследованиях с использованием флуоресцентной гибридизации in situ (FISH) с TM7-специфическим зондом были обнаружены длинные филаментозные клетки с исчерченностью наряду с короткими палочками и диплококками (10).Первая геномная последовательность организма TM7 (TM7a) была получена после выделения одной клетки и амплификации всего генома, но эта последовательность была фрагментирована и неполна (14). Данные метагеномного секвенирования позволили использовать подход гибридной сборки для реконструкции более полной версии генома группы TM7 (3). Окончательная сборка все еще фрагментирована, но идентифицировано 703 гена, которых не было в исходной сборке. Ясно, что если бы бактерию-кандидат деления TM7 можно было бы культивировать в чистой культуре, можно было бы получить гораздо больше информации о генетике и относительно атрибутов вирулентности.В ортодонтии использование несъемных аппаратов на зубах мешает методам чистки и может привести к накоплению зубного налета и потенциально повышенному риску заболеваний пародонта (19, 20). Традиционные методы культивирования показали повышенное количество пародонтальных патогенов, таких как Porphyromonas gingivalis и Tannerella forsythia, присутствующих на краях десны во время ортодонтического лечения (21). Цель настоящего исследования заключалась в наблюдении за изменениями бактерий-кандидатов деления TM7 в зубном налете на краю десны, связанными с ортодонтическим лечением.Из культуры наддесневого зубного налета, содержащей не менее 12 филотипов TM7, мы смогли одомашнить один изолят и вырастить его в чистой культуре. Организм соответствовал предыдущему морфологическому описанию TM7 (9) путем роста в виде длинных нитей, иногда полосатых, внутри колоний или биопленок на агаровых пластинах. Однако изолят подвергался морфологическим изменениям при выращивании в биопленках в присутствии различных видов бактерий ротовой полости.

    МАТЕРИАЛЫ И МЕТОДЫ

    Дизайн исследования.

    Двадцать пациентов (в возрасте от 11 до 14 лет), готовых начать ортодонтическое лечение в Бристольской стоматологической больнице, приняли участие в этом исследовании (одобрено Этическим комитетом UBHT [04/Q2006/53]). Критерии исключения включали пациентов с известными системными заболеваниями и тех, кто принимал антибиотики в течение 3 мес до начала или во время лечения. Кросс-рандомизация для противоположных контралатеральных квадрантов рта применялась (i) при назначении колец для моляров и приклеенных молярных трубок и (ii) для самолигирующих брекетов (SLB) с эластомерными лигатурами или без них в верхней челюсти (19) (19). см. рис.S1 в дополнительных материалах). Образцы были получены непосредственно перед ( T 0 ), через 3 месяца ( T 1 ), по завершении ( T 2 ) и через 3 месяца после ( T

    90 0 ). ) лечение (19). Образцы зубного налета помещали в 50 мМ Трис-ЭДТА-буфер (pH 8,0) (TE-буфер) и хранили в замороженном виде при -70°C до обработки.

    Микробная культура.

    Образцы зубного налета были собраны у пациентов в анаэробной транспортной среде (ATM Systems) и инокулированы в привередливую анаэробную среду (FAB; LabM), содержащую канамицин (100 мкг/мл) для подавления роста грамотрицательных бактерий.После 48 ч инкубации при 37°C в анаэробных условиях образцы пересевали в FAB на срок до 1 недели. Затем порции культур (0,1 мл) высевали на чашки с прихотливым анаэробным агаром (FAA), содержащие 5% дефибринированной лошадиной крови, и инкубировали в течение 7 дней в анаэробных условиях под N 2 -CO 2 -H 2 (80:10: 10). Затем отбирали отдельные колонии и подвергали многократным циклам субкультивирования на свежих чашках с FAA до тех пор, пока не получали чистые культуральные изоляты.Все бактериальные штаммы, включая Streptococcus gordonii, Parvimonas micra, Actinomyces oris, Fusobacterium nucleatum subsp. nucleatum, Prevotella intermedia и Porphyromonas gingivalis культивировали на FAA или FAB.

    Экстракция ДНК.

    ДНК экстрагировали из образцов бляшек или клеток, собранных из бульонных культур, с использованием набора бактериальной геномной ДНК GeneElute (Sigma-Aldrich Company Ltd., Дорсет, Соединенное Королевство) в соответствии с инструкциями производителя, и концентрации ДНК оценивали спектрофотометрически при 260 нм.

    ПЦР для ДГГЭ.

    Кандидатный ген 16S рРНК деления TM7 был амплифицирован методом ПЦР с использованием олигонуклеотида TM7-580F (9), содержащего зажимы GC для последующего денатурирующего градиентного гель-электрофореза (DGGE) и обратного праймера TM7 (5′ GTGTAGCAGTGAAATGCGTAGATAT) в 50 мкл реакционной смеси, содержащей 1,25 ед. ДНК-полимеразы Go Taq (Promega), 10 мкл поставляемого буфера (конечная концентрация MgCl 2 1,5 мМ), 0,2 мМ каждого дезоксинуклеозидтрифосфата (dNTP), 1,0 мМ каждого праймера и примерно 20 нг матричной ДНК.Цикл амплификации проводили следующим образом: этап денатурации при 94°С в течение 2 мин; 15 циклов при 94°С по 30 с, этапы отжига праймера по 30 с, начиная с 65°С и снижаясь на 1°С в каждом цикле, с удлинением при 72°С; затем 10 циклов 94°С, 50°С и 72°С по 30 с каждый; и конечная стадия удлинения при 72°С в течение 10 мин. Амплимеры размером приблизительно 102 п.н. визуализировали после электрофореза в агарозном (1,2%) геле.

    ДГГЭ.

    ПЦР-амплимеры разделяли в 10% полиакриламидных гелях, содержащих линейный градиент мочевины (от 40 до 50%), с использованием системы электрофореза CBS Scientific DGGE и прикладывали напряжение 30 В в течение 1 ч, а затем 60 В в течение ночи (16 ч).Систему поддерживали при постоянной температуре (60°С) в 22 литрах 0,5× трис-ацетат-ЭДТА (ТАЕ) буфера. Гели окрашивали в течение 30 мин в 1× ТАЕ-содержащем красителе геля нуклеиновой кислоты SYBR green (разведение 10 4 ) и фотографировали в цифровом виде с просвечиванием УФ-светом.

    ПЦР в реальном времени.

    Анализы проводили в 96-луночных планшетах в детекторе реального времени DNA Engine ThermoCycler Chromo4 (Bio-Rad) с теми же последовательностями праймеров, которые использовались для DGGE-PCR, но без зажимов GC и с универсальными праймерами 2 и 3 для общего амплифицируемого гены 16S рРНК (22).Общий объем реакционной смеси составлял 25 мкл на лунку, и каждая реакционная смесь содержала 12,5 мкл зеленого супермикса iTaq SYBR (Bio-Rad), 1,25 мкл каждого праймера (конечная концентрация 6 мкМ) и 10 мкл (~50 нг) матричной ДНК. Цикл амплификации проводили следующим образом: денатурация при 95°С в течение 3 мин; затем 30 циклов: 95°С 15 с, 54,2°С 45 с, 72°С 15 с; и затем заключительный этап удлинения при 72°C в течение 10 мин. Интенсивность флуоресценции SYBR green измерялась автоматически во время этапов отжига.В конце каждого опыта проводили анализ кривой плавления от 70°C до 95°C, считывая каждые 0,2°C с выдержкой 0,1 с. Стандартами служили разведения плазмиды, содержащей сегмент 572 п.н. гена 16S рРНК, тесно связанного (99%) с последовательностью гена 16S рРНК TM7a.

    Амплификация 16S рРНК.

    Гены 16S рРНК амплифицировали с помощью ПЦР в стандартных условиях с использованием TM7-специфических праймеров (прямой праймер, TM7-314F; обратный праймер, TM7-910R), которые амплифицируют фрагмент длиной 572 п.н., как описано ранее (9, 13).Дополнительными используемыми специфическими для TM7 праймерами были 5’GATGAACGCTGGCGGCATG и 1391R (5’GACGGGCGGTGTGTRCA). Использовали стандартный протокол в термоциклере PTC-100TM (MJ Research Inc.), который включал денатурацию при 94°C в течение 3 мин, затем 34 цикла при 94°C в течение 1 мин, 58,4°C в течение 45 с, 72°C в течение 1 мин и заключительный этап удлинения при 72°С в течение 10 мин. Продукты ПЦР анализировали электрофорезом в 1% агарозном геле, содержащем бромистый этидий, и визуализировали в УФ-свете.

    Процедуры клонирования и секвенирование.

    Клонирование ПЦР-амплифицированной ДНК выполняли с помощью набора для клонирования ТА (Invitrogen) в соответствии с инструкциями производителя. ДНК трансформировали в компетентные клетки Escherichia coli DH5α, и трансформанты отбирали на устойчивость к канамицину (50 мкг/мл). Правильные размеры вставок определяли с помощью ПЦР, а фрагменты гена 16S рРНК очищали (набор для очистки QIAquick PCR) и секвенировали.

    Секвенирование гена 16S рРНК и анализ данных.

    Были проанализированы многочисленные клоны со вставками правильного размера (102 п.н. или 572 п.н.).Для идентификации ближайших родственников последовательности вставок сравнивали с доступными базами данных с использованием инструмента поиска базового локального выравнивания (BLAST), чтобы определить приблизительную филогенетическую принадлежность и указать наличие любых существующих последовательностей, которые могут быть включены в новые подразделения. которые ранее не были идентифицированы. Филогенетические деревья были построены путем объединения соседей с использованием веб-сайта CLUSTAL W и набора программ PHYLIP (23).

    Конструкция зонда.

    Скомпилированные последовательности были выровнены с помощью Clustal W и Clustal Omega, а выравнивания уточнены вручную.Специфичный для TM7 флуоресцентный зонд для гибридизации in situ (FISH) (TM7-2; Cy3-GAGTTTGTGAGTTCGAATAAT) был разработан на основе сравнительного анализа всех последовательностей в базе данных. Впоследствии специфичность последовательности зонда была подтверждена с использованием последовательностей гена 16S рРНК в проекте Ribosomal Database Project и в базах данных GenBank.

    РЫБА.

    Для выявления присутствия TM7 в образцах смешанных культур 0,2 мл культуры центрифугировали (13 000 × g , 3 мин) и осадок фиксировали в 0.1 мл 4% параформальдегида (PFA) на 20 мин на льду (2, 24). После фиксации клетки промывали 50% этанолом и смешивали с 0,1 мл 0,1 М Трис-HCl (рН 7,5), содержащей 5 мМ ЭДТА и 10 мг лизоцима/мл, в течение 10 мин при 37°С для пермеабилизации клеток. Затем клетки обезвоживали серией промывок этанолом (каждая по 3 мин), содержащих 50%, 80% и 100% этанол. Образцы инкубировали с 50 мкг/мл Cy3-меченого олигонуклеотидного зонда TM7-905 (9) или Cy3-меченого универсального зонда EUB-338 в гибридизационном буфере (0.9 мМ NaCl, 20 мМ Трис-HCl [pH 7,5], 25% формамид, 0,01% додецилсульфат натрия) при 46°С в течение 90 мин. Образцы промывали в течение 15 мин при 48°С в буфере, содержащем 0,16 М NaCl, 20 мМ Трис-HCl (рН 7,5), 5 мМ ЭДТА и 0,01% додецилсульфата натрия. Затем клетки промывали 0,4 мл ледяной воды и исследовали с помощью флуоресцентной микроскопии. Также были проведены эксперименты с зондом новой конструкции ТМ7-2 (см. выше) со следующими изменениями протокола: исходный осадок фиксировали в 50% этаноле (0.15 мл) на ночь при 4°С; клетки промывали 0,4 мл фосфатно-солевого буфера (PBS) и центрифугировали, а осадки суспендировали в 0,5% тритоне (0,1 мл) в течение 10 мин при 22°C для пермеабилизации клеток.

    Приготовление покровных стекол, покрытых слюной.

    Образцы цельной человеческой слюны были собраны как минимум у пяти взрослых добровольцев (в соответствии с Законом о тканях человека и этическим одобрением Бристольского университета) в охлажденные пробирки на льду, объединены, инкубированы в течение 10 минут с 2,5 мМ дитиотреитола (ДТТ). и осветлен центрифугированием (10 000 × г , 10 мин).Затем надосадочную жидкость пропускали через фильтр с размером пор 0,2 мкм и разбавляли до 10% дистиллированной водой. Порции (0,5 мл) переносили в лунки 24-луночного планшета с покровными стеклами диаметром 13 мм и инкубировали в течение 16 ч при 4°С. Покрытые слюной покровные стекла затем удаляли из каждой лунки и использовали для экспериментов с биопленками, как описано ниже.

    Образование биопленки.

    S. gordonii DL1 (Challis) выращивали в анаэробных условиях в течение 24 часов в привередливом анаэробном бульоне (FAB), тогда как изолят TM7 UB2523, A.oris T14V, F. nucleatum subsp. nucleatum ATCC 25586, P. micra ATCC 33270, P. gingivalis ATCC 33277 и P. intermedia ATCC 25611 выращивали в анаэробных условиях до 7 дней. Клетки собирали центрифугированием, промывали в FAB и доводили до оптической плотности при 600 нм (OD 600 ) 0,5 в том же бульоне. Суспензии (0,5 мл) переносили в лунки 24-луночных планшетов, содержащих покрытые слюной покровные стекла, и инкубировали в течение 24 ч (S. gordonii, A. oris, P. micra или P. gingivalis) или 48 ч (F.nucleatum) в анаэробном шкафу, с лунками в камере увлажнения. Суспензии отсасывали из лунок, покровные стекла высушивали на воздухе и биопленки окрашивали изотиоцианатом флуоресцеина (FITC; 1,5 мМ в 0,05 М Na 2 CO 3 , содержащем 0,1 М NaCl) в течение 15 мин при 22°C в темный или с кристаллическим фиолетовым в течение 5 мин. Избыток красителя удаляли путем промывания покровных стекол дистиллированной водой (dH 2 O), затем покровные стекла сушили на воздухе, переворачивали на предметные стекла и визуализировали под микроскопом (проходящий свет, флуоресценция или конфокальный сканирующий лазер).

    Измерение биомассы.

    Для оценки биомассы биопленки, выращенные на покровных стеклах, окрашивали кристаллическим фиолетовым в течение 5 мин. Затем покровные стекла промывали dH 2 O и переносили на свежий 24-луночный планшет. Кристаллический фиолетовый солюбилизировали 10% уксусной кислотой и определяли оптическую плотность при 595 нм ( A 595 ) как меру биомассы (25).

    ТЕМ.

    Колонии собирали с поверхности FAA в среду FAB и центрифугировали (5000 × g , 5 мин), клетки суспендировали в среде FAB и переносили в 15-мл конические центрифужные пробирки.Суспензию центрифугировали и к осадку добавляли фиксатор для просвечивающей электронной микроскопии (ПЭМ) (4% параформальдегида, 5% глутаральдегида, 0,1 М буфера какодилата натрия [pH 7,2], 0,05% Tween 20; 6 мл). Пробирки осторожно встряхивали и инкубировали при 22°С в течение 15 мин. Образцы центрифугировали (3000 × g , 2 мин), осторожно удаляли надосадочную жидкость и осадок суспендировали в фиксаторе TEM (2% параформальдегид, 2,5% глутаральдегид; 2 мл). Образцы хранили при 4°С в течение ночи.Затем осадки промывали 3 раза в 0,1 М буфере какодилата натрия (pH 7,2) и помещали в 2% агарозу с низкой температурой плавления. Осадки агарозы нарезали на срезы ~3 мм и инкубировали при 22°С в течение 1 ч в 1% растворе четырехокиси осмия. Образцы промывали в стерильной среде H 2 O, обезвоживали при комнатной температуре с помощью последовательных инкубаций в этаноле (30%, 50%, 75%, 90% и 100%), а затем в оксиде пропилена и заключали в смолу Spurr. Смолу разрезали на микротоме (RMC Powertome PC) на срезы размером от 80 до 100 нм с помощью алмазного ножа, а срезы собирали на медных сетках и визуализировали при 80 кВ с помощью ПЭМ.

    Конфокальная сканирующая лазерная микроскопия (CSLM).

    Биопленки окрашивали FITC, как описано выше, и визуализировали во влажном состоянии с помощью системы конфокальной визуализации Leica TCS-SP2, прикрепленной к инвертированному микроскопу Leica DMIRBE. Использовались масляные иммерсионные объективы (40× и 100×), а параметры устанавливались для оптимизации разрешения. Анализ данных проводили с использованием программного обеспечения для анализа изображений Volocity (Improvision).

    Анализ протеома.

    клеток изолята TM7 UB2523 собирали с чашек с агаром в FAB и собирали центрифугированием при 5000 × g в течение 10 мин.Осадок клеток суспендировали в 0,5 мл ТЕ-буфера, переносили в пробирку дисмембратора и добавляли равный объем 0,5-мм стеклянных шариков (BioSpec Products Inc.). Клетки разрушали с помощью шейкера Precellys в течение 30 с (три раза) с охлаждением в ледяной воде в течение 1 мин между каждым этапом. Лизаты подвергали низкоскоростному центрифугированию для осаждения гранул, переносили в свежую пробирку и снова центрифугировали при 13000 × g в течение 10 мин. Осадок, содержащий в основном фрагменты клеточной стенки и мембраны и связанные с ними цитоплазматические белки, затем суспендировали в 0.5 мл 0,1 М Tris-HCl (pH 6,8) буфера, содержащего 0,1% SDS, нагревали при 80°C в течение 10 мин и центрифугировали для осветления. Порции супернатанта подвергали электрофорезу через 5% акриламид так, чтобы передний краситель переместился на 2 см, и гель фиксировали в смеси 50% МеОН-7% уксусная кислота-вода в течение 30 мин. Затем верхние 1,5-сантиметровые участки разделяющихся полосок геля вырезали, промывали и подвергали расщеплению трипсином в геле. Пептиды фракционировали с использованием системы ВЭЖХ Dionex Ultimate 3000 nano в сочетании с масс-спектрометром LTQ-Orbitrap Velos (Thermo Scientific).Файлы необработанных данных были обработаны с использованием программного обеспечения Proteome Discoverer v1.2 (Thermo Scientific). Затем эти данные были проанализированы в базе данных Swiss-Prot Eubacteria с использованием алгоритма Mascot и частичной последовательности генома TM7 в базе данных микробиомов полости рта человека (HOMD) (26) и последовательно проанализированы с использованием программы BLAST (http://www.ncbi). .nlm.nih.gov/BLAST/).

    Статистический анализ.

    Результаты представлены в виде средних значений и стандартных ошибок средних (SEM), рассчитанных для каждой группы образцов.Для нормально распределенных данных сравнения были проверены с помощью теста Стьюдента t . Для сравнения групп использовали двусторонний U-критерий Манна-Уитни. Значение P <0,05 считалось статистически значимым.

    Номер доступа к последовательности нуклеотидов.

    ОБСУЖДЕНИЕ

    Культивируемая микробиота ротовой полости человека оценивается примерно в 50% присутствующих видов. В настоящее время предпринимаются согласованные попытки культивировать некультивируемое (27), экспериментально признавая, что организмы могут быть некультивируемыми обычным способом, поскольку они существуют в обязательных метаболических ассоциациях с другими организмами.Это было предложено как возможная причина невозможности аксиального культивирования TM7 в чистой культуре. Однако теперь мы успешно культивировали бактериальный изолят отдела TM7 на основе секвенирования, протеомных и морфологических данных. TM7 был впервые обнаружен с использованием данных секвенирования в окружающей среде и последовательно описан в почве, лабораторном биореакторе и осадке периодического реактора (9, 28), а затем в поддесневом налете человека (13). Взаимосвязь между бактериями из окружающей среды и изолятами из полости рта человека неизвестна.Выделение TM7 в этой статье повышает вероятность того, что этот изолят может восполнить дефицит метаболизма у других бактерий TM7 и, следовательно, каким-то образом будет помечен и использован в дальнейших попытках выделения других организмов TM7. Клиническое значение обнаружения TM7, связанного с ортодонтических креплений, а не полос, в настоящее время неясно, хотя вполне вероятно, что зубной налет, который накапливается вокруг этих аппаратов, может быть более недоступным (и оставаться нетронутым) в ситуации с бондингом (рис.S1 в дополнительном материале показывает in vivo связей и полос). Интересно, что мы обнаружили, что деления-кандидаты присутствуют в таких относительно высоких пропорциях (около 3% от общего числа последовательностей), что может указывать на предпочтение зрелых или ненарушенных бляшек. Однако это не является обязательным условием для обнаружения TM7, поскольку метагеномные и микробиомные исследования все чаще сообщают об обнаружении TM7 в различных местах, как здоровых, так и больных (15, 18, 29). Некоторые из наших последовательностей TM7 из образцов зубного налета были уникальный (т.g., клоны N3 или N9) и, вероятно, представляют собой новые подтипы TM7 (рис. 1В). Другие последовательности были очень похожи на последовательности в базах данных, например, клон N12, вероятно, происходит от бактерии TM7, очень тесно связанной с той, от которой произошла последовательность базы данных GenBank AF125206. Клоны TM7, полученные из бульонной культуры, сгруппировались вместе с клоном TM7, ранее обнаруженным в бляшке, используемой для инокуляции бульона, что позволяет нам предположить, что TM7 способен расти в смешанной культуре. Множественные филотипы других организмов полости рта также обнаруживаются методами молекулярного секвенирования, поэтому, возможно, неудивительно, что несколько филотипов TM7 были обнаружены у одного человека.Аналогичным образом, сообщалось, например, что несколько филотипов трепонемы могут быть обнаружены в одном периодонтальном кармане (30). Исследования этого изолята бактерии TM7 с помощью трансмиссионной электронной микроскопии показали, что структура поверхностного слоя клетки больше похожа на грамположительную бактериальную клетку. стена. Однако, в отличие от микрофотографий клеток TM7 в окружающей среде (9), мы не смогли обнаружить внешнюю оболочку. Это может быть связано с возможностью того, что в окружающей среде требуется больше защиты от неблагоприятных условий, таких как высыхание или температура, чем в относительно более стабильных условиях человеческого рта.Трехслойная структура внешних слоев была аналогична описанной для организмов окружающей среды (9), но в настоящее время неясно, что представляют собой эти слои. Толщина тройного слоя была несколько меньше толщины внешнего фибриллярного слоя, оцениваемой примерно в 50 нм. Вполне возможно, что организм производит массив поверхностных белков, и подробный анализ клеточной стенки как углеводных, так и белковых компонентов должен быть в состоянии определить биохимический состав и молекулярную структуру возможного внешнего слоя.Организм поддерживал длинные филаменты в условиях биопленки, и внутри этих филаментов были видны клеточные единицы, как описано для организмов из окружающей среды (9). Интересной особенностью было появление по крайней мере одной выпуклости по длине большинства филаментов. Вряд ли это артефакты в результате обработки, так как они имеют слишком правильный вид и не связаны с какими-либо нарушениями наружных слоев клеток. Мы полагаем, что они могут представлять собой поверхностные завихрения в филаментах, не связанные непосредственно с формированием перегородки (делением клеток), поскольку они не локализованы конкретно в перегородке.В качестве дополнительного доказательства гипотезы скручивания можно предусмотреть потенциальные скручивания в филаментах биопленки (рис. 5C), и некоторые из этих филаментов явно содержат линии клеточных единиц. Изолят TM7 описывает сформированные биопленки как маты. Наиболее тесные ассоциации бактерий были с A. oris и F. nucleatum, где можно было наблюдать биопленки двух срастающихся организмов. Однако у A. oris не было синергической связи с TM7 UB2523 (рис. 6). Конкретные физические взаимодействия не проявлялись в используемых условиях, поэтому казалось, что организмы сосуществовали, а не коагрегировались.Мы регулярно обнаруживали последовательности Fusobacterium во время процедур обогащения на бляшке, и Fusobacterium spp. были одним из наиболее часто обнаруживаемых родов, присутствующих в исследованиях ортодонтических зубных пластин с помощью микрочипов (19). Похоже, что TM7 не образовывал биопленку с P. intermedia; скорее, он оказался ингибирующим для этого штамма. В других двухвидовых биопленках клетки TM7 можно было увидеть присутствующими как более темные объекты. У P. micra TM7 редко присутствовал в виде коротких филаментов, но биомасса биопленки была значительно увеличена по сравнению с P.micra, с плотными скоплениями бактерий, окруженными матриксом. У S. gordonii клетки TM7 присутствовали в виде очень коротких палочек, которые собирали массы клеток S. gordonii с продукцией матрикса, возможно, внеклеточной ДНК (eDNA). Поскольку в питательной среде отсутствовала сахароза, маловероятно, что условия благоприятствовали продукции внеклеточных глюканов. У P. gingivalis можно было увидеть более длинные нити TM7, присутствующие в больших скоплениях бактерий P. gingivalis, окруженных матриксом.Учитывая повторяемость матричных наблюдений, было бы важно определить химическую природу этих матричных веществ и какие из организмов в двухвидовых биопленках их производят. Ясно, что TM7 обладает способностью модулировать рост биопленки других бактерий полости рта, формировать биопленки с рядом различных видов бактерий полости рта и сам быть модулированным этими видами роста. Такие взаимодействия могут способствовать (или ингибировать) развитию микробного сообщества ротовой полости, связанного с заболеванием.В совокупности эти результаты показывают, что этот организм TM7 изо рта человека обладает почти всеми морфологическими характеристиками организмов TM7, которые были идентифицированы в иле биореактора (9), но никогда не поддавались культивированию. Присутствие кандидата деления TM7 в двухвидовых взаимодействиях оказывает множественное влияние на биопленки, продуцируемые другими бактериями. Бактерии TM7 могут различаться по морфологии от очень длинных филаментов в монокультуре (> 200 мкм) до более коротких филаментов (20 мкм) или маленьких палочек или кокков (∼1 мкм) в присутствии грамположительных стрептококков и P.микра. Морфологические преобразования должны быть тесно связаны с метаболическими условиями смешанных культур или в результате передачи сигналов от бактерий-партнеров в биопленке. Эти морфологические изменения в присутствии различных бактерий могут в некоторой степени объяснить наши изображения FISH (рис. 3B) и различные морфологические описания предполагаемых TM7-подобных организмов в почве в виде кокков и нитевидных клеток (9), а также в виде длинных и коротких филаментов. (9) в культурах бактерий из стоматологических образцов.Возможность аксиального культивирования этого изолята теперь открывает возможность для более полного биохимического и генетического анализа организма, тестирования вирулентности и патогенных свойств (3, 31) и углубления понимания этой новой бактерии-кандидата деления, которая до сих пор оставалась неизвестной. неуловимый.

    Микроорганизмы | Бесплатный полнотекстовый | Микробиом ротовой полости человека в условиях здоровья и болезней: от последовательностей к экосистемам

    1. Введение

    Подобно различным наземным биомам, составляющим Землю, микробиом человека представляет собой ряд отдельных сообществ бактерий, грибов, вирусов, архей, простейших , и другие микроорганизмы, состав которых зависит от условий окружающей среды [1].Различные участки человеческого тела можно рассматривать как уникальные биомы с совершенно разной средой и доступностью питательных веществ, что, в свою очередь, способствует развитию различных сообществ. Тем не менее, даже в пределах определенного участка тела состав микробиома может сильно различаться у людей с разным состоянием здоровья, с разным образом жизни или из-за ряда других факторов [2]. В центре внимания этого обзора будет микробиом полости рта человека, методы подхода к его анализу и описание его типичного состава, который мы знаем в настоящее время, а также его отклонения в нетипичных условиях.Полость рта содержит одно из самых разнообразных и уникальных сообществ микробов в организме человека [3,4], однако эта ниша относительно малоизучена по сравнению с кишечником — на момент написания этого обзора поиск в PubMed с запросом «оральный микробиома» было опубликовано 746 статей по сравнению с 5605 статьями о микробиоме кишечника. Миллилитр слюны содержит примерно 10 8 микробных клеток [5], и ряд исследований выявил до 700 различных прокариотических таксонов [6], при этом типичный здоровый микробиом состоит из примерно 100–200 различных бактериальных организмов. [7].Появление методов секвенирования следующего поколения (NGS) открыло новые возможности для крупномасштабных метагеномных исследований в различных популяциях, что позволило охарактеризовать структуру микробиома и, в некоторых случаях, функциональные роли и последствия для здоровья. Рот как биом является домом для множества уникальных местообитаний, в каждом из которых есть свое сообщество микроорганизмов. Микробиомы слюны, языка, слизистой оболочки щек, поверхностей зубов, десен, неба, как поддесневого, так и наддесневого зубного налета, а также горла и миндалин были охарактеризованы в многочисленных исследованиях, демонстрирующих общее сходство, но с небольшими различиями. такие как более высокие уровни рода Corynebacterium в обоих типах зубного налета [3,8] или более высокие уровни типа Firmicutes как в слюне, так и в слизистой оболочке щеки по сравнению с зубным налетом [8,9].Хотя в некоторых метагеномных исследованиях эти отдельные места обитания рассматриваются отдельно, также нередко используется полоскание рта в качестве метода сбора образцов, чтобы получить репрезентативный образец общего микробиома полости рта [10,11,12]. Независимо от исследуемого конкретного биома или среды обитания, текущая тенденция в исследованиях микробиома в значительной степени заключается в использовании преимуществ культурно-независимых технологий NGS, поскольку они продолжают снижать как финансовые, так и вычислительные затраты, наряду с постоянным расширением баз данных микробных генетических последовательностей. .Согласно расширенной базе данных микробиомов ротовой полости человека (HOMD) [13], официально названы только 57% видов бактерий полости рта, 13% культивировались, но остаются безымянными, а 30% не культивируются. Следовательно, методы NGS не только делают анализы относительно быстрыми и легкими, но они также значительно расширили наши знания о некультивируемой и / или редкой микробиоте. Рот может быть поражен несколькими патологиями, которые широко распространены среди людей, включая пародонтит, гингивит и кариес зубов, все из которых явно связаны с изменениями микробиома полости рта (см. ссылки в таблице 1).Однако рот представляет собой точку входа в дыхательную и пищеварительную системы, и он сильно васкуляризирован, что приводит к потенциальным последствиям микробиома полости рта при других системных заболеваниях. Действительно, все больше исследований показывают связь между другими заболеваниями и изменениями микробиома полости рта (таблица 2). Это говорит о том, что микробиота полости рта может служить потенциальными биомаркерами при диагностике некоторых системных заболеваний. При поиске этих отклонений в популяциях мы также должны учитывать оговорку о том, что наши знания о микробиоме человека могут быть далеко не полными.Недавние исследования собрали данные из ранее не изученных популяций и обнаружили не только различия в составе, но даже добавили многие неоткрытые виды в общедоступные базы данных [44,45], подчеркнув сильные различия между различными регионами мира. Большинство исследований были сосредоточены на европейских, североамериканских, китайских или других так называемых «СТРАННЫХ» популяциях. Это относится к западным, образованным, промышленно развитым, богатым и демократическим нациям, аббревиатура, которая первоначально была предложена для обозначения предвзятости в исследованиях психологии по отношению к этим обществам, которые в то время составляли около 13% населения мира, но насчитывали от 60 человек. % и 90% испытуемых в психологических исследованиях [46].Это раннее свидетельство подобной предвзятости в исследованиях микробиомов предполагает, что сохраняется возможность гораздо более широкого ландшафта «здоровых» микробиомов в разных культурах. Более того, даже в наборах здоровых образцов одной и той же популяции можно выявить отдельные подгруппы [10, 47, 48, 49, 50, 51]. Следовательно, в дополнение к изучению причин и последствий дисбиоза в микробиоме, также необходимо постоянно уделять внимание полной характеристике здорового микробиома, чтобы более надежно обнаруживать истинные отклонения от нормального состояния.

    Исследования, направленные на характеристику состава микробиома полости рта в различных человеческих популяциях, быстро развиваются, как и исследования, направленные на изучение вариаций в соответствии с растущим числом параметров, особенно тех, которые связаны со здоровьем и болезнями. В этом обзоре мы представляем общий обзор современных методологий, используемых для изучения микробиома полости рта, и основных результатов, полученных в течение последнего десятилетия интенсивных исследований. Наконец, мы обсудим текущие проблемы и перспективы этой быстро развивающейся области.На протяжении всего обзора мы будем уделять внимание новой роли микробиома полости рта в здоровье и болезни, а также новым возможностям для терапии и диагностики.

    2. Технические подходы к изучению микробиома полости рта

    Затраты на секвенирование ДНК резко упали благодаря внедрению технологий NGS, которые теперь позволяют ученым секвенировать несколько геномов человека за один день по цене менее 1000 долларов за геном, что составляет почти в миллион раз меньше, чем 20 лет назад [52].Точно так же существует ряд экономически эффективных методов NGS, которые можно использовать сегодня при изучении микробиома, в зависимости от того, что исследователь надеется узнать (рис. 1). Два наиболее широко используемых подхода включают секвенирование полного метагенома дробовиком (WMS) и секвенирование ампликона рибосомной РНК 16S, оба из которых включают считывание последовательностей ДНК микробов, присутствующих в образце, и сравнение их с базой данных последовательностей для установления относительных количеств различные организмы, присутствующие в этом образце.При WMS-секвенировании (рис. 1C) ДНК многократно случайным образом фрагментируется, что позволяет параллельно считывать миллионы коротких последовательностей, а затем они повторно собираются в полные (или частичные) геномные последовательности путем соединения перекрывающихся концов [53]. Однако секвенирование 16S рРНК (рис. 1А), также известное как штрих-кодирование 16S, чаще использовалось в метагеномных исследованиях, поскольку оно менее затратно как в экспериментальном, так и в вычислительном отношении, что позволяет проводить более масштабные исследования. Ген 16S рРНК является общим для всех бактерий и архей и имеет высококонсервативные области, что делает его полезным маркерным геном для использования универсальных последовательностей праймеров для его выделения для секвенирования.Среди консервативных областей гена разбросаны девять гипервариабельных областей (названных от V1 до V9), и именно эти сегменты позволяют таксономически идентифицировать организмы при картировании прочтений в базе данных известных последовательностей 16S рРНК [54]. Конечно, даже с использованием ASV для идентификации секвенирование 16S по-прежнему не имеет значительного таксономического разрешения по сравнению с секвенированием WMS, часто допуская различие только до уровня рода. Также были предложены альтернативы секвенированию 16S, чтобы улучшить разрешение или избежать систематической ошибки из-за разного количества копий гена 16S у разных видов [60] (хотя существуют методы для его коррекции [61]).Ген rpoB, например, имеет то преимущество, что обычно является единственной копией и имеет большую изменчивость, что позволяет проводить более глубокое таксономическое разрешение. Однако соответствующее отсутствие консервации делает его менее применимым в качестве универсального маркера [62]. База данных последовательностей генов rpoB доступна на веб-сайте FROGS (Find, Rapidly, Otus with Galaxy Solution) [63]. Некоторые предложили, чтобы один или несколько генов домашнего хозяйства, таких как rpoB, были секвенированы вместе с геном 16S, поскольку они повсеместно распространены и быстро эволюционируют, что обеспечивает лучшее таксономическое разрешение, чем один ген 16S [64].Чтобы различить близкородственные организмы, другие исследователи предложили метод многолокусного анализа последовательностей (MLSA), при котором несколько генов домашнего хозяйства из разных хромосомных локусов секвенируются параллельно [65]. Тем не менее, ген 16S рРНК остается текущим стандартом для анализа маркерных генов микробиома. Все упомянутые методы маркерных генов полезны при задании вопроса «Какие микроорганизмы присутствуют в образце?», Давая обзор микробного состава. по многим образцам.Однако секвенирование WMS может позволить обнаруживать виды или даже штаммы в дополнение к функциональным аннотациям образцов микробиома [66], которые можно предсказать только на основе известных полных геномных последовательностей при выполнении 16S-секвенирования. Таким образом, WMS дополнительно дает представление о функциональном потенциале микробиома, позволяя исследователям задать вопрос «Что на самом деле могут делать присутствующие микроорганизмы?». Исследования метагенома могут быть дополнительно подкреплены использованием метатранскриптомики [67], метапротеомики [68]. и метаболомика [69], хотя только первая из них использует технологии NGS.Метатранскриптомика (рис. 1D) отвечает на вопрос: «Что делают микроорганизмы?» Здесь идея состоит в том, чтобы профилировать общую экспрессию микробного гена в образце путем захвата общего содержания матричной РНК (мРНК), поэтому это особенно полезно при изучении функциональной активности микробиома в различных условиях, таких как болезнь или здоровье, разные состояния. диеты или разное время суток. Метапротеомика (рис. 1E) — это еще один подход к оценке функциональной активности образца микробиома, но вместо секвенирования генетического материала идея состоит в том, чтобы каталогизировать изобилие микробных белков, присутствующих в образце.Обычно это делается путем экстракции белка и тандемного масс-спектрометрического анализа (МС/МС) [68]. С другой стороны, метаболомика (рис. 1Е) отвечает на вопрос: «Что производят микроорганизмы в данном образце?» Метаболом представляет собой общий набор небольших молекул, продуцируемых микробиомом (и хозяином) в образце, и может быть сильным индикатором здоровья или дисбактериоза образца [70]. Метаболиты обычно количественно определяют с помощью хроматографии и методов обнаружения, таких как масс-спектрометрия (МС) и ядерный магнитный резонанс (ЯМР).Каждый из этих методов также имеет свои недостатки, которые не позволяют использовать его так широко, как метагеномика. Метатранскриптомике могут препятствовать нестабильность мРНК и избыток рРНК (хотя были разработаны методы противодействия этому [71]), а также ограниченность справочных баз данных транскриптомов [72]. Метапротеомика страдает вычислительными ограничениями при запросе белковых баз данных (которые, тем не менее, остаются неполными), а также избыточностью аннотаций из-за идентичных пептидов в гомологичных белках разных организмов, которые могут использовать их в разных процессах, оставляя тем самым результирующие таксономические и функциональные количественные оценки неоднозначны [68].Однако новейшие инструменты претендуют на решение обеих этих проблем [73]. С метаболомикой проблемы заключаются в определении того, продуцируются ли метаболиты хозяином или микробиомом, и связывании их с соответствующими генами и путями, подчеркивая необходимость интеграции этого метода с другими данными омики [72]. Все это инструменты и методы часто направлены на исследование бактериома, который составляет наиболее значительную часть микробиома, но не полностью.Для классификации состава микобиома, грибкового компонента микробиома, исследователи часто используют маркерную область, очень похожую на ген 16S рРНК, называемую внутренней транскрибируемой спейсерной областью цистрона ядерной рибосомной РНК, именуемой областью ITS (рис. 1A), который обеспечивает такое же таксономическое разрешение, как и при секвенировании 16S для бактерий [74]. К вируму, вирусному компоненту микробиома, может быть трудно подобраться, поскольку нет консервативных маркерных областей, таких как ген 16S рРНК у бактерий или область ITS у грибов.Таким образом, необходимо взять образец полного вирома и сравнить его с известными последовательностями вируса. Из-за этого возникают две проблемы, так как в текущих вирусных базах данных отсутствуют характеристики многих вирусов, и, следовательно, любые новые вирусные последовательности, которые не совпадают близко с последовательностями в текущих базах данных, будет трудно классифицировать [75]. Еще одной проблемой для исследований вирома является относительно низкая доля содержания вирусных нуклеиновых кислот по сравнению с другими микробами. Однако были предложены процедуры обогащения для увеличения содержания вирусных нуклеиновых кислот [76].Совсем недавно был предложен новый подход, называемый геномикой одного вируса (SVG) (рис. 1B), в котором отдельные вирусы выделяются с помощью флуоресцентно-активируемой вирусной сортировки (FAVS), а геномный материал амплифицируется и секвенируется [77]. При использовании данной методики важно, чтобы исследователи пришли к единому мнению о точной процедуре сбора и секвенирования для обеспечения воспроизводимости. Хотя некоторые из этих упомянутых исследований показали, что профиль микробиома образца не сильно зависит от метода сбора [78,79], они сосредоточены на крупномасштабных различиях.Однако по мере того, как технологии секвенирования становятся более эффективными, а базы данных, связанные с микробиомами, становятся более полными, исследователи будут продолжать сравнивать образцы в более мелких масштабах, поэтому небольшая техническая изменчивость, связанная с различными методами взятия мазков из мест сбора или использованием другого раствора для сбора полосканий полости рта, потенциально может результаты воздействия. Были опубликованы некоторые обзоры современных передовых практик [80,81], и их следует продолжать улучшать и развивать. доступные программные пакеты.Пакеты phyloseq [82] и microbiome [83] для R предлагают средства для организации данных экспериментов по секвенированию вместе с любыми метаданными, а также предоставляют набор инструментов и учебных пособий для расчетов и построения графиков в типичном анализе микробиома. Сюда входят функции для расчета альфа-разнообразия (относительное разнообразие таксонов, присутствующих в образце) и бета-разнообразия (относительное расстояние между любыми двумя образцами на основе общего состава), а также графики для различных методов ординации.Отсюда биоинформатик может пойти в любом направлении, поэтому здесь мы просто упомянем некоторые из наиболее известных анализов. Пакет vegan R [84] предлагает варианты многомерных тестов, таких как функция анозима (анализ сходства) для определения различий в составе микробиома между группами образцов и функция адониса для пермановой (перестановочный многомерный дисперсионный анализ), который может применять линейный модели для определения источников вариаций среди выборок. Линейные модели смешанных эффектов также могут применяться для определения воздействия на различные точки данных, такие как конкретные таксоны, уровни разнообразия или другие переменные метаданных.Стандартные или обобщенные линейные модели могут быть подобраны с использованием функций lm или glm, соответственно, из основного пакета R, называемого stats [85]. Модели смешанных эффектов также можно использовать с функциями lmer и glmer из пакета lme4 [86]. Также доступны варианты программного обеспечения для прогнозирования функциональных возможностей образца микробиома, секвенированного с помощью маркерного гена-мишени, такого как 16S рРНК. Инструменты PICRUSt (филогенетическое исследование сообществ путем реконструкции ненаблюдаемых состояний) [87] и Tax4Fun [88] используют базы данных эталонных геномов, чтобы попытаться реконструировать полные метагеномы из каждого образца.Методы машинного обучения также были реализованы, чтобы попытаться предсказать заболевание на основе состава микробиома [89], и некоторые исследователи сделали свой код общедоступным [90,91]. Микробиом полости рта с некоторым успехом даже использовался в классификаторе колоректального рака [92]. Недавний спорный момент в этой области связан с композиционным характером данных микробиома и значением для его анализа, что некоторые начали обсуждать. как с экспериментальной [93], так и со статистической [94] точки зрения.Поскольку показания, полученные в эксперименте NGS, представляют собой по существу случайные выборки относительной численности присутствующих организмов, это не может объяснить последствия различий в общей численности организмов, которые могут быть физиологически значимыми. Вандепутте и др. описали экспериментальный метод, называемый количественным профилированием микробиома (QMP) [93], в котором общая микробная нагрузка определяется путем отбора равного количества последовательностей на образец с последующей поправкой на систематическую ошибку количества копий 16S и общее количество клеток в образце. .Они смогли использовать этот подход, чтобы выявить ошибочные результаты стандартного эксперимента, предложив решение некоторых технических предубеждений, присущих исследованиям NGS. Однако, поскольку большинство наборов данных на сегодняшний день не были секвенированы с помощью каких-либо методов, таких как QMP, были предложены другие решения для обработки типичных асимметричных наборов данных в исследованиях микробиома. Редкое число прочтений, при котором из каждого образца извлекается случайная выборка из одинакового количества прочтений, было распространенным подходом в более ранних исследованиях микробиома, но эта практика не поощрялась, поскольку она пропускает биологически значимую информацию [95].Глор и др. вместо этого предложили нормализовать данные с помощью центрированного преобразования логарифмического отношения, на которое минимально влияет глубина чтения для выборки [94]. Они также предоставили руководство по рабочему процессу, сопровождающему их публикацию по этой теме.

    3. Полость рта и ее микробные ниши

    Из всех мест обитания в человеческом теле, для которых обычно изучается микробиом, ротовая полость требует, пожалуй, самого уникального подхода к изучению, поскольку она содержит ряд очень четко сформированных ниш. на различных поверхностях во рту.Изменения доступности кислорода, питательных веществ и рН-опосредующего действия слюны [96] могут способствовать росту различных организмов, и, наоборот, эти организмы могут участвовать в построении собственной небольшой ниши [97] посредством образования биопленок и питательных веществ. метаболизм, который может оказывать воздействие как внутри полости рта (таблица 1, рисунок 2), так и системно (таблица 2, рисунок 2). Некоторые исследователи решили изучить все эти ниши параллельно, чтобы сравнить их друг с другом [3,8,9], некоторые выбрали отдельные сайты с особым вниманием к локализованному дисбиозу при болезненных состояниях [98,99,100,101,102,103,104,105,106], а другие использовали полоскание полости рта для получения общего вида полости рта [10,11,12].Исследования, посвященные конкретным оральным нишам, обычно направлены на изучение заболевания, относящегося к этому участку. Например, считалось, что первичный синдром Шегрена (ПСС) в слизистой оболочке щеки является потенциальным резервуаром для патогенов, причастных к заболеванию, при этом было показано, что образцы больных имеют более высокое соотношение Firmicutes/Proteobacteria по сравнению со здоровым контролем и более высокое содержание 19 родов [98]. Различные исследования характеризовали изменения в поддесневом и наддесневом зубном налете, связанные с пародонтитом [99, 100, 101, 102], а также исследование поддесневого налета и слизистой оболочки щеки, показывающее, что оба участка различались между образцами пародонтита и здоровым контролем, при этом многие из одних и тех же микроорганизмов поражались в обоих случаях. участках, хотя они также демонстрировали колонизацию уникальными видами [103].Микробиом языка был исследован у пожилых людей в Японии из-за потенциальной связи между проглоченными микробами и пневмонией, которая обнаружила, что образцы с худшим состоянием зубов были обогащены бактериями, связанными с пневмонией [104]. Язык также рассматривался как потенциальный сегмент в диагностических инструментах, которые, возможно, будут включать микробиомы всего желудочно-кишечного тракта для выявления рака поджелудочной железы [105]. Небные миндалины были исследованы у ВИЧ-инфицированных пациентов, чтобы лучше понять оральные и системные осложнения заболевания, и было показано, что бактериом действительно был значительно изменен у инфицированных людей, но микобиом не был [106].В целом микробный состав во всех областях ротовой полости довольно постоянен, что позволяет легко отличить его от микробиомов других мест обитания человеческого тела [3,107,108,109,110]. Однако, хотя ниши в ротовой полости в основном состоят из одних и тех же организмов, некоторые из них могут присутствовать в разных пропорциях. В одном исследовании, объединяющем образцы из 10 ниш вдоль пищеварительного тракта у более чем 200 человек из США, эти ниши были разделены на четыре группы на основе сходства общего состава [8].Одним из участков был кишечник, представленный образцами стула, которые были сгруппированы отдельно, а остальные девять находились во рту и горле. Одна из трех других групп состояла из слизистой оболочки щек, ороговевшей десны и твердого неба, другая — из языка, слюны, небных миндалин и горла, а последняя группа содержала поддесневые и наддесневые бляшки. Хотя во всех нишах, не связанных со стулом, обычно доминировали типы Firmicutes и Bacteroidetes, они основывали группы больше на небольших различиях.Первая группа была более уникальной, чем две другие группы, не связанные со стулом, и было показано, что она имеет значительно более высокую численность рода Streptococcus и более низкое общее альфа-разнообразие, которое является мерой относительного разнообразия организмов, присутствующих в данном образце. Группа 3, содержащая два типа десневого налета, обычно имела более высокое альфа-разнообразие. Сравнение состава этих ниш и их разнообразия было подтверждено в других исследованиях [3,9,111]. Авторы утверждают, что уровень потока слюны во рту является ключевым фактором, определяющим состав микробиома в каждой нише полости рта из-за его способности регулировать pH и доступность питательных веществ, но другие важные факторы могут включать тип поверхности. и наличие кислорода.Две бляшки, например, формируются на не теряющихся поверхностях зубов, где они образуют биопленки, внутри которых кислород ограничен, что приводит к большему количеству облигатных анаэробных организмов в поддесневой бляшке и факультативных анаэробных организмов в наддесневой бляшке [8]. ]. Они предполагают, что одна ниша из каждой группы может быть использована для представления всех ниш в этой группе, например, использование микробиома слизистой оболочки щеки в качестве показателя как для микробиомов кератинизированной десны, так и для микробиомов твердого неба (ниши группы 1).Однако по мере того, как методы секвенирования продолжают совершенствоваться, а затраты продолжают снижаться, мы можем обнаруживать все более и более тонкие особенности в каждой нише из-за комбинаций только что упомянутых факторов микросреды, а также любых других. Таким образом, это решение будет зависеть от усмотрения исследователей и актуальности их исследований. Поскольку эти ниши, как правило, имеют очень похожий общий состав микробиома на всех уровнях, кроме самых низких таксономических уровней, многие исследователи предпочитают рассматривать полость рта как отдельный объект. среде обитания и анализировать глобальные составы и процессы в ней [10,12,112].Несколько исследований показали, что это жизнеспособный и эффективный метод сбора образцов для исследования микробиома полости рта [78,79], и были предложены стандартные процедуры [113,114]. По сути, человек должен воздерживаться от еды, питья, чистки зубов или курения (всего, что может временно изменить типичный микробный состав) в течение как минимум 30 минут до сбора. Затем они полоскали буферным раствором в течение примерно 30–60 с, а затем выплевывали содержимое в пробирку, которую позже центрифугировали и секвенировали.Практические преимущества использования ополаскивателя для полости рта заключаются в простоте сбора, поскольку это быстрый и неинвазивный метод получения ДНК микробов из полости рта от участника исследования, а также в простоте хранения и транспортировки, поскольку эти образцы можно заморозить. и секвенированы позже без ущерба для качества образцов [79,115]. Это выгодно для крупномасштабных проектов микробиома, поскольку позволяет собирать множество образцов, что может занять недели или месяцы, которые впоследствии можно секвенировать вместе, чтобы свести к минимуму потенциальную техническую погрешность, присущую проектам секвенирования, как упоминалось в предыдущем разделе. .

    4. Здоровый микробиом полости рта и определение стоматотипов

    Область исследований микробиома, возможно, все еще находится в зачаточном состоянии, о чем свидетельствуют продолжающиеся усилия по расширению баз данных по известным микробным геномам и борьбе с предубеждением в пользу «СТРАННЫХ» популяций, как упоминалось во введении [44,45,116]. Одни только эти факторы затрудняют эффективное определение того, что представляет собой «здоровый» микробиом полости рта. Однако, вдобавок ко всему, накопление исследований за последнее десятилетие или около того показало, что даже в пределах определенных групп населения потенциально может существовать несколько различных тенденций состава микробиома среди людей с относительным общим состоянием здоровья [10, 48, 49, 50]. ,51].Таким образом, хотя мы можем стремиться исследовать связь микробиома с болезнью, жизненно важно, чтобы мы также продолжали дальнейшее определение состава микробиома в здоровом состоянии среди различных групп населения и изучали причины сдвигов внутри или между этими популяциями. Проекты, основанные на устных образцы полоскания идеально подходят для наблюдения за тем, как внешние факторы влияют на микробиом ротовой полости в целом. Конечно, фраза «внешние факторы» может охватывать широкий спектр переменных, но некоторые из них явно связаны со ртом — это вода, которую мы пьем, и пища, которую мы едим.В когорте из 1319 образцов здоровых подростков в Испании, проанализированных с помощью секвенирования 16S рРНК, было показано, что различия в ионном составе общественной питьевой воды связаны со сдвигами в общем составе микробиома полости рта [10]. Образцы из регионов с более высокой щелочностью и более высокими уровнями ионов, таких как сульфат (SO4) и натрий (Na), имели более высокое содержание родов, таких как Porphyromonas и Flavobacterium, в то время как регионы с более низкими уровнями показали более высокое содержание других родов, включая Veillonella. , Pseudomonas и Ralstonia.Также было показано, что различные диеты вносят вклад в вариации состава микробиома, например, в исследовании, основанном на WMS, сравнивающем микробиомы полости рта у популяций охотников-собирателей (HG) с Филиппин, традиционных фермеров (TF) с Филиппин и Западные контроли (WC) из проекта Human Microbiome Project (образцы из США) [116]. Они показали, что образцы HG имели более высокое альфа-разнообразие, в то время как у образцов WC оно было ниже, а образцы TF оказались в середине. Точно так же наблюдался сильный градиент в распространенности основных родов Neisseria и Haemophilus полости рта, с высокими уровнями Neisseria и низкими уровнями Haemophilus в образцах HG, обратным в образцах WC, а образцы TF снова находились между ними.Образцы HG, несмотря на хорошее здоровье полости рта, также показали более высокую численность ряда видов, которые обычно считаются оральными патогенами, связанными с гингивитом и пародонтитом по западным стандартам. Функциональный анализ выявил усиление путей биосинтеза витамина В5 в образцах ГГ и, в меньшей степени, в образцах ТФ. Было показано, что американцы потребляют большее количество продуктов с витамином B5, поэтому авторы утверждают, что этот недостаток в рационе охотников-собирателей приведет к отбору организмов, которые синтезируют его самостоятельно.И наоборот, они показали, что образцы WC и, в меньшей степени, образцы TF были обогащены уреазной активностью, особенно из Haemophilus spp. Эта уреаза противодействует падению pH, которое происходит, когда бактерии разлагают сахара до кислотных соединений, поэтому имеет смысл выбирать эти организмы в образцах WC с их диетами, богатыми сахаром и крахмалом. Таким образом, авторы предполагают, что организмы, считающиеся оральными патогенами в западных популяциях, действительно могут быть частью здоровых микробиомов различных популяций, таких как общества охотников-собирателей, и что патогенные штаммы этих организмов будут выбираться на основе доступности питательных веществ, связанных с диетой.Еда и вода являются очевидными влияющими факторами, но любое количество других факторов также может влиять на микробиом. Обычный подход на ранних этапах анализа микробиома любой среды обитания тела состоит в том, чтобы сначала рассмотреть широкое влияние таких факторов путем группирования образцов на основе общего микробного состава. Идея разделения образцов на кластеры обсуждалась в раннем исследовании микробиома кишечника, основанном на NGS, где авторы назвали кластеры «энтеротипами», подразумевая наличие различных предполагаемых категорий микробного состава кишечника [47].Они обнаружили три различных энтеротипа, разделение которых в значительной степени было обусловлено различиями в численности конкретных организмов, а именно родов Bacteroides, Prevotella и Ruminococcus, и подтвердили это, обнаружив очень похожие энтеротипы из двух отдельных наборов образцов. Исходя из этого, они предположили, что может существовать некоторое ограниченное количество равновесий симбиотических состояний между человеком-хозяином и его микробиомом, которые возникнут из-за различных диет и образов жизни. , также появились кластеры образцов аналогичного состава, названные «стоматотипами» в одном из таких исследований, как дань уважения первоначальному термину «энтеротип», но в отношении рта [10].Сводка некоторых родов бактерий, которые, как было обнаружено, совместно встречаются у разных стоматотипов в ходе исследований, представлена ​​в таблице 3. Таким образом, было показано, по крайней мере, два строго подтвержденных стоматотипа, один из которых включает более высокую численность родов Proteobacteria Neisseria и Haemophilus, а другой с более высоким содержанием Bacteroidetes рода Prevotella и рода Firmicutes Veillonella. Некоторые исследования показали больше, чем просто эти два стоматотипа, хотя консенсус в отношении составов более разнообразен.Некоторые из родов встречаются по-разному, в зависимости от исследования. Явный характер стоматотипов может быть очень привлекательным в качестве средства дифференциации образцов, но эти несоответствия подчеркивают две основные проблемы. Первый связан с фрагментарностью нашего нынешнего понимания микробиома из-за уже обсуждавшихся культурных предубеждений и технических ограничений. У нас еще нет полной картины того, что может представлять собой различные потенциальные равновесия численности микробов, которые приводят к определенному стоматотипу, потому что мы не исследовали здоровые микробиомы многих уникальных популяций по всему миру, и многие исследования, которые у нас уже есть не хватает разрешения, чтобы объяснить мелкие различия между образцами.Как упоминалось выше, популяции охотников-собирателей с Филиппин, которые были отобраны, были обогащены Neisseria spp. в то время как западные контроли были обогащены Haemophilus spp. [116]. Это может означать, что образцы из обеих популяций будут сгруппированы в стоматотип 1 из таблицы 3, поскольку эти два рода управляют равновесием стоматотипа 1, обычно вместе, но не во всех исследованиях [49]. Между тем, Bacteroidetes (тип, содержащий Prevotella) и Veillonella, драйверы стоматотипа 2, оказались ближе к середине градиента между равновесиями HG и WC, что является еще одним потенциальным доказательством того, что HG и WC могут группироваться вместе в стоматотипе 1.Как можно примирить сильные различия, демонстрируемые между этими двумя популяциями, и доказательства, представленные до сих пор для составов внутри стоматотипов? Это, вероятно, можно частично объяснить «СТРАННЫМ» уклоном в исследованиях, представляющих стоматотипы — возможно, это равновесие возникает в популяциях с прозападной диетой, медицинским лечением и образом жизни. Однако этот вопрос также связан со второй важной проблемой, а именно со статистической значимостью разделения выборок на дискретные кластеры.Идея анализа градиентов микробного обилия была предложена как ответ на концепцию энтеротипа [117]. Это привело к дальнейшему обсуждению достоинств энтеротипов/стоматотипов, предупреждению их использования в качестве прогностических или диагностических инструментов [118], а также предложению улучшить их расчеты с дальнейшим акцентом на градиентах численности [107,119]. См. Рисунок 3 для примера различных градиентов обилия организмов в Таблице 3, которые были показаны как драйверы стоматотипов, и как они связаны со стоматотипами, обнаруженными в случайном подмножестве из 500 образцов из набора данных микробиома полости рта [10]. .Эти и другие исследования предполагают, что стоматотипы полезны в качестве первого шага в изучении лежащих в основе вариаций среди образцов, которые затем могут быть дополнительно исследованы посредством более глубокого анализа сдвигов в конкретных организмах. Например, при исследовании подростков в Испании они установили связь с составом водопроводной воды, сначала наблюдая за картами распределения образцов в двух обнаруженных ими стоматотипах, которые напоминали карты значений жесткости воды по всей Испании, а затем позже. начали смотреть на воздействие на конкретные организмы в их образцах [10].

    5. Небактериальные микроорганизмы полости рта

    Бактерии доминируют как в исследованиях микробиома ротовой полости человека, так и в биомассе ротовой полости, при этом грибы, по оценкам, составляют 120]. Тем не менее, в полости рта присутствует значительное разнообразие видов грибов, включая виды из родов Candida, Aspergillus, Penicillium, Schizophyllum, Rhodotorula и Gibberella [121]. Тем не менее, два основных осложнения ограничивают исследование микобиома: (1) трудности в идентификации многих видов грибов и (2) путаница в номенклатуре грибов.Обе эти проблемы начали решаться в значительной степени за счет использования технологий NGS. До недавнего времени считалось, что разнообразие внутри орального микобиома весьма ограничено, в нем преобладают в основном несколько видов Candida [122]. Во многом это было связано с тем, что многие грибы трудно культивировать в лаборатории, но достижения в технологиях NGS выявили более широкий спектр грибковых организмов, чем ожидалось ранее. Одно исследование показало, что род Malassezia был широко распространен во рту [123], но ранее оставался незамеченным в этом участке тела, потому что он имеет особые потребности в липидах и нуждается в специализированных питательных средах для выращивания в лаборатории, и ранее считалось, что это возбудителя на коже [124].Однако даже в рамках метагеномных исследований могут возникнуть сложности с классификацией истинного разнообразия грибов. Например, при повторном анализе образцов, в которых была обнаружена Malassezia, не удалось обнаружить этот род ни в одном из образцов [125], но, возможно, это связано с тем, что во втором исследовании не использовался тот же протокол выделения ДНК, что и в первом. , который включал этап, на котором использовались шарики, чтобы помочь разрушить клеточные стенки и капсулы. Это подчеркивает несоответствие протоколов метагеномных исследований грибов и необходимость стандартизации.Независимо от технических проблем, связанных со сбором и классификацией генетического материала в исследованиях грибов, в классификации грибов также существует некоторая неоднозначность. Например, Malassezia диморфны, имеют как дрожжевую, так и мицелиальную фазы, и в прошлом относились к нескольким родам [123]. Авторы утверждают, что, хотя таксономия для этого конкретного рода в основном решена, более ранние исследования могут упустить эту информацию, и эта проблема может возникнуть и для других грибковых организмов.В последнее десятилетие был сделан толчок к прекращению системы двойной номенклатуры, поскольку этот подход стал рассматриваться как архаичный, и с тех пор начала применяться единая классификация имен [126]. Поскольку таксономия грибов продолжает расширяться, исследования на основе NGS вносят большой вклад в идентификацию новых видов, как с помощью ITS-amplicon [74], так и метагеномных методов дробовика [127]. Сложности в технических подходах и в классификации привели к скудным исследованиям оральный виром, но мы можем сделать несколько выводов из некоторых недавних работ в этой области.Это важный сегмент исследования микробиома, поскольку не только эукариотические вирусы могут напрямую влиять на здоровье хозяина, но и прокариотические вирусы могут делать то же самое, изменяя общий состав бактериома и, следовательно, его функцию [75]. Исследование, проведенное в Испании с использованием геномики одного вируса (SVG) и вирусной метагеномики в 15 образцах слюны, выявило 439 оральных вирусов, которые они сгруппировали примерно в 200 кластеров, соответствующих классификации на уровне рода [128]. Они увидели, что большинство вирусов не были постоянно преобладающими, и было трудно определить основную группу слюнных вирусов, и вместо этого в ротовом вироме были различные межличностные композиции.Тем не менее, 26 из их 200 вирусных кластеров имеют много общих генов, и большинство из них были фагами Streptococcus, что является разумным выводом, поскольку, как мы видели, Streptococcus обычно относится к наиболее многочисленным родам оральных бактерий, если не к самым многочисленным. в западных оральных микробиомах. Другое исследование, также проведенное в Испании, на 72 здоровых взрослых оральных виромах дало аналогичные результаты [129]. Они обнаружили очень мало вездесущих вирусов, в то время как большинство из них были обнаружены только в отдельных образцах, и снова фаги Streptococcus были обычным явлением.Тем не менее, они предположили небольшое ядро ​​оральных вирусов и указали на присутствие вирусных ядер в других участках тела, наблюдаемых в других исследованиях, включая легкие в здоровых образцах [130], кишечник даже после фекальной трансплантации [28] и кожи [29]. Они также подчеркивают специфичность этого орального вирусного ядра для западных культур, поскольку исследования вирома также страдают от упомянутой выше предвзятости «СТРАННЫХ». Простейшие и археи также являются компонентами орального микробиома, хотя мало что было сказано об обеих группах.По-видимому, никаких исследований простейших ротовой полости на основе NGS не проводилось, но вместо этого они были идентифицированы с помощью методов микроскопии [30, 131, 132, 133]. Однако наличие гена 16S рРНК у архей привело к использованию методов NGS в некоторых исследованиях. Все виды архей, обнаруженные к настоящему времени в ротовой полости, являются метаногенами (метанпродуцирующими организмами) типа Euryarchaeota [134]. Было показано, что эти археи, как правило, присутствуют в большем количестве у пациентов, страдающих пародонтитом [14,15].Однако было высказано предположение, что может существовать большее разнообразие архей, которое до сих пор осталось незамеченным, либо потому, что традиционные методы не позволили обнаружить другие археи, потому что они встречаются в низкой распространенности и численности, либо из-за отсутствия разнообразия в археях. отобранных популяций [135]. Каждая из этих проблем может быть решена путем дальнейшего изучения исследований на основе NGS среди различных групп населения.

    6. Микробиом полости рта и заболевания полости рта

    Эколог растений Роберт Хардинг Уиттакер, определяя наземные биомы в 1970-х годах, обсуждал градиенты условий окружающей среды от благоприятных до экстремальных.Он показал, что как альфа-, так и бета-разнообразие уменьшается по мере того, как условия биома становятся более экстремальными. [136]. Параллель с этим обобщением была замечена в исследованиях микробиома за последнее десятилетие, если мы учтем, что болезненные состояния приравниваются к «экстремальным» условиям окружающей среды в определенных участках тела. Это часто приводит к низкому альфа-разнообразию (меньшему количеству отдельных организмов), что приводит к низкому бета-разнообразию (уникальность общего состава отдельного образца), поскольку некоторые организмы лучше приспособлены для доминирования в своей среде обитания.Распространенные заболевания полости рта, такие как пародонтит и кариес зубов, являются яркими примерами этого явления, при этом состав микробиома тесно связан с болезненным состоянием. Однако на данном этапе развития поля микробиома не всегда ясно, приводят ли изменения микробного состава к заболеванию или наоборот. Тем не менее, безусловно, стоит обсудить ассоциации, которые были обнаружены, чтобы начать постулировать связанные с микробиомом механизмы возникновения или прогрессирования заболевания.Виды «красного комплекса» (Porphyromonas gingivalis, Treponema denticola и Tannerella forsythia) исторически рассматривались как первичные инфекционные организмы, вызывающие пародонтит [137], но это было определено исследованиями на основе культур, которые, таким образом, упустили большую часть бактериальное разнообразие, присутствующее в образцах. С тех пор методы NGS выявили другие микроорганизмы, которые также связаны с периодонтитом (таблица 1, рисунок 2), такие как классы Clostridia, Negativicutes и Erysipelotrichia [16]; роды Synergistes [17], Prevotella и Fusobacterium [18]; вид Filifactor alocis [16]; а также виды архей Methanobrevibacter oralis, Methanobacterium curvum/congolense и Methanosarcina mazeii [14,15].И наоборот, некоторые организмы связаны со здоровьем пародонта, включая тип Proteobacteria и класс Firmicutes Bacilli [16], а также роды Streptococcus, Actinomyces и Granulicatella [19]. Очевидно, что существует множество организмов, так или иначе связанных с пародонтитом. , но это поднимает вопрос о том, какие на самом деле могут быть возбудителями, а на какие просто влияют изменения окружающей среды в болезненном состоянии. Одно исследование, в котором использовались методы метатранскриптомики, сравнило профили экспрессии 160 000 генов и показало сохраняющиеся различия в метаболизме, несмотря на различия в составе микробиома, предполагая, что в болезненном состоянии организмы, присутствующие в образце, выполняют сходные функции, даже если виды различаются между образцами. [20].Это мнение может быть подтверждено другим исследованием, в котором предполагалось, что метаногенные виды архей развивают синтрофические отношения, действуя как «поглотители водорода», что способствует усиленному росту патогенных вторичных ферментеров. Представители рода Treponema обладают аналогичной активностью по потреблению водорода, что, возможно, объясняет их участие в «красном комплексе». Действительно, это исследование показало, что распространенность трепонем и метаногенных архей антикоррелирует, предполагая, что они могут занимать одну и ту же функциональную нишу [15].Было показано, что при кариесе зубов альфа-разнообразие уменьшается по мере прогрессирования заболевания, и виды Streptococcus mutans обнаруживаются в высоких количествах на ранних стадиях развития кариеса, но не на более поздних стадиях, в то время как другие виды Streptococcus связаны со здоровьем зубов [22]. . Было высказано предположение, что, хотя S. mutans является ацидогенным и может способствовать начальному образованию кариеса, другие таксоны полости рта также являются ацидогенными. Существенным вирулентным фактором в этой ситуации является его способность метаболизировать сахарозу из рациона хозяина во внеклеточные полисахариды (ЭПС), которые необходимы для образования кариесогенных биопленок.Кроме того, в этих условиях способствует адгезия между S. mutans и Candida albicans, при этом C. albicans обеспечивает дополнительный ацидогенез [23]. Недавно также были изучены связи между микробиомом и раком. Ряд видов, обнаруженных в полости рта, были связаны с раком полости рта, включая Capnocytophaga gingivalis, Prevotella melaninogenica и Streptococcus mitis [24]. В таблице 1 перечислены некоторые виды, которые были описаны как имеющие связь с раком ротовой полости, хотя есть оговорка, что образцы в одном из этих исследований были взяты из опухолевых и неопухолевых участков у одного и того же пациента, и, таким образом, состав при оба участка могут на самом деле быть поражены болезнью, и неясно, какое именно лечение, связанное с раком, прошли пациенты, если таковое имело место [25].К сожалению, по-видимому, не так много исследований, изучающих эту связь с современными методами, и среди таких исследований нет большого консенсуса по составу микробиома при наличии рака полости рта, но есть ряд гипотез о потенциальном канцер-стимулирующем действии. микробиоты. Было высказано предположение, что некоторые из нормальных бактерий полости рта, в том числе Streptococcus salivarius, Streptococcus intermedius и Streptococcus mitis, могут превращать этанол в канцерогенный ацетальдегид [26, 138] или активировать цитокины и другие провоспалительные молекулы, приводя к хроническому воспалению, которое может быть связано с канцерогенез [139], и что бактериальные токсины также могут влиять на сигнальные пути клетки или повреждать ДНК [140].Также был исследован рак пищевода с выявленными ассоциациями с пародонтальными патогенами Tannerella forsythia и Porphyromonas gingivalis (членами «красного комплекса») [27]. Исследование показало, что род Neisseria был связан с более низким риском рака пищевода, как и путь биосинтеза каротиноидов, в который потенциально могут вносить свой вклад ряд видов Neisseria.

    7. Микробиом полости рта и другие заболевания

    Микробиом полости рта ни в коем случае не является изолированным биомом, а вместо этого является частью сильно взаимосвязанной серии микробиомов в организме человека, образующих своего рода микробиосферу .Ротовая полость, как точка входа почти всего проглоченного материала и благодаря высокой васкуляризации, имеет широкие возможности влиять на активность других участков тела. Поэтому неудивительно, что, помимо заболеваний полости рта, микробиом полости рта вовлечен в ряд системных заболеваний.

    Рот — это прямой путь как к легким, так и к пищеварительной системе, поэтому, возможно, можно ожидать связи между таксонами полости рта и такими заболеваниями, как кистозный фиброз (МВ) [33] или колоректальный рак (КРР) [12, 141, 142, 143]. уже обсуждали.Патогенность Pseudomonas aeruginosa, основного агента в образовании биопленки в легких пациентов с муковисцидозом, может подавляться оральными комменсальными стрептококками, особенно Streptococcus oralis, за счет продукции перекиси водорода, которая может нарушить образование биопленки, но это наблюдалось только если эти стрептококки были первичными колонизаторами до интродукции P. aeruginosa. Однако в типичной среде легких при муковисцидозе эти виды стрептококков фактически стимулируют выработку P.aeruginosa, включая факторы вирулентности, включая эластазу и пиоцианин [33]. Дисбиоз в ротовой полости, приводящий к пародонтиту, был связан, среди прочего, с раком полости рта, пищевода, желудка, легких, поджелудочной железы, предстательной железы, гематологическим раком и раком молочной железы [144,145]. Гипотезы об этих связях включают: производство канцерогенных молекул, таких как нитрозамины, таксонами, восстанавливающими нитраты [146, 147] или ацетальдегид таксонами, метаболизирующими этанол [26, 138], повышенное количество связанных с раком вирусов, таких как цитомегаловирус и вирус Эпштейна-Барра [148, 149], и , возможно, наиболее заметным является увеличение провоспалительных маркеров, возникающих в результате иммунных реакций на заболевания пародонта, таких как цитокины [139] и рецепторы конечных продуктов усиленного гликирования (RAGE) [150].Многочисленные исследования связывают Fusobacterium nucleatum с CRC [141, 142, 143], так как это оральный комменсальный вид, который является высокоинвазивным и адгезивным [151] и появляется в образцах аденомы пациентов с CRC. В случаях аденомы это коррелировало с локальным воспалением, TNF-α и IL-10 [141]. Однако недавнее исследование, основанное на NGS, не обнаружило связи между Fusobacterium и CRC, но вместо этого обнаружило ассоциации с родами Lactobacillus и Rothia [12]. Авторы предполагают, что результаты некоторых других исследований на самом деле могут быть искажены курением, которое, как было показано, связано с F.nucleatum во рту [152,153]. Они также утверждают, что, хотя Lactobacillus был предложен в качестве пробиотика, когда он присутствует в микробиоме кишечника [154,155], как показано в предыдущем разделе (см. Таблицу 1, Рисунок 2), этот род связан с кариесом зубов в микробиоме полости рта. Таким образом, Lactobacillus, возможно, не оказывает прямого влияния на колоректальный канцерогенез, но, возможно, может быть дополнительным показателем плохого состояния полости рта, которое, как мы видели, тесно связано с раком. Другое исследование показало более высокое содержание Porphyromonas gingivalis и Aggregatibacter actinomycetemcomitans при раке поджелудочной железы. образцы [31], оба из которых являются краеугольными возбудителями пародонтита [18,21].gingivalis [156], а другой показывает, что как P. gingivalis, так и A. actinomycetemcomitans обладают потенциалом инициировать пути Toll-подобных рецепторов (TLR), которые, как было показано, являются движущей силой канцерогенеза поджелудочной железы [157]. Тем не менее, другое исследование, кажется, противоречит первому, обнаружив большее количество лептотрихий в образцах рака поджелудочной железы по сравнению со здоровым контролем и более низкое количество Porphyromonas, а также меньшее количество Aggregatibacter (хотя последнее не было статистически значимым) [32]. .Они предполагают, что высокое соотношение Leptotrichia и Porphyromonas (коэффициент LP) является биомаркером рака поджелудочной железы. Фактически, они смогли переклассифицировать одного пациента, который изначально был здоровым человеком, но у которого было диагностировано неизвестное заболевание пищеварительной системы. Высокий коэффициент LP у человека вызвал повторную оценку, которая привела к диагностике рака поджелудочной железы у этого пациента.

    Объединение доказательств, представленных в обоих исследованиях, может привести к решению несоответствующих результатов. Оба ссылаются на связь между P.gingivalis и раком поджелудочной железы, так что это может быть связано с высокой численностью этого вида до начала заболевания, что приводит к выработке антител и, в конечном итоге, снижению численности. Затем высокая начальная численность P. gingivalis потенциально может быть связана с заболеванием пародонта, которое затем может привести к различным видам рака в результате системного воспаления или любого из других механизмов, обсуждаемых здесь. Конкуренция между Leptotrichia и Porphyromonas может объяснить их антикорреляцию, так как антитела снижают обилие P.gingivalis, лептотрихия способна процветать. Фактически, во втором исследовании некоторые из образцов рака поджелудочной железы имели низкие коэффициенты LP, наравне с коэффициентами LP, не относящимися к раку поджелудочной железы, так что это могли быть случаи на ранней стадии. Эта ситуация подчеркивает необходимость большего внимания к временной динамике микробиома в такого рода ассоциативных исследованиях, чтобы обнаружить важные факторы возникновения, прогрессирования и поддержания болезненных состояний.

    Некоторые другие системные заболевания также связаны с пародонтитом, например сердечно-сосудистые заболевания/атеросклероз [34,35].Одно исследование, в котором приняли участие более 3000 человек в течение 16 лет, показало, что периодонтит с потерей моляров был связан с раком молочной железы (среди других типов) и преждевременной смертью из-за рака, сердечно-сосудистых или желудочно-кишечных заболеваний [158]. Как и в случае рака, связанного с пародонтитом, возникающее в результате усиление системного воспаления является основным объяснением связи с сердечно-сосудистыми заболеваниями [159]. Во многом это связано с инвазивным характером некоторых связанных таксонов, таких как P.gingivalis, который также способствует инвазии в эпителиальные клетки хозяина у таких видов, как Prevotella intermedia, комменсальных оральных видов [160]. Белки, секретируемые этими микроорганизмами, вовлечены в их патогенность, такие как гингипаины из P. gingivalis, которые способствуют образованию биопленки во время пародонтита [161] и впоследствии активируют выработку цитокинов [162]. Исследования, связывающие периодонтит и атеросклероз, основывались на обнаружении бактерий полости рта, колонизирующих атеросклеротические бляшки [34,35], а не на обилии таксонов в полости рта (таблица 2, рисунок 2).Хотя, по-видимому, было проведено меньше исследований с использованием методов NGS образцов полости рта для определения связи между составом микробиома полости рта и сердечно-сосудистыми заболеваниями, потенциальные механизмы действия таксонов полости рта делают эту область еще одной привлекательной областью для исследований. Ревматоидный артрит (РА) часто был связан с периодонтитом [36, 163], снова вовлекая P. gingivalis, в данном случае из-за его продукции гингипаинов и пептидиларгининдеиминазы, которые активируют цитруллинирование белка, важный триггер для РА.Однако недавно было показано, что эта прямая связь может быть ошибочной [164]. Фактически, исследования ревматоидного артрита с использованием секвенирования 16S и секвенирования полного метагенома, соответственно, показали, что P. gingivalis либо не был связан с ревматоидным артритом [37], либо на самом деле был более обильным у здоровых контролей по сравнению с образцами ревматоидного артрита [38], в то время как разные микроорганизмы были ассоциированы. с заболеванием (табл. 2, рис. 2). Это демонстрирует, как исследования NGS могут позволить исследователям определить достоверность ранее существовавших убеждений и потенциально открыть новые пути для исследований.Неврологические расстройства также связаны с микробиомом полости рта. Возможно, наиболее полным исследованием в этом отношении является ассоциация P. gingivalis с болезнью Альцгеймера [40]. Авторы этого исследования не только идентифицировали эту бактерию в мозге пациентов с болезнью Альцгеймера на уровнях, коррелирующих с агрегатами тау и убиквитина (признак заболевания), но также показали, что инфекция P. gingivalis у мышей приводила к колонизации мозга и увеличивала образование компонентов амилоидных бляшек.Далее они показали, что протеазы гингипаина, продуцируемые P. gingivalis, нейротоксичны и ингибируют функцию тау. Это предполагает прямую связь между обнажённой колонией P. gingivalis и возникновением или прогрессированием болезни Альцгеймера, а также предполагает, что ингибиторы гингипаина могут быть использованы для лечения нейродегенерации при этом заболевании. Также было показано, что типичные оральные виды филума Spirochaetes, включая несколько видов рода Treponema, часто образуют амилоидные бляшки и что эти организмы способны продуцировать дополнительный амилоид-β и амилоид-β-протеиновый предшественник [41].Дисбиоз микробиома полости рта также связан с нарушениями эндокринной системы. В этом случае пародонтит, по-видимому, является потенциальным результатом диабета, а не его потенциальной причиной, как в случае большинства заболеваний, обсуждавшихся выше. В одном лонгитюдном исследовании распространенность пародонтита составила 60% у пациентов с диабетом и 36% у пациентов без диабета [165]. Некоторые из предполагаемых механизмов влияния диабета на здоровье пародонта включают микроангиопатию или изменения воспалительной реакции, метаболизма коллагена или концентрации глюкозы в жидкости десневой борозды [166].Тем не менее было высказано предположение, что пародонтит может также усугублять последствия диабета, усиливая выработку воспалительных факторов, таких как TNF-α, которые могут действовать как антагонисты инсулина [167]. Удивительно, но одно исследование NGS показало, что у пациентов с диабетом на самом деле было меньшее количество типичных видов «красного комплекса», наблюдаемых при инфекциях пародонтита, Porphyromonas gingivalis, Tannerella forsythia и Treponema denticola [43]. Авторы отмечают, что потенциальные искажающие факторы в их исследовании включают более высокий средний индекс зубного налета и более высокий возраст у пациентов с диабетом.Однако также возможно, что любой из предложенных механизмов диабетического влияния на здоровье пародонта мог привести к изменению типичного дисбиотического состава при пародонтите или что образцы были собраны на стадии прогрессирования заболевания, при которой общие патогены обнаруживаются в меньшей степени. В любом случае это представляет еще одну интересную возможность для более масштабных лонгитюдных исследований, чтобы обнаружить потенциальные альтернативные пути пародонтита и, таким образом, лучше понять его механизмы и возможные методы лечения или профилактические меры.

    8. Клинический потенциал микробиома полости рта/Манипуляции и возмущения микробиома полости рта

    Здесь мы продемонстрировали несколько ключевых примеров широкомасштабного действия микробиома полости рта на организм человека. Это открывает огромные возможности для диагностики и вмешательства, лишь некоторые из которых начали изучаться или даже концептуализироваться. Чтобы в полной мере использовать этот потенциал, нам нужно будет продолжать исследовать состав и действие микробиомов полости рта как при небольших взаимодействиях между людьми с разным состоянием здоровья, так и в широких масштабах среди разных групп населения.Оральный микробиом уже показал потенциал в качестве диагностического инструмента. Одно исследование, основанное на машинном обучении, в котором были собраны 2424 общедоступных метагенома из восьми исследований, показало, что эффективность прогнозирования заболеваний улучшилась при использовании признаков на уровне штамма (невозможно с секвенированием 16S), и предположило, что фенотипы заболевания связаны с «не «основные» микробные гены/факторы, которые могут быть обнаружены в вариабельных областях генома, специфичных для штаммов/подвидов [90]. Тем не менее, они предостерегают от использования некоторых потенциальных биомаркеров для диагностики заболеваний, таких как виды Streptococcus anginosus, которые на самом деле связаны с общим дисбактериозом, а не с конкретным заболеванием.Авторы по-прежнему считают эту работу ранней стадией моделирования здорового микробиома, чтобы ее можно было использовать для противопоставления состояний дисбактериоза, связанных с болезнью. Другая попытка использования микробного обилия в ротовой полости в качестве биомаркеров показала некоторый предварительный успех в раннем выявлении поражений колоректальным раком (CRC) [92]. Иммунный тест кала (FIT) и анализ кала на скрытую кровь (FOBT) являются типичными неинвазивными процедурами скрининга, используемыми для выявления CRC, но они имеют низкую чувствительность при обнаружении ранних поражений.Авторы показали, что классификационная модель, основанная на образцах орального микробиома, обладает высокой специфичностью и большей чувствительностью, чем стандартные тесты, в различении образцов CRC и полипов от здоровых контролей с дальнейшим увеличением чувствительности при сочетании с образцами фекального микробиома. Таким образом, при дальнейших проверочных исследованиях микробиом может быть использован для повышения скорости раннего выявления CRC. Помимо биомаркера, микробиом полости рта может быть как инструментом, так и мишенью для лечения заболеваний.Было показано, что коммерчески доступные пробиотики, которые содержат живые штаммы из родов бактерий, таких как Bifidobacterium, Lactobacillus и Streptococcus, способствуют большему альфа-разнообразию в микробиоме полости рта, хотя и не вызывают крупномасштабных или постоянных изменений в его составе [154]. Как упоминалось в предыдущем разделе, Lactobacillus, в частности, является распространенным и эффективным пробиотиком в контексте микробиома кишечника, но он был связан с кариесом зубов и косвенно с CRC.Однако также возможно, что этот эффект зависит от контекста окружающей среды, как обсуждалось выше в случае Streptococcus oralis при муковисцидозе или лептотрихии при раке поджелудочной железы. Таким образом, Lactobacillus без условий окружающей среды, подходящих для кариеса, может вместо этого способствовать увеличению альфа-разнообразия и улучшению здоровья полости рта. Это еще один случай предварительных результатов с интересным потенциалом, который требует более глубокого лонгитюдного изучения. Были предложены механизмы благотворного воздействия других потенциальных пробиотиков, чтобы противодействовать прогрессированию заболеваний пародонта и кариеса, включая штаммы Streptococcus salivarius, которые были показано, что он подавляет воспалительные реакции и стимулирует полезные пути, такие как реакции интерферона типа I и II [168].Другими потенциальными пробиотиками для этого использования являются Streptococcus dentisani [169] и Streptococcus A12 [170], которые могут сглаживать кислый pH, образующийся в кариесогенных биопленках посредством метаболизма аргинина. Вид Proteobacteria Bdellovibrio bacteriovorus был предложен в качестве инструмента для потенциального воздействия на пародонтальные патогены [171]. Он питается грамотрицательными бактериями, вторгаясь в них, что в конечном итоге приводит к лизису его добычи. Эксперименты ex vivo со слюной и поддесневым налетом показали, что B. bacteriovorus способен атаковать два важных оральных патогена, Fusobacterium nucleatum и Aggregatibacter actinomycetemcomitans, хотя и не определенные другие желательные мишени, и не является специфичным только для этих мишеней.Пути и продукты микробиоты полости рта также могут быть мишенями для лечения. Было показано, что провоспалительный цитокин IL-17 наиболее сильно активируется у пациентов с диабетом и связан с пародонтитом, в то время как лечение антителами против IL-17 способно смягчить этот эффект [172]. При болезни Альцгеймера ингибиторы протеаз гингипаина, секретируемых Porphyromonas gingivalis, были способны снижать инфекцию этого вида в головном мозге, а также продукцию β-амилоида и нейровоспаление [40].Еще многое предстоит узнать о функциональности микробиома полости рта и его потенциальной реакции на лечение. Один пример связан с предубеждением «СТРАННОЕ», из-за которого многие люди в мире остались за рамками этой области исследований. Исследование «не контактировавших» индейцев в венесуэльской Амазонии, изолированного сообщества, не подвергавшегося воздействию антибиотиков, выявило бактерии, несущие гены функциональной устойчивости к антибиотикам (AR) [45]. Авторы предполагают, что «гены AR, вероятно, готовы к мобилизации и обогащению при воздействии фармакологических уровней антибиотиков».Авторы подчеркивают необходимость характеристики отдаленных популяций «до того, как глобализация современных практик затронет потенциально полезные бактерии, обитающие в организме человека». Таким образом, контекст исследований микробиома должен продолжать расширяться, прежде чем мы сможем найти оптимальные подходы к лечению.

    9. Выводы и перспективы на будущее

    Улучшения в методах секвенирования и стоимости продолжают продвигать область исследований микробиома, позволяя использовать более масштабные подходы и более широкое понимание его структуры и функций.Однако за последнее десятилетие или около того большая часть исследований была исследовательской, и многие исследователи использовали свои собственные подходы к проведению экспериментов и анализов по мере изучения возможностей и ограничений этих новых методов. В результате, результаты в этой области, несомненно, пронизаны некоторой технической предвзятостью. По мере того, как мы начинаем понимать, что показывают нам эксперименты NGS, и по мере разработки новых подходов мы должны стремиться к стандартизированным методам, которые позволят проводить надежное сравнение данных с минимальной погрешностью.То же самое относится к дизайну исследования и методам сбора образцов, как было предложено [113]. Микробиом полости рта особенно выиграет от конкретных методологий, обеспечивающих надлежащий контекст для данного исследования, потому что, в зависимости от цели исследования, результаты могут зависеть от конкретных ниш в этой среде обитания. Текущие данные позволяют сделать по крайней мере некоторые предварительные обобщения о Структура микробиома полости рта. Несмотря на аргументы в пользу сосредоточения внимания на градиентах численности в выборках популяции и против опоры на стоматотипы (или другие соответствующие группы образцов микробиома), стоматотипы позволяют исследователям получить широкую перспективу и могут помочь в дальнейшем анализе.Обсуждаемые выше стоматотипы Neisseria/Haemophilus и Prevotella/Veillonella могут представлять собой относительно здоровые организмы, в то время как другие обнаруженные стоматотипы, имеющие тенденцию к менее последовательному составу, могут свидетельствовать о дисбактериозе. Роды-драйверы первых двух стоматотипов часто связаны со здоровьем, в то время как роды-драйверы других описанных стоматотипов часто связаны с болезнями, такими как Porphyromonas, Rothia и некоторые виды Streptococcus.Конечно, есть исключения, такие как связи, о которых сообщалось между периодонтитом и Prevotella [18] или между кариесом зубов и Neisseria [22], хотя, чтобы уточнить это утверждение, как упоминалось выше, могут быть изменения в обилии многие таксоны в результате болезненного состояния, а не как причина болезни. Таким образом, как в случае Prevotella при пародонтите или Neisseria при кариесе зубов, эти таксоны могут просто стать условно-патогенными в среде, созданной болезнью (Neisseria может просто воспользоваться «поглотителем водорода», созданным архейными метаногенами и/или Treponema). видов, так как его виды склонны к ацидогенности [173]), и, следовательно, их все же можно считать связанными с общим здоровьем полости рта.Пародонтит и кариес зубов являются тщательно изученными заболеваниями, но при поиске связей между микробиомом и любым заболеванием важно тщательно изучить механизмы прогрессирования заболевания, прежде чем называть какой-либо конкретный организм возбудителем. Таблицы 1 и 2, представленные в этом обзоре, в которых перечислены связанные таксоны, следует воспринимать просто так: список потенциальных ассоциаций, подлежащих дальнейшему изучению. Как подчеркивалось на протяжении всего этого обзора, наши современные концепции микробиома полости рта в значительной степени предвзяты. к образу жизни в «СТРАННЫХ» странах (западных, образованных, промышленно развитых, богатых и демократических) [46], так как большинство исследователей и изучаемых выборок происходят из этих групп населения.Несколько упомянутых здесь исследований, в которых использовались незападные образцы, подчеркивают пробелы в наших текущих знаниях о потенциальных составах и структурах микробиома полости рта [44] и его функциональности в определенных контекстах [45]. По мере того, как исследователи интегрируют в эту область более разнообразные популяции (а также расширяют фокус, чтобы включить другие области жизни, присутствующие в микробиоме), они смогут постоянно генерировать более обширные базы данных таксономии и функций, связанных с ротовой полостью человека, что позволит получить больше информации. комплексные исследования.

    Ротовая полость тесно связана с остальными частями тела и оказывает сильное влияние на многие процессы в организме. Дисбиоз в микробиоме полости рта явно связан с рядом местных и системных заболеваний, хотя некоторые из конкретных ассоциаций и механизмов действия остаются предположительными в ожидании дальнейшего изучения. Некоторые из обсуждаемых здесь примеров лечения кажутся простыми, даже несмотря на необходимость более глубокой проверки эффективности.Тем не менее, микробиом человека представляет собой многомерную взаимосвязанную микробиосферу, и возмущения могут иметь пока еще непредвиденные последствия, будь то незамеченные в краткосрочной перспективе или неопределимые в долгосрочной перспективе без соответствующего дизайна исследования. Мы уже упоминали примеры, когда неродственные организмы могут заполнять одни и те же функциональные ниши (см. выше обсуждение трепонем и видов метаногенных архей, действующих как поглотители водорода при пародонтите), и их конкуренция может быть связана с заболеванием.Исследования микробиома далеки от завершения, и без глубокого понимания его природы мы должны проявлять осторожность и терпение, прежде чем широко использовать его медицинский потенциал. Это потребует еще многих крупномасштабных и лонгитюдных исследований, большего внимания к функциональному компоненту микробиома и более четкой характеристики различных структур каждого микробиома тела в разных контекстах, часть которых будет заключаться в борьбе с предубеждением WEIRD.