Содержание

Линкомицин инструкция по применению: показания, противопоказания, побочное действие – описание Lincomycin р-р д/в/в и в/м введения 300 мг/1 мл: амп. 5 или 10 шт. (5213)

💊 Состав препарата Линкомицин

✅ Применение препарата Линкомицин


Сохраните у себя

Поделиться с друзьями

Пожалуйста, заполните поля e-mail адресов и убедитесь в их правильности

Описание активных компонентов препарата Линкомицин (Lincomycin)

Приведенная научная информация является обобщающей и не может быть использована для принятия решения о возможности применения конкретного лекарственного препарата.

Дата обновления: 2021.05.27

Владелец регистрационного удостоверения:

Лекарственная форма


Линкомицин

Р-р д/в/в и в/м введения 300 мг/1 мл: амп. 5 или 10 шт.

рег. №: Р N001054/01 от 24.12.07 — Бессрочно

Форма выпуска, упаковка и состав препарата Линкомицин


Раствор для в/в и в/м введения1 мл
линкомицин (в форме гидрохлорида моногидрата)300 мг

1 мл — ампулы (5) — пачки картонные.
1 мл — ампулы (10) — пачки картонные.

Фармакологическое действие

Антибиотик группы линкозамидов. В терапевтических дозах действует бактериостатически. При более высоких концентрациях оказывает бактерицидное действие. Подавляет белковый синтез бактерий вследствие обратимого связывания с 50S-субъединицей рибосом, нарушает образование пептидных связей.

Активен в отношении Staphylococcus aureus (пенициллиназа-продуцирующие и непродуцирующие штаммы), Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus группы viridans, Corynebacterium diphtheria, Propionibacterium acnes, Clostridium tetani, Clostridium perfringens.

Эффективен в отношении Staphylococcus spp., устойчивых к пенициллину, тетрациклину, хлорамфениколу, стрептомицину, цефалоспоринам (30% Staphylococcus spp., устойчивых к эритромицину, имеют перекрестную устойчивость к линкомицину).

К линкомицину устойчивы Enterococcus spp. (в т.ч. Enterococcus faecalis), Neisseria gonorrhoeae, Neisseria meningitidis, Haemophilus influenzae и другие грамотрицательные бактерии, а также грибы, вирусы и простейшие.

Оптимум действия находится в щелочной среде (pH 8-8.5). Устойчивость к линкомицину развивается медленно. В высоких дозах обладает бактерицидным эффектом.

Существует перекрестная резистентность между линкомицином и клиндамицином.

Фармакокинетика

При однократном в/м введении в дозе 600 мг Cmax в плазме крови достигается через 30 мин. При 120-минутном в/в введении 600 мг лекарственного средства терапевтическая концентрация сохраняется в течение 14 ч. Хорошо проникает в ткани легких, печени, почек, через плацентарный барьер, в грудное молоко; в высоких концентрациях обнаруживается в костной ткани и суставах. Частично метаболизируется в печени. Т1/2 — 5 ч. Выводится в неизмененном виде и в виде метаболитов с желчью и мочой.

При почечной недостаточности (терминальная стадия) Т1/2 равен 10-20 ч, при нарушениях функции печени — 8-12 ч.

Показания активных веществ препарата Линкомицин

Бактериальные инфекции, вызванные чувствительными к линкомицину микроорганизмами (прежде всего Staphylococcus spp. и Streptococcus spp., особенно микроорганизмами, устойчивыми к пенициллинам, а также при аллергии к пенициллинам): сепсис, подострый септический эндокардит, абсцесс легкого, эмпиема плевры, плеврит, отит, остеомиелит (острый и хронический), гнойный артрит, послеоперационные гнойные осложнения, раневая инфекция, инфекции кожи и мягких тканей (пиодермия, фурункулез, флегмона, рожа).

Режим дозирования

Способ применения и режим дозирования конкретного препарата зависят от его формы выпуска и других факторов. Оптимальный режим дозирования определяет врач. Следует строго соблюдать соответствие используемой лекарственной формы конкретного препарата показаниям к применению и режиму дозирования.

Вводят в/м или в/в. Разовая для взрослых — 0.6 г, суточная доза — 1.8 г; у детей суточная доза составляет 10-20 мг/кг. Продолжительность лечения в зависимости от формы и тяжести заболевания составляет 7-14 дней (при остеомиелите — 3 недели и более).

Побочное действие

Со стороны пищеварительной системы: тошнота, рвота, диарея, боль в животе, зуд ануса, глоссит, стоматит, желтуха, транзиторная гипербилирубинемия, повышение активности печеночных трансаминаз; при длительном применении — кандидоз ЖКТ, псевдомембранозный колит.

Со стороны системы кроветворения: обратимые лейкопения, тромбоцитопеническая пурпура, нейтропения, агранулотицоз, апластическая анемия и панцитопения.

Аллергические реакции: зуд, крапивница, сыпь, эксфолиативный дерматит, везикуло-буллезный дерматит, ангионевротический отек, анафилактический шок, многоформная эритема, синдром Стивенса-Джонсона, сывороточная болезнь.

Со стороны мочеполовой системы: нарушение функции почек (азотемия, олигурия, протеинурия), вагинит.

Со стороны органов чувств: шум в ушах, вертиго.

Местные реакции: при в/в введении — тромбофлебит, при в/м введении — местное раздражение, болезненность, образование уплотнения и стерильного абсцесса в месте инъекции.

При быстром в/в введении:

снижение АД, головокружение, головная боль, сонливость, общая слабость, расслабление скелетной мускулатуры, остановка дыхания, остановка сердца.

Противопоказания к применению

Повышенная чувствительность к линкомицину и клиндамицину; тяжелая печеночная и/или почечная недостаточность; беременность (за исключением случаев, когда это необходимо по жизненным показаниям), период грудного вскармливания; новорожденные (до 1 месяца).

С осторожностью

Грибковые заболевания кожи, слизистой оболочки полости рта; влагалища; миастения; одновременное применение с лекарственными препаратами, блокирующими нервно-мышечную проводимость; сахарный диабет; печеночная/почечная недостаточность средней степени тяжести; заболевания ЖКТ, особенно колиты, в анамнезе.

Применение при беременности и кормлении грудью

Противопоказано применять во время беременности (за исключением случаев, когда это необходимо по жизненным показаниям) и в период грудного вскармливания.

Применение при нарушениях функции печени

Противопоказано применение при тяжелой печеночной недостаточности. С осторожностью следует применять у пациентов с печеночной недостаточностью средней степени тяжести.

Применение при нарушениях функции почек

Противопоказано применение при тяжелой почечной недостаточности. С осторожностью следует применять у пациентов с почечной недостаточностью средней степени тяжести.

Применение у детей

Противопоказано применение у новорожденных (до 1 месяца).

Применение у пожилых пациентов

Фармакокинетика у лиц пожилого возраста с нормальной функцией печени и почек соответствует фармакокинетике взрослых пациентов.

Особые указания

Во избежание развития асептического некроза вводить предпочтительно глубоко в/м. Нельзя вводить в/в без предварительного разведения.

На фоне длительного лечения необходим периодический контроль активности печеночных трансаминаз и функции почек. При выявлении нарушений следует рассмотреть возможность отмены препарата.

Назначение пациентам с печеночной недостаточностью допустимо лишь по жизненным показаниям.

Т1/2 линкомицина может быть увеличен у пациентов с нарушениями функции печени и почек, поэтому следует соблюдать осторожность при назначении линкомицина пациентам с печеночной/почечной недостаточностью средней степени тяжести и контролировать концентрацию линкомицина в крови во время терапии высокими дозами линкомицина. У таких пациентов следует рассмотреть возможность уменьшения частоты введения препарата.

Сообщалось о случаях псевдомембранозного колита, развившегося спустя 2 месяца после приема антибактериальных препаратов. При появлении признаков псевдомембранозного колита в легких случаях достаточно отмены препарата и назначения ионообменных смол, в тяжелых случаях показано возмещение потери жидкости, электролитов и белка, назначение ванкомицина или бацитрацина. Противопоказано применение препаратов, тормозящих перистальтику кишечника.

Линкомицин не показан для терапии менингита, поскольку его концентрация в спинномозговой жидкости недостаточна для лечения менингита.

Не рекомендуется применять линкомицин у пациентов с сахарным диабетом за исключением случаев отсутствия альтернативного лечения, поскольку отсутствуют адекватные данные о терапии пациентов с эндокринными или метаболическими заболеваниями.

При применении линкомицина, особенно длительном, возможно развитие вторичной инфекции, связанной с ростом устойчивых к препарату микроорганизмов (особенно грибов), для исключения и подтверждения которой следует проводить повторную оценку состояния пациента. Если во время терапии возникает вторичная инфекция, следует принять необходимые меры по ее лечению.

Линкомицин следует применять с осторожностью у пациентов с имеющимися грибковыми заболеваниями, таким пациентам следует также назначать противогрибковую терапию.

При применении линкомицина сообщалось о развитии тяжелых буллезных реакций, таких как синдром Стивенса-Джонсона, токсический эпидермальный некролиз. Пациентов следует информировать о том, что при развитии кожных реакций и/или поражении слизистых оболочек необходимо немедленно проконсультироваться у врача прежде, чем продолжать лечение линкомицином.

При применении линкомицина сообщалось о развитии реакций гиперчувствительности и аллергических реакциях (анафилактический шок и анафилактоидные реакции, которые могут прогрессировать до жизнеугрожающего состояния). В этих случаях следует прекратить применение линкомицина и начать проведение соответствующего лечения.

Линкомицин характеризуется блокирующей нервно-мышечное проведение активностью и может усиливать мышечную слабость у пациентов с псевдопаралитической миастенией. Применение линкомицина у пациентов с установленным диагнозом псевдопаралитической миастении не рекомендуется.

Сообщалось о случаях развития нейтропении и/или лейкопении на фоне лечения линкомицином, поэтому во время терапии рекомендуется периодический контроль анализа крови.

Влияние на способность к управлению транспортными средствами и механизмами

При применении линкомицина нельзя исключить вероятность появления головокружения и расслабления скелетной мускулатуры, поэтому вождение автотранспорта и другие виды деятельности, требующие повышенного внимания и скорости реакции, не рекомендуются.

Лекарственное взаимодействие

Фармацевтически несовместим с канамицином, ампициллином, барбитуратами, теофиллином, кальция глюконатом, гепарином и магния сульфатом.

При одновременном применении с эритромицином, пенициллинами, цефалоспоринами, хлорамфениколом, ампициллином и другими бактерицидными антибиотиками возможен антагонизм противомикробного действия.

При одновременном применении с аминогликозидами возможен синергизм действия.

В исследованиях in vitro наблюдался антагонизм между линкомицином и эритромицином. Из-за возможной клинической значимости не следует применять эти лекарственные средства одновременно.

Противодиарейные средства снижают эффект линкомицина (интервал между их применением должен составлять не менее 4 ч).

Усиливает действие лекарственных средств для ингаляционного наркоза, миорелаксантов и опиоидных анальгетиков, повышая риск нервно-мышечной блокады и остановки дыхания.

При одновременном применении теофиллина с линкомицином, ингибиторами изоферментов цитохрома Р450, эффективность теофиллина может увеличиваться, что может потребовать снижения его дозы.


Сохраните у себя

Поделиться с друзьями

Пожалуйста, заполните поля e-mail адресов и убедитесь в их правильности

Линкомицин — описание вещества, фармакология, применение, противопоказания, формула

Содержание

Структурная формула

Русское название

Линкомицин

Английское название

Lincomycin

Латинское название вещества Линкомицин

Lincomycinum (род. Lincomycini)

Брутто формула

C18H34N2O6S

Фармакологическая группа вещества Линкомицин

Характеристика

Антибиотик группы линкомицинов (линкозамидов), продуцируемый Streptomyces lincolnensis или другими родственными актиномицетами. Белый или почти белый кристаллический порошок горького вкуса. Легко растворим в воде, трудно — в спирте.

Фармакологическое действие

Фармакологическое действие антибактериальное.

Фармакология

Подавляет белковый синтез бактерий вследствие обратимого связывания с 50S субъединицей рибосом, нарушает образование пептидных связей. Эффективен в отношении грамположительных микроорганизмов (Staphylococcus spp., Streptococcus spp., в т.ч. Streptococcus pneumoniae, Corynebacterium diphtheriae), некоторых анаэробных спорообразующих бактерий (Clostridium spp.) и грамотрицательных анаэробов (Bacteroides spp., Mycoplasma spp.). Действует на микроорганизмы (особенно Staphylococcus spp.), устойчивые к другим антибиотикам. Не чувствительны к линкомицину Enterococcus spp. (в т.ч. Enterococcus faecalis), грамотрицательные микроорганизмы, грибы, вирусы, простейшие. Уступает по активности эритромицину в отношении спорообразующих анаэробов, Neisseria spp., Corynebacterium spp. Резистентность развивается медленно. Между линкомицином и клиндамицином существует перекрестная резистентность. В терапевтических дозах оказывает бактериостатическое действие, в более высоких и в отношении высокочувствительных микроорганизмов — бактерицидное.

При приеме внутрь на пустой желудок всасывается примерно 20–30% дозы (прием пищи значительно снижает всасывание, биодоступность при приеме после еды — 5% ), Cmax в крови достигается через 2–4 ч. Хорошо и быстро распределяется в большинство тканей и жидкостей организма (кроме спинно-мозговой жидкости), высокие концентрации создаются в желчи и костной ткани. Плохо проходит через ГЭБ. Быстро проходит через плаценту, концентрации в сыворотке крови плода составляют 25% от концентрации в крови матери. Проникает в грудное молоко. Метаболизируется в печени. T1/2 при нормальной функции почек — 4–6 ч, при заболевании почек в терминальной стадии — 10–20 ч, при нарушении функции печени T1/2 увеличивается в 2 раза. Выводится в неизмененном виде и в виде метаболитов с желчью и почками. При приеме внутрь 30–40% дозы выводится в неизмененном виде с фекалиями в течение 72 ч. Гемодиализ и перитонеальный диализ не эффективны для удаления линкомицина из организма.

Применение вещества Линкомицин

Инфекционно-воспалительные заболевания тяжелого течения, вызванные чувствительными микроорганизмами (прежде всего стафилококками и стрептококками, особенно микроорганизмами, устойчивыми к пенициллинам, а также при аллергии к пенициллинам): инфекции нижних дыхательных путей (в т.ч. аспирационная пневмония, абсцесс легкого, эмпиема плевры), отит, инфекции костей и суставов (острый и хронический остеомиелит, гнойный артрит), гнойные инфекции кожи и мягких тканей (пиодермия, фурункулез, флегмона, рожистое воспаление, раневая инфекция).

Противопоказания

Гиперчувствительность, тяжелая печеночная и/или почечная недостаточность, ранний грудной возраст (до 1 мес).

Ограничения к применению

Грибковые заболевания кожи, слизистых оболочек полости рта, влагалища; миастения (для парентерального введения, дополнительно).

Применение при беременности и кормлении грудью

Противопоказано при беременности (за исключением случаев, когда это необходимо по жизненным показаниям).

Категория действия на плод по FDA — C.

На время лечения следует прекратить грудное вскармливание.

Побочные действия вещества Линкомицин

Со стороны органов ЖКТ: тошнота, рвота, диарея, боль в животе, глоссит, стоматит, транзиторная гипербилирубинемия, повышение активности печеночных трансаминаз; при длительном применении — кандидоз ЖКТ, антибиотикоассоциированная диарея, псевдомембранозный энтероколит.

Со стороны органов кроветворения: обратимая лейкопения, тромбоцитопения, нейтропения.

Аллергические реакции: крапивница, эксфолиативный дерматит, ангионевротический отек, анафилактический шок.

Прочие: местные реакции при в/в введении — флебит; при быстром в/в введении — снижение АД, головокружение, астения, расслабление скелетной мускулатуры.

Взаимодействие

Возможен антагонизм при одновременном применении с эритромицином, хлорамфениколом, ампициллином и другими бактерицидными антибиотиками, синергизм — с аминогликозидами. Противодиарейные ЛС снижают эффект линкомицина (интервал между их применением должен составлять не менее 4 ч). Усиливает действие ЛС для ингаляционного наркоза, миорелаксантов и опиоидных анальгетиков, повышая риск нервно-мышечной блокады и остановки дыхания. Фармацевтически несовместим с канамицином.

Способ применения и дозы

Внутрь, в/в, в/м, местно. Режим дозирования определяется индивидуально в зависимости от показаний. Взрослым, разовая доза при приеме внутрь — 0,5 г, суточная — 1,5–2 г, при парентеральном введении разовая доза — 0,6 г, суточная — 1,8 г (может быть увеличена до 2,4 г в 3 введения с интервалом 8 ч). Детям в возрасте от 1 мес до 14 лет внутрь — в суточной дозе 30–60 мг/кг массы тела (в 2–3 приема с интервалом 8–12 ч), парентерально — 10–20 мг/кг/сут вне зависимости от возраста. При почечной и/или печеночной недостаточности при парентеральном введении суточная доза не должна превышать 1,8 г, интервал между введениями — 12 ч.

При местном применении наносят в виде тонкого слоя на пораженные участки кожи 2–3 раза в сутки.

Меры предосторожности

Не следует комбинировать с миорелаксантами. При тяжелых инфекциях линкомицин сочетают с аминогликозидами или другими антибиотиками, действующими на грамотрицательные бактерии. Назначение пациентам с печеночной недостаточностью допустимо лишь по жизненным показаниям. При длительном применении необходим систематический контроль функции почек и печени. В случае развития псевдомембранозного колита прием прекращают и назначают ванкомицин или бацитрацин. Следует избегать быстрого в/в введения. При местном применении следует соблюдать осторожность при дерматомикозах.

Торговые названия с действующим веществом Линкомицин

Линкомицин — инструкция по применению

Инструкция по применению раствора Линкомицина 10%
для лечения болезней бактериальной этиологии у животных
(организация-разработчик: ЗАО «Мосагроген», г. Москва)

I. Общие сведения
Торговое наименование лекарственного препарата: Линкомицин 10% раствор (Lyncomycini 10% solutio).
Международное непатентованное наименование: линкомицин.

Лекарственная форма: раствор для инъекций.
Линкомицин 10% раствор в 1 мл в качестве действующего вещества содержит линкомицина — 100 мг, а в качестве вспомогательных компонентов: трилон Б — 0,1 мг, нипагин — 1,0 мг, а также воду для инъекций до 1 мл.
По внешнему виду препарат представляет собой прозрачную бесцветную или слегка желтоватого цвета жидкость.

Выпускают Линкомицин 10% расфасованным по 10, 20 и 100 мл в стеклянные флаконы соответствующей вместимости, укупоренные резиновыми пробками, укрепленными алюминиевыми колпачками.

Хранят лекарственный препарат в закрытой упаковке производителя в сухом, защищенном от прямых солнечных лучей месте, отдельно от продуктов питания и кормов, при температуре от 5°С до 25°С.
Срок годности лекарственного препарата при соблюдении условий хранения — 2 года с даты производства.
После вскрытия флакона неиспользованные остатки препарата хранению не подлежат.
Запрещается использование препарата после окончания срока его годности.
Линкомицин следует хранить в недоступном для детей месте.
Неиспользованный лекарственный препарат утилизируют в соответствии с требованиями законодательства.

II. Фармакологические свойства
Линкомицин 10 % раствор относится к антибактериальным препаратам группы линкозамидов. Линкомицин проявляет наибольшую активность в отношений большинства грамположительных микроорганизмов, в том числе стафилококков, стрептококков, пневмококков, клостридий, коринобактерий, а также микоплазм. Активен в отношении микроорганизмов, особенно стафилококков, устойчивых к другим антибиотикам. Устойчивость микроорганизмов к линкомицину вырабатывается медленно.
На грамотрицательные бактерии, грибы и вирусы линкомицин не действует.
Механизм действия связан с подавлением синтеза белка в микробных клетках.
Максимальная концентрация антибиотика в крови достигается через 20-40 минут после инъекции. Терапевтическая концентрация сохраняется на протяжении 16-24 часов. Линкомицин быстро и хорошо всасывается из места инъекции и проникает во все органы и ткани организма, в том числе и костную ткань. Линкомицин не подвергается биотрансформации в организме и выделяется преимущественно в неизмененном виде с мочой и желчью.

Линкомицин 10% раствор по степени воздействия на организм относится к умеренно опасным веществам (3 класс опасности по ГОСТ 12.1.007-76).

III. Порядок применения
Линкомицин 10% применяют свиньям, телятам, собакам и кошкам для лечения респираторных заболеваний, актиномикозов, остеомиелитов и других заболеваний, вызванных чувствительными к антибиотику микроорганизмами.

Препарат показан для лечения энзоотической пневмонии и дизентерии свиней а также при лечении бактериальных артритов свиней, вызванных Staphylococcus spp., Streptococcus spp., и Mycoplasma spp..

Противопоказанием для применения препарата является индивидуальная повышенная чувствительность животных к линкомицину.

Раствор вводят внутримышечно или внутривенно (медленно) один раз в сутки в следующих дозах:

Вид животных Способ введения Доза, мл/10 кг Срок лечения, дней
Свиньи внутримышечно 1 3-7
Телята внутримышечно 1 2-4
Собаки внутримышечно 2 3-7
внутривенно 1 3-7
Кошки внутримышечно 2 3-7
внутривенно 1 3-7

 

Симптомы передозировки у животных не выявлены.
Особенностей действия лекарственного препарата при его первом применении и при его отмене не установлено.
При случайном увеличении интервала между двумя введениями препарата, его следует ввести как можно скорее в предусмотренной дозировке.
При применении Линкомицина 10% в соответствии с настоящей инструкцией побочных явлений и осложнений у животных, как правило, не наблюдается.

Не допускается применение Линкомицина животным с развитым рубцовым пищеварением в возрасте старше 6 месяцев.

Не рекомендуется применять лекарственный препарат одновременно с тиамфениколом и хлорамфениколом.

Убой телят и свиней на мясо разрешается не ранее, чем через 3 суток после последнего применения препарата.
Мясо животных, вынужденно убитых до истечения указанного срока, может быть использовано для кормления пушных зверей.

IV. Меры личной профилактики
При работе с Линкомицином 10% следует соблюдать общие правила личной гигиены и техники безопасности, предусмотренные при работе с лекарственными препаратами. По окончании работы руки следует вымыть теплой водой с мылом.
При случайном контакте лекарственного препарата с кожей или слизистыми оболочками глаза, их необходимо промыть большим количеством воды. Людям с гиперчувствительностью к компонентам препарата следует избегать прямого контакта с раствором. В случае появления аллергических реакций или при случайном попадании препарата в организм человека следует немедленно обратиться в медицинское учреждение (при себе иметь инструкцию по применению препарата или этикетку).

Пустые флаконы из-под лекарственного препарата запрещается использовать для бытовых целей, они подлежат утилизации с бытовыми отходами.

Организация-производитель: ЗАО «Мосагроген»; 117545, г. Москва, 1-ый Дорожный проезд, д. 1.

С утверждением настоящей Инструкции утрачивает силу Инструкция по применению Линкомицина 10%. раствора для лечения животных при болезнях бактериальной этиологии, утвержденная Россельхознадзором 06.12.2005 г.

Линкомицин 10%, 100 мл. Ветеринарная аптека HorseVet.

СОСТАВ И ФОРМА ВЫПУСКА
Линкомицин 10% инъекционный раствор, в 1 мл которого содержится 100 мг линкомицина гидрохлорид моногидрат, вспомогательные вещества и вода для инъекций. Представляет собой прозрачную, бесцветную или слегка желтоватого цвета жидкость с рН от 3,0 до 6,0. Расфасовывают во флаконы по 10 и 100 мл.

ФАРМАКОЛОГИЧЕСКИЕ СВОЙСТВА
Линкомицин — антибиотик, продуцируемый Streptomyces lincolniensis или другими родственными актиномицетами. Линкомицин сходен по антибактериальному действию с антибиотиками группы макролидов, хотя отличается от них химической структурой. Линкомицин обладает противомикробным действием в отношении большинства грамположительных микроорганизмов, в том числе стафилококков, стрептококков, пневмококков, клостридий, коринебактерий, а также микоплазм. Активен в отношении микроорганизмов, особенно стафилококков, устойчивых к другим антибиотикам. На грамотрицательные бактерии, грибы и вирусы не действует. Механизм действия связан с подавлением синтеза белка микробных клеток. Максимальная концентрация антибиотика в крови достигается через 20-40 минут после инъекции и сохраняется на протяжении 3-6 часов, а терапевтическая концентрация — на протяжении 24 часов. Линкомицин быстро и хорошо всасывается из места инъекции и проникает во все органы и ткани организма, в том числе и костную ткань. Линкомицин не подвергается биотрансформации в организме и выделяется в основном в неизменном виде с мочой и желчью.

ПОКАЗАНИЯ
Дизентерия и рожа свиней. Энзоотическая пневмония, актиномикоз, септицемия, инфекционные полиартриты, абсцессы, отиты, гнойные дерматиты, заболевания дыхательных путей и другие болезни, вызванные чувствительными к линкомицину микроорганизмами, особенно при инфекциях, вызванных микроорганизмами, устойчивыми к пенициллинам и другим антибиотикам у свиней, телят, собак и кошек.

ДОЗЫ И СПОСОБ ПРИМЕНЕНИЯ
Препарат применяют внутримышечно и внутривенно (при внутривенном введении раствор вводят капельно) один раз в сутки в следующих дозах:
Животные
Путь введения
Доза (мл/10 кг)
Срок лечения (дней)
Свиньи
внутримышечно
1-2
3-7
Телята
внутримышечно
1
2-4
Собаки
внутримышечно
2
3-7
внутривенно
1
3-7
Кошки
внутримышечно
2
3-7

ПОБОЧНЫЕ ДЕЙСТВИЯ
В отдельных случаях возможны аллергические реакции, лейкопения, тромбоцитопения. При длительном применении могут возникать кандидозы. Завышенные дозы у поросят иногда приводят к поносам. При быстром внутривенном введении — понижение артериального давления, общая слабость, расслабление скелетной мускулатуры.

ПРОТИВОПОКАЗАНИЯ
Препарат противопоказан при индивидуальной повышенной чувствительности к линкомицину, беременным, лактирующим, а также животным с тяжелыми заболеваниями печени и почек. Не допускается применение линкомицина животным с развитым рубцовым пищеварением (взрослый крупный и мелкий рогатый скот).

ОСОБЫЕ УКАЗАНИЯ
Убой животных на мясо разрешается через трое суток после последнего применения препарата. Мясо животных, вынужденно убитых до истечения указанного срока, может быть использовано для кормления пушных зверей или для производства мясо-костной муки.

УСЛОВИЯ ХРАНЕНИЯ
Список Б. В закрытой упаковке производителя, в сухом, защищенном от прямых солнечных лучей, недоступном для детей и животных месте, отдельно от пищевых продуктов и кормов при температуре 4-25 °С. Срок годности препарата — 3 года со дня изготовления.

Производитель : Россия

Линдоксин 100 — жидкий комбинированный антибактериальный препарат (доксициклин+линкомицин) для лечения и профилактики заболеваний у сельскохозяйственной птицы (колибактериоз, сальмонеллез, некротический энтерит, микоплазмоз)

ЛИНДОКСИН 100
раствор для орального применения

В 1 мл содержится: 100 мг доксициклина гиклата и 100 мг линкомицина гидрохлорида, вспомогательные вещества и растворитель.

инструкция по применению

 

Препарат назначают: 
Эффективен для лечения с/х птицы при колибактериозе, сальмонеллезе, некротическом энтерите, микоплазмозе, пастереллезе, других заболеваниях, вызванных микроорганизмами, чувствительными к компонентам препарата.

Спектр действия: 
Комбинация доксициклина и линкомицина, входящих в состав препарата, обладает широким спектром антибактериального действия в отношении большинства грамположительных и грамотрицательных микроорганизмов, в том числе: Staphylococcus spp. (включая продуцирующих пенициллиназу), Streptococcus spp., Listeria monocytogenes, Corynebacterium spp., Clostridium spp., Escherichia coli, Salmonella spp., Bacteroides spp., Enterobacter spp., Pasterella spp., Klebsiella spp., а также в отношении Spirochetes spp., Mycoplasma spp., Treponema spp., Rickettsia spp., Chlamydia psittaci.

Применение    
Препарат применяют из расчета суточного потребления воды в течение 3–5 дней, в дозах: 
Сельскохозяйственной птице: 1 л на 1 т питьевой воды.  
В период лечения птица должна получать только воду, содержащую препарат. Приготовленный раствор препарата необходимо использовать в течение 24 ч.

Период ожидания   
Мясо птицы — 7 суток

Форма выпуска    
Полимерная упаковка по 1 л.


Срок годности    
1 год от даты изготовления.

Условия хранения    
Хранить в сухом, защищенном от света месте при температуре от + 5°С до + 25°С.

Линкомицин — это… Что такое Линкомицин?

Линкомицин — антибиотик группы линкозамидов.

Фармакологическое действие

В терапевтических дозах действует бактериостатически. При более высоких концентрациях оказывает бактерицидное действие. Подавляет синтез белка в микробной клетке. Активен преимущественно в отношении аэробных грамположительных бактерий: Staphylococcus spp. (в том числе штаммы, продуцирующие пенициллиназу), Streptococcus spp. (в том числе Streptococcus pneumoniae /за исключением Enterococcus faecalis/), Corynebacterium diphtheriae; анаэробных бактерий Clostridium spp., Bacteroides spp. Линкомицин активен также в отношении Mycoplasma spp. К линкомицину устойчивы большинство грамотрицательных бактерий, грибы, вирусы, простейшие. Устойчивость вырабатывается медленно. Между линкомицином и клиндамицином существует перекрестная резистентность.

Фармакокинетика

После приема внутрь 30-40 % абсорбируется из ЖКТ. Приём пищи замедляет скорость и степень всасывания. Линкомицин широко распределяется в тканях (включая костную) и жидкостях организма. Проникает через плаценту. Частично метаболизируется в печени. T1/2 составляет около 5 ч. Выводится в неизменённом виде и в виде метаболитов с мочой, желчью и калом.

Показания

Инфекционно-воспалительные заболевания тяжёлого течения, вызванные чувствительными к линкомицину микроорганизмами, в том числе сепсис, остеомиелит, септический эндокардит, пневмония, абсцесс лёгкого, эмпиема плевры, раневая инфекция. В качестве антибиотика резерва при инфекциях, вызванных штаммами стафилококка и другими грамположительными микроорганизмами, резистентными к пенициллину и другим антибиотикам. Для местного применения: гнойно-воспалительные заболевания кожи.

Режим дозирования

При приёме внутрь взрослым — по 100 мг 3-4 раза/сут или в/м — по 600 мг 1-2 раза/сут. В/в капельно вводят по 600 мг в 300 мл изотонического раствора натрия хлорида или глюкозы 2-3 раза/сут. Детям в возрасте от 1 месяца до 14 лет внутрь — 30-60 мг/кг/сут; в/в капельно вводят в дозе 10-20 мг/кг каждые 8-12 ч.[1] При местном применении наносят тонким слоем на поражённые участки кожи.

Побочное действие

Со стороны пищеварительной системы: тошнота, рвота, боли в эпигастрии, диарея, глоссит, стоматит; транзиторное повышение уровня печеночных трансаминаз и билирубина в плазме крови; при длительном применении в высоких дозах возможно развитие псевдомембранозного колита. Со стороны системы кроветворения: обратимая лейкопения, нейтропения, тромбоцитопения. Аллергические реакции: крапивница, эксфолиативный дерматит, отёк Квинке, анафилактический шок. Эффекты, обусловленные химиотерапевтическим действием: кандидоз. Местные реакции: флебит (при в/в введении). При быстром в/в введении: снижение АД, головокружение, общая слабость, расслабление скелетной мускулатуры.

Противопоказания

Выраженные нарушения функции печени и/или почек, беременность, лактация, повышенная чувствительность к линкомицину и клиндамицину.

Беременность и лактация

Линкомицин проникает через плацентарный барьер, выделяется с грудным молоком. Применение при беременности противопоказано. При необходимости применения в период лактации следует решить вопрос о прекращении грудного вскармливания.

Особые указания

При нарушении функции печени и/или почек следует уменьшить разовую дозу линкомицина на 1/3 — 1/2 и увеличить интервал между введениями. При длительном применении необходим систематический контроль функций почек и печени. В случае развития псевдомембранозного колита линкомицин следует отменить и назначить ванкомицин или бацитрацин. Линкомицин в форме капсул, раствора для инъекций, мази включён в Перечень ЖНВЛС.

Лекарственное взаимодействие

При одновременном применении с пенициллинами, цефалоспоринами, хлорамфениколом или эритромицином возможен антагонизм противомикробного действия. При одновременном применении с аминогликозидами возможен синергизм действия. При одновременном применении со средствами для ингаляционного наркоза или миорелаксантами периферического действия отмечается усиление нервно-мышечной блокады, вплоть до развития апноэ. Приём противодиарейных препаратов снижает эффект линкомицина.

Фармацевтическое взаимодействие

Фармацевтически несовместим с ампициллином, барбитуратами, теофиллином, кальция глюконатом, гепарином и магния сульфатом. Линкомицин несовместим в одном шприце или капельнице с канамицином или новобиоцином.

Примечания

инструкция по применению антибиотика в капсулах и уколах

Для лечения различных заболеваний часто применяются антибиотики. Эти препараты способствуют подавлению развития живых клеток в организме. Для лечения стоматологических заболеваний часто применяют антибиотик Линкомицин. Что это за препарат и как его правильно применять, от чего он помогает?

Линкомицин и его свойства

Данный препарат выпускается в нескольких формах:

  • таблетки;
  • капсулы;
  • мазь;
  • ампулы для инъекций;
  • саморассасывающиеся пластыри.

Основным компонентом препарата является, главное, действующее вещество линкомицин. Также в составе антибиотика есть и другие вспомогательные вещества. Это противомикробное средство, принадлежащее к группе линкозамидов. Препарат оказывает бактериостатическое действие в отношении широкого спектра бактерий. Если медикамент использовать в больших дозах, он способен проявлять бактерицидные свойства.

Данный препарат проявляет механизм действия в ингибировании процесса синтеза белка в микробной клетке. Антибиотик эффективен против многих бактериальных микроорганизмов, например, при шигелле, вызывающей бактериальную дизентерию. Однако при вирусных грибковых заболеваниях он неэффективен и даже вреден, поскольку предназначен против бактерицидных инфекций.

Показания к применению

При лечении стоматологических болезней трудно обойтись без препарата Линкомицина. В ротовой полости постоянно находятся десятки видов микроорганизмов. Если организм здоров он не дает возможности им размножаться сверх меры и предупреждает воспалительные процессы. Баланс будет нарушаться при стоматологических проблемах:

  • кариес, пародонтит, стоматит — в этом случае количество микробов увеличивается, слюна не в состоянии справится с таким количеством инфекционных агентов;
  • когда инфекция распространяется, то нарушается функция тканей;
  • если происходят воспалительные процессы и есть гнойные массы, тогда количество патогенных микроорганизмов возрастает во много раз.

Чтобы справиться с ними, необходим антибиотик. После полного курса антибактериальной терапии объем бактерий начинает резко уменьшаться и приходит в норму. Слюна снова становится здоровой и способна контролировать деятельность и объем микроорганизмов.

Препарат Линкомицин эффективно помогает при многих поражениях ротовой полости и других органов:

  • для лечения ЛОР и дыхательных органов;
  • инфекционные заболевания суставов и костей, если они спровоцированы активностью чувствительных к препарату микроорганизмов;
  • болезни кожного покрова инфекционного характера, мягких тканей по причине чувствительности к медикаменту Линкомицину микроорганизмов, а также инфицированные гнойные раны, абсцессы, фурункулы, мастит, рожистые воспаления и др.

В стоматологии препарат применяют при инфекциях и гнойных процессах челюстно-лицевого аппарата. Он предупреждает инфицирование мягких тканей при вживлении имплантов.

Побочные действия и противопоказания

Если проявляется высокая чувствительность к антибиотикам группы линкозамидов, тогда применение Линкомицина недопустимо. Его нельзя принимать детям до 6 лет. Противопоказан препарат при беременности и в период лактации кормящих мам. Препарат нельзя принимать при заболеваниях печени и почек.

У некоторых пациентов применение Линкомицина способно вызвать негативные явления:

  • расслабление скелетных мышц;
  • сыпь на кожной поверхности;
  • головокружение и слабость;
  • грибковые инфекции;
  • сбои в пищеварительном тракте;
  • тромбоцитопения;
  • снижение в крови количества лейкоцитов.

При первых признаках побочных явлений после применения необходимо сразу обратиться к врачу. Специалист сможет оценить риск и скорректировать дозировку Линкомицина.

Инструкция по применению

Нельзя принимать Линкомицин без назначения врача. Дозировка препарата будет зависеть от его формы выпуска и заболевания.

В капсулах его назначают по 500 мг 3-4 раза в день с продолжительностью лечения 1-2 недели. При заболевании остеомиелитом Линкомицин принимают в таблетках на протяжении 3 недель и более. Препарат в капсулах и таблетках необходимо принимать за несколько часов до приема пищи, запивая небольшим количеством воды либо другой жидкости.

Согласно инструкции внутривенно инъекции водят по 600 мг до двух раз в сутки. Также можно принимать внутривенно Линкомицин гидрохлорида капельным путем по 600 мг несколько раз в течение суток.

Для детей от 6 лет препарат назначают с суточной дозой 30-60 мг на 1 кг массы тела ребенка. Также при необходимости можно колоть уколы детям каждые 8-12 часов с дозировкой 10-20 мг на 1 кг массы тела.

В виде мази Линкомицин наносят на кожный покров тонким слоем и непосредственно на пораженные участки тела несколько раз в день. Мазь применяется с осторожностью, особенно при грибковых поражениях кожи и дерматомикозах.

Совсем недавно появились пластыри с линкомицином — пленка Диплен Дента Л. Пленка выглядит в виде самоклеящегося и саморассасыающегося пластыря. Это отличное средство для нанесения в пораженную область слизистой оболочки. Пленка приклеивается с помощью лечебного геля к пораженной воспалением зоне. Она является эффективным средством после оперативного вмешательства в ротовой полости.

Из-за фармацевтических свойств Линкомицина его нельзя совмещать с некоторыми препаратами:

  • Канамицин;
  • Новобиоцин;
  • Кальция глюконат;
  • Гепарин;
  • Барбитурат;
  • Магния сульфат;
  • Ампициллин;
  • Теофиллин.

Пациенты всегда должны соблюдать назначенную дозировку и все правила приема препарата. Чтобы получить эффективный результат в лечении нельзя увеличивать или уменьшать самостоятельно разовую или суточную дозу лекарства.

Преимущества Линкомицина

Независимо от формы выпуска лекарственного препарата Линкомицин активно проявляет свое действие. К положительным качествам антибиотика можно отнести:

  • губительное влияние на различные виды бактерий, которые проявляют устойчивость к другим антибиотикам;
  • основное активное вещество в составе медикамента Линкомицина быстро накапливается в костной ткани. Эффективный препарат не дает распространяться на слизистой ротовой полости патогенным микроорганизмам на челюстные кости. Он устраняет все воспалительные процессы в деснах и слизистой;
  • Линкомицин имеет свойство долго сохранять свое активное действие, Очень важно, что болезнетворным микробам необходим большой промежуток времени, чтобы выработать по отношению к антибактериальному средству устойчивость.

Пациенты отмечают положительный результат после применения антибиотика Линкомицина почти сразу. Он считается одним из наиболее эффективных препаратов в лечении стоматологических заболеваний. Стоматологи часто его назначают своим пациентам, если нет противопоказаний и он не вызывает побочных эффектов.

При повышении терапевтической дозы патогенные микроорганизмы сразу погибают. Болезнетворные бактерии не успевают приспособиться к главному действующему веществу. Медикамент оказывает быстрое антимикробное действие и позволяет в короткие сроки избавиться от инфекционных заболеваний. При стоматологических болезнях помогает быстро и эффективно устранить гнойные и воспалительные процессы.

Оцените статью: Поделитесь с друзьями!

Линкомицин, клиндамицин и их применение

  • Ахаван А., Бершад С. (2003) Актуальные препараты от акне, обзор клинических свойств, системного воздействия и безопасности. Am J Clin Dermatol 4: 473–492

    PubMed Google ученый

  • Amr S, Brown MB, Martin GP, ​​Forbes B (2001) Активация клиндамицина фосфата кожей человека. J Appl Microbiol 90:550–554

    Статья КАС пабмед Google ученый

  • Bastian L, Weber S, Regel G (1997) Bacillus cereus пневмония после тяжелой травмы грудной клетки, клинический случай и обзор литературы.Анестезиолог Интенсивмед Нотфолмед Шмерцтер 32:124–129

    CAS Google ученый

  • Boselli E, Allaouchiche B (1999) Диффузия антибиотиков в костную ткань. Presse Med 28:2265–2276

    CAS пабмед Google ученый

  • Bouvet A (1996) Тяжелые инфекции, вызванные Streptococcus pyogenes (стрептококки группы А). Med Malad Infect 6:803–808

    Google ученый

  • Brook I (2002a) Клинический обзор: бактериемия, вызванная анаэробными бактериями у детей.Crit Care 6:205–211

    Статья пабмед Google ученый

  • Брук I (2002b) Профилактика и лечение сибирской язвы. Int J Antimicrob Agents 20:320–325

    Статья КАС пабмед Google ученый

  • Brook I, Frazier EH (1993) Значительное выделение неспорообразующих анаэробных палочек из клинических образцов. Clin Infect Dis 16:476–80

    CAS пабмед Google ученый

  • Bryskier A (2001) Антианаэробная активность антибактериальных средств.Экспертное заключение Invest Drugs 10:239–267

    CAS Google ученый

  • Champney WS, Tober CL (2000) Специфическое ингибирование образования 50S рибосомных субъединиц в клетках Staphylococcus aureus 16-членными макролидами, линкозамидом и антибиотиками стрептограмина B. Curr Microbiol 41:126–135

    Статья КАС пабмед Google ученый

  • Cooper AJ (1998) Систематический обзор устойчивости Propionibacterium acnes к системным антибиотикам.Med J Aust 169: 259–261

    CAS пабмед Google ученый

  • Coyle EA (2003) Борьба с бактериальной вирулентностью: роль ингибиторов синтеза белка при тяжелых инфекциях — взгляды Общества фармацевтов-инфекционистов. Фармакотерапия 23:638–642

    CAS пабмед Google ученый

  • Эпштейн М.Е., АмодиоГротон М., Садик Н.С. (1997) Противомикробные средства для дерматолога.2. Макролиды, фторхинолоны, рифамицины, тетрациклины, триметоприм-сульфаметоксазол и клиндамицин. J Am Acad Dermatol 37: 365–381

    CAS пабмед Google ученый

  • Falagas ME, Siakavellas E (2000) Bacteroides , Prevotella и Porphyromonas видов: обзор устойчивости к антибиотикам и вариантов лечения. Int J Antimicrob Agents 15:1–9

    Статья КАС пабмед Google ученый

  • Fichera ME, Bhopale MK, Roos DS (1995) Анализы in vitro объясняют специфическую кинетику действия клиндамицина против Toxoplasma gondii .Противомикробные агенты Chemother 39:1530–1537

    CAS пабмед Google ученый

  • Fishman JA (1998) Лечение инфекций, вызванных Pneumocystis carinii . Противомикробные агенты Chemother 42:1309–1314

    CAS пабмед Google ученый

  • Freeman J, Wilcox MH (1999) Антибиотики и Clostridium difficile . Microbes Infect 1:377–384

    Статья КАС пабмед Google ученый

  • Fung HB, Kirschenbaum HL (1996) Схемы лечения больных токсоплазматическим энцефалитом.Clin Ther 18:1037–1056

    Статья КАС пабмед Google ученый

  • Green M, Wald ER (1996) Возникающая устойчивость к антибиотикам: влияние на респираторные инфекции в амбулаторных условиях. Ann Allergy Asthma Immunol 77:167–173

    CAS пабмед Google ученый

  • Gross U, Pohl F (1996) Влияние противомикробных препаратов на репликацию и стадию преобразования Toxoplasma gondii .Curr Top Microbiol Immunol 219:235–245

    CAS пабмед Google ученый

  • Guay DRP (2003) Лечение бактериальных инфекций кожи и кожных покровов. Экспертное заключение Pharmacother 4:1259–1275

    Статья КАС Google ученый

  • Harms JM, Bartels H, Schlunzen F, Yonath A (2003) Антибиотики, действующие на механизм трансляции. J Cell Sci 116:1391–1393

    Статья КАС пабмед Google ученый

  • Hopkins MJ, Macfarlane GT (2003) Неперевариваемые олигосахариды повышают устойчивость к бактериальной колонизации против Clostridium difficile in vitro.Appl Environ Microbiol 69:1920–1927

    Статья КАС пабмед Google ученый

  • Jimenez-Diaz A, Reig M, Baquero F, Ballesta JP (1992) Чувствительность к антибиотикам рибосом штаммов дикого типа и устойчивых к клиндамицину Bacteroides vulgatus . J Antimicrob Chemother 30:295–301

    CAS пабмед Google ученый

  • Job ML, Jacobs NF (1997) Лекарственно-индуцированное Clostridium difficile -ассоциированное заболевание.Безопасность наркотиков 17:37–46

    CAS пабмед Google ученый

  • Като М.С., Хикосака К., Хиросе Т. (2002) Фотоинактивация и восстановление фотосистемы II в листьях Chenopodium album , выращенных при различных уровнях освещенности и доступности азота. Funct Plant Biol 29:787–795

    Статья КАС Google ученый

  • Kimura T, Horii T, Morita M, Muramatsu H, Kanno T, Maekawa M (2003) Обнаружение устойчивости к макролидам у Streptococcus pneumonie .Химиотерапия 49:56–61

    Статья КАС пабмед Google ученый

  • Кемтруп А.М., Конрад П.А. (2000) Бабезиоз человека: новое клещевое заболевание. Int J Parasitol 30:1323–1337

    Статья КАС пабмед Google ученый

  • Klastersky J, Husson M (1977) Бактерицидная активность комбинаций гентамицина с клиндамицином или хлорамфениколом против видов Escherichia coli и Bacteroides fragilis .Противомикробные агенты Chemother 12:135–138

    CAS пабмед Google ученый

  • Kucers A, Hoy JF, Lindsay Grayson M, Crowe SM (1997) Использование антибиотиков: клинический обзор антибактериальных, противогрибковых и противовирусных препаратов, 5-е изд. Издательство Оксфордского университета, Оксфорд

    Google ученый

  • Lell B, Kremsner PG (2002)Клиндамицин как противомалярийный препарат: обзор клинических испытаний.Противомикробные агенты Chemother 46:2315–2320

    Статья КАС пабмед Google ученый

  • Ленг Б., Мейерс Б.Р., Хиршман С.З., Кеуш Г.Т. (1975) Восприимчивость грамотрицательных бактерий к комбинациям антимикробных агентов in vitro. Противомикробные агенты Chemother 8:164–171

    CAS пабмед Google ученый

  • Magerlein BJ (1971) Модификация линкомицина.Adv Appl Microbiol 14:185–229

    CAS пабмед Google ученый

  • Marcinak JF, Frank AL (2003) Лечение внебольничного метициллин-резистентного Staphylococcus aureus у детей. Curr Opin Infect Dis 16:265–269

    CAS пабмед Google ученый

  • Matsuoka M (2000) Изучение устойчивости к макролидам, линкозамидам и стрептограмину В у Staphylococcus aureus .Якугаку Дзасши 120: 374–386

    CAS пабмед Google ученый

  • McGregor JA, French JI (2000) Бактериальный вагиноз у беременных. Obstet Gynecol Surv [Приложение] 55: S1–S19

    Google ученый

  • McManus MC (1997) Механизмы устойчивости бактерий к противомикробным препаратам. Am J Health Syst Pharm 54:1420–1433

    CAS пабмед Google ученый

  • Melter O (2003) Обнаружение и молекулярная характеристика метициллин-резистентных Staphylococcus aureus и Bartonella henselae в Чешской Республике.Кандидатская диссертация, Карлов университет, Прага

  • Мордмюллер Б., Гранингер В., Кремснер П.Г. (1998) Химиотерапия малярии во время резистентности к хлорохину. Вена Клин Wochenschr 110: 321–325

    CAS пабмед Google ученый

  • Mylonakis E, Ryan ET, Calderwood SB (2001) Clostridium difficile -ассоциированная диарея — обзор. Arch Intern Med 161:525–533

    Статья КАС пабмед Google ученый

  • Noli C, Boothe D (1999) Макролиды и линкозамиды.Вет Дерматол 10:217–223

    Статья Google ученый

  • Novotná G, Janata J, Kopecky J, Najmanova L, Spizek J (2002) Гены, контролирующие устойчивость к MLS у метициллин-резистентного Staphylococcus aureus . В: Медицинская комиссия Inter Academy (редактор) Борьба с инфекциями, устойчивостью к антибиотикам и биотерроризмом во всем мире. Elsevier, London, pp 169–170

  • Patenotte A, Dupuy O, Peyron F, Delolme H, Flechaire A (1995) Антибиотики и малярия — обзор литературы.Med Malad Infect 25:970–975

    Google ученый

  • Patey O, Varon E, Prazuck T, Podglajen I, Dublanchet A, Dubreuil L, Breuil J (1994) Многоцентровое исследование во Франции антимикробной чувствительности 416 изолятов культур крови из группы Bacteroides fragilis . J Antimicrob Chemother 33:1029–1034

    CAS пабмед Google ученый

  • Пиперсберг В., Дистлер Дж. (1997) Аминогликозиды и компоненты сахара в других вторичных метаболитах в биотехнологии.В: Kleinkauf H, Dören H von (eds) Продукты вторичного метаболизма. (Биотехнология, том 7, 2-е изд.) Wiley–VCH, Weinheim, стр. 397–488

  • Priestley CJF, Kinghorn GR (1996) Бактериальный вагиноз. Brit J Clin Pract 50: 331–334

    CAS пабмед Google ученый

  • Reeves DS, Holt HA, Phillips I, King A, Miles RS, Paton R, Wise R, Andrews JM (1991) Активность клиндамицина против Staphylococcus aureus и Staphylococcus epidermidis из 4 центров Великобритании.J Antimicrob Chemother 27:469–474

    CAS пабмед Google ученый

  • Reig M, Fernandez MC, Ballesta JP, Baquero F (1992a) Индуцибельное выражение устойчивости к рибосомному клиндамицину у Bacteroides vulgatus . Противомикробные агенты Chemother 36: 639–642

    CAS пабмед Google ученый

  • Reig M, Moreno A, Baquero F (1992b) Устойчивость Peptostreptococcus spp к макролидам и линкозамидам: индуцируемые и конститутивные фенотипы.Противомикробные агенты Chemother 36:662–664

    CAS пабмед Google ученый

  • Remington JS (1990) Роль клиндамицина отдельно или в комбинации с другим средством для лечения токсоплазмоза и пневмоцистоза при СПИДе. AM Medica Communications, New York

  • Rice RJ, Bhullar V, Mitchell SH, Bullard J, Knapp JS (1995) Восприимчивость изолятов Chlamydia trachomatis , вызывающих неосложненные инфекции женских половых путей и воспалительные заболевания органов малого таза.Противомикробные агенты Chemother 39:760–762

    CAS пабмед Google ученый

  • Ridgway GL, Owen JM, Oriel JD (1978) Чувствительность Chlamyda trachomatis к противомикробным препаратам в клеточной культуре. Br J Venereol Dis 54:103–105

    CAS Google ученый

  • Роос Д.С. (1996) Молекулярно-генетические инструменты для идентификации и анализа лекарственных мишеней в Toxoplasma gondii .Curr Top Microbiol Immunol 219:247–259

    CAS пабмед Google ученый

  • Ross JI, Snelling AM, Carnegie E, Coates P, Cunliffe WJ, Bettoli V, Tosti G, Katsambas A, Del Pulgar JIGP, Rollman O, Torok L, Eady EA, Cove JH (2003) Устойчивые к антибиотикам угри : уроки Европы. Бр Дж Дерматол 148:467–478

    CAS пабмед Google ученый

  • Sanders CC, Sanders WE Jr, Goering RV (1983) Влияние клиндамицина на дерепрессию бета-лактамаз у грамотрицательных бактерий.J Antimicrob Chemother 12 [Suppl C]:97–104

  • Schlievert PM, Kelly JA (1984) Индуцированное клиндамицином подавление производства экзотоксина, связанного с синдромом токсического шока. J Infect Dis 149:471

    Google ученый

  • Шлунцен Ф., Заривач Р., Хармс Р., Башан А., Тоциль А., Альбрехт Р., Йонат А., Франчески Ф. (2001) Структурная основа взаимодействия антибиотиков с пептидилтрансферазным центром эубактерий.Природа 413:814–821

    Статья КАС пабмед Google ученый

  • Печать Д.В. (2001) Некротизирующий фасциит. Curr Opin Infect Dis 14:127–132

    Статья КАС пабмед Google ученый

  • Шеридан Р.Л., Райан К.М., Пастернак М.С., Вебер Дж.М., Томпкинс Р.Г. (1993) Флавобактериальный сепсис у педиатрических пациентов с массивными ожогами. Clin Infect Dis 17:185–187

    CAS пабмед Google ученый

  • Siberry GK, Tekle T, Carroll K, Dick J (2003) Неудача лечения клиндамицином метициллин-резистентного Staphylococcus aureus , экспрессирующего индуцибельную резистентность к клиндамицину in vitro.Clin Infect Dis 37:1257–1260

    Статья пабмед Google ученый

  • Sicora C, Mate Z, Vass I (2003) Взаимодействие видимого и УФ-В света при фотоповреждении и восстановлении фотосистемы II. Photosynth Res 75:127–137

    Статья КАС Google ученый

  • Smieja M (1998) Текущие показания к применению клиндамицина: критический обзор. J Can Infect Dis 9:22–28

    Google ученый

  • Spizek J, Rezanka T (2004) Линкомицин, культивирование штаммов-продуцентов и биосинтез.Appl Microbiol Biotechnol (в печати)

  • Stevens DL (1996) Инвазивное стрептококковое заболевание группы А. Infect Agents Dis Rev Issues Комментарий 5:157–166

    CAS Google ученый

  • Стивенс Д.Л. (2000)Синдром стрептококкового токсического шока, связанный с некротизирующим фасциитом. Annu Rev Med 51:271–288

    Статья КАС пабмед Google ученый

  • Sztarickai F, Dinya Z, Puskas MM, Batta G, Masuma R, Omura S (1996) Полусинтетическая модификация антибиотика линкомицина.J Антибиот 49:941–943

    CAS пабмед Google ученый

  • Tanaka-Bandoh K, Kato N, Watanabe K, Ueno K (1995) Профили чувствительности к антибиотикам Bacteroides fragilis и Bacteroides thetaiotaomicron в Японии с 1990 по 1992 год. –S355

  • Teng LJ, Hsueh PR, Tsai JC, Liaw SJ, Ho SW, Luh KT (2002) Высокая частота резистентности к цефокситину и клиндамицину среди анаэробов на Тайване.Противомикробные агенты Chemother 46:2908–2913

    Статья КАС пабмед Google ученый

  • Thomas C, Stevenson M, Riley TV (2003) Антибиотики и внутрибольничная Clostridium difficile -ассоциированная диарея: систематический обзор. J Antimicrob Chemother 51:1339–1350

    Статья КАС пабмед Google ученый

  • Turgeon P, Turgeon V, Gourdeau M, Dubois J, Lamothe F (1994) Продольное исследование восприимчивости видов группы Bacteroides fragilis к пяти противомикробным агентам в трех медицинских центрах.Противомикробные агенты Chemother 38: 2276–2279

    CAS пабмед Google ученый

  • Uguen C, Girard L, Brasseur P, Leblay R (1997) Бабезиоз человека в 1997 г. Rev Med Interne 18:945–951

    Статья КАС пабмед Google ученый

  • VanVlem B, Vanholder R, DePaepe P, Vogelaers D, Ringoir S (1996) Иммуномодулирующие эффекты антибиотиков: обзор литературы.Инфекция 24:275–291

    CAS пабмед Google ученый

  • Verdier L, Bertho G, Gharbi-Benarous J, Girault JP (2000) Конформации линкомицина и клиндамицина. Фрагмент, общий для макролидов, кетолидов и линкозамидов, определяемый по конформациям TRNOE, связанным с рибосомой. Bioorg Med Chem 8:1225–1243

    Статья КАС пабмед Google ученый

  • Veyssier-Belot C, Lejoyeux-Chartier F, Bouvet A (1999) Рожистое воспаление, целлюлит и другие Streptococcus pyogenes кожные инфекции.Presse Med 28: 1959–1965

    CAS пабмед Google ученый

  • Wagner J, Jabbusch M, Eisenblatter M, Hahn H, Wendt C, Ignatius R (2003) Восприимчивость изолятов Campylobacter jejuni из Германии к ципрофлоксацину, моксифлоксацину, эритромицину, клиндамицину и тетрациклину. Противомикробные агенты Chemother 47:2358–2361

    Статья КАС пабмед Google ученый

  • Walker C, Karpinia K (2002) Обоснование использования антибиотиков в пародонтологии.J Periodontol 73:1188–1196

    PubMed Google ученый

  • Warner GT, Plosker GL (2002) Гель клиндамицин/бензоилпероксид: обзор его использования при лечении акне. Амер Дж. Клин Дерматол 3:349–360

    Google ученый

  • Границы | Количественное определение генов устойчивости к линкомицину, связанных с остатками линкомицина в водах и почвах, прилегающих к репрезентативным свинофермам в Китае

    Введение

    Антибиотики обычно используются во всем мире при кормлении крупных закрытых животных (CAFO) для стимулирования роста животных и лечения болезней животных.Многие антибиотики плохо всасываются в кишечнике обработанных животных, и поэтому до 75% из них могут выводиться в неметаболизированной форме с фекалиями и мочой, что позволяет антибиотикам сохраняться и накапливаться в воде и почве (Kumar et al., 2005). . Ранее сообщалось, что высокая концентрация (7820 нг/мл) линкомицина может быть обнаружена в жидком навозе свиней после введения в корм. В жидком навозе ~84 % линкомицина находится в растворенной фазе, а 16 % связано с твердыми компонентами навоза (Kuchta and Cessna, 2009b).Кроме того, линкомицин может быть обнаружен в навозе отстойников в течение 5 месяцев при его применении в качестве добавки к сельскохозяйственным угодьям. Когда навоз домашнего скота из CAFO используется в качестве жидкого удобрения, антибиотики могут переноситься в поверхностные и грунтовые воды, а также в почву и действовать как резервуар (Hornish et al., 1987; Kuchta and Cessna, 2009b; Kwon, 2011). Следовательно, линкомицин является одним из антибиотиков, которые могут легко накапливаться в среде, прилегающей к CAFO (Hu et al., 2010).

    Предыдущее исследование показало, что применение навоза животных может привести к потенциальному распространению устойчивости к антибиотикам среди экологических бактерий за счет латерального переноса генов (Ghosh and Lapara, 2007).Более того, гены устойчивости к антибиотикам (ARG) могут передаваться между патогенами и непатогенами под давлением отбора в окружающей среде (Kruse and Sorum, 1994). Сообщалось, что гены устойчивости к тетрациклину, плазмид-опосредованные гены устойчивости к хинолонам и гены устойчивости к хлорамфениколу были обнаружены в сточных водах и почве, прилегающих к свинофермам в Китае (Wu et al., 2010; Li et al., 2012, 2013). Существует три известных механизма, ответственных за устойчивость к линкомицину (Schmitz et al., 2000; Lozano et al., 2012): метилазы 23S рРНК [кодируется erm (A), erm (B), erm (C), erm (TR)]; О-нуклеотидилтрансферазы [кодируется lnu (A), lnu (B), lnu (C), lnu (D)] и экспорт линкомицина, опосредованный оттоком [ vga (A), vga (B), vga (C), vga (D), vga (E), lsa (A), lsa (B), lsa (C)]. vga (A), erm (B) и erm (A) были обнаружены в навозе и системах обработки отходов свиноферм, а vga (A)-положительных патогенов были обнаружены у свиней и свиноводов (Chen и другие., 2010; Мендес и др., 2011; Чжу и др., 2013). Однако поиск генов устойчивости к линкомицину (особенно erm , lnu и vga ) в среде свиноферм проводился в нескольких исследованиях.

    Китай является крупнейшим производителем и потребителем антибиотиков в мире, и почти половина из них используется в животноводстве (Hvistendahl, 2012). Кроме того, вода из свиного навоза использовалась в качестве удобрения для рыбных прудов, что при соединении с окружающими водными путями будет способствовать росту фотосинтезирующих организмов в Китае.После того, как свиной навоз был сброшен в окружающую среду, гены устойчивости к линкомицину и остатки линкомицина, скорее всего, появляются в воде и почве и впоследствии могут формировать селекционное давление на экологию окружающей среды.

    Целью данного исследования было количественное определение генов устойчивости к линкомицину в отношении остатков линкомицина в окружающей среде (почве и воде), особенно на сельскохозяйственных полях, прилегающих к свинофермам. Кроме того, также была определена связь между остатками линкомицина и развитием резистентности к линкомицину.Образцы воды и почвы были собраны на нескольких участках по пути сточных вод, сбрасываемых в окружающую среду со свинофермы (рис. 1), и для исследования уровней генов устойчивости к линкомицину использовался независимый от культуры метод.

    Рисунок 1. Географическая карта свинофермы и ее окрестностей . Черная стрелка указывает направление стока навозной воды. Пробы воды и почвы были взяты на участках от A до G. A, загон для опороса; Б, детский дом; C, рыбный пруд; D–F – сельскохозяйственные поля; Г, резервуар.

    Материалы и методы

    Отбор проб

    В октябре 2012 года на свиноферме, расположенной в провинции Гуандун, Китай, было отобрано 14 проб воды и почвы, где поголовье свиней составляло 10 000 или более товарных свиней в год. Эта свиноферма является представителем ферм, которые выбрасывают свиной навоз в окружающую среду. Воду из свиного навоза собирали в траншеи, а затем сбрасывали в пруд для разведения рыбы, который через канавы соединяется с окружающими водотоками. Между тем вода из водотоков впоследствии использовалась для орошения окружающих сельскохозяйственных полей (рис. 1).Методы сбора и подготовки образцов подробно описаны Li et al. (2012). В частности, пробы воды (около 1 л на каждую площадку) были отобраны на шести участках по пути сброса сточных вод в окружающую среду со свинофермы (рис. 1): загон для опороса (участок А), доращивание (участок В). , пруд для разведения рыбы (участок C) и окружающие сельскохозяйственные поля (участки D–F) (обозначенные как Aw, Bw, Cw, Dw, Ew и Fw для проб воды). Пробы почвы (около 200 г на каждую площадку) были отобраны со дна траншеи, которая использовалась для сброса сточных вод, прилегающих к площадкам водосбора (площадка А и Б), водно-отстойных вод пруда для разведения рыбы (площадка С), и окружающие сельскохозяйственные поля (участки D – F) (обозначенные как As, Bs, Cs, Ds, Es и Fs для образцов почвы).Кроме того, контрольные образцы были собраны из водохранилища (участок G), воды (G-w) и почвы окружающих сельскохозяйственных полей (G-s), в которые не поступали отходы животноводства (таким образом, предположительно не использовались антибиотики) вверх по течению от свинофермы. Для каждого участка четыре повтора, взятые из четырех разных мест, были объединены для формирования одного составного образца. Образцы сразу помещали в холодильник при транспортировке и хранили при –80°C до выделения ДНК и количественного анализа остатков линкомицина.

    Экстракция ДНК

    Экстракцию ДНК

    проводили культурально-независимым методом, описанным ранее (Li et al., 2012). Тотальную ДНК из образцов воды (около 200 мл) и образцов почвы (около 0,25 г) экстрагировали с помощью набора ДНК Power Water (MO BIO Laboratories Inc., Карлсбад, Калифорния, США) и набора ДНК Power Soil (MO BIO) в соответствии с инструкции производителя соответственно.

    Анализы ПЦР и количественной ПЦР

    ПЦР использовали для обнаружения присутствия 16 генов устойчивости к линкомицину [т.е. erm (A), erm (B), erm (C), erm (TR), lnu (A ) , vga (A), vga (C), vga (D) и vga (E)] во всех экологических и контрольных образцах.Праймеры для этих генов были либо зарегистрированы, либо недавно разработаны (таблица A1 в Приложении). Для обеспечения воспроизводимости ПЦР для генов устойчивости к линкомицину и генов 16SrРНК проводили в трех повторах с использованием термоциклера (iQ5; Bio-Rad, Hercules, CA) и SYBR ® Premix Ex Taq ™ параллельно с отрицательным контролем в каждый прогон. Все продукты ПЦР секвенировали напрямую, и результаты сравнивали с данными базы данных нуклеотидов GenBank (http://www.ncbi.nlm.nih.gov/взрыв/). Праймеры, использованные для ПЦР в реальном времени для обнаружения генов устойчивости к линкомицину, были такими же, как те, которые использовались в качественной ПЦР, в то время как праймеры для генов 16S рРНК были описаны ранее (Li et al., 2012). Каждую реакцию проводили в объеме 25 мкл, содержащем 12,5 мкл SYBR Premix Ex Taq , 0,5 мкл каждого праймера, 9,5 мкл ddH 2 O и 2 мкл матрицы, при следующих условиях: денатурация при 94°С. °С в течение 5 мин, затем 40 циклов при 94°С в течение 1 мин, 60°С в течение 1 мин и 72°С в течение 1 мин с окончательным удлинением при 72°С в течение 5 мин.Кривую плавления считывали через каждый 1°С от 60 до 95°С ближе к концу реакции ПЦР. Все агенты поставлялись компанией TaKaRa (TaKaRa Bio, Далянь, Китай). Эффективность ПЦР исследовали для проверки ингибирования. Значения R 2 превышали 0,9 для всех калибровочных кривых. Чтобы свести к минимуму дисперсию, вызванную разной эффективностью экстракции и анализа, а также различия в фоновой численности бактерий, уровень каждого гена устойчивости к линкомицину нормализовали по количеству копий 16S рРНК с использованием метода, рекомендованного ранее (Livak and Schmittgen, 2001). .

    Количественное определение линкомицина

    Экстракцию и количественный анализ линкомицина в воде, почве и контрольных образцах проводили в соответствии с методами, описанными ранее (Peru et al., 2006; Hu et al., 2010). Остатки линкомицина обнаруживали с помощью жидкостной хроматографии с быстрым разрешением и тандемной масс-спектрометрии (RRLC-MS/MS), включающей систему жидкостной хроматографии Agilent серии 1200 RRLC (Agilent Technologies, Пало-Альто, Калифорния, США), соединенную с тройным квадрупольным масс-спектрометром API 4000. (Applied Biosystems, Фостер, Калифорния, США) с помощью программного обеспечения Analyst 1.5 Аналитическая колонка представляла собой 2,1 мм внутренний диаметр × 150 мм, 1,8 мкм Zorbax SB-Aq (Agilent Technologies, Атланта, Джорджия, США). Извлечение линкомицина на основе калибровки, соответствующей матрице, составило 90,1% в пробах воды и 78,4% в пробах почвы. Пределы количественного определения составляли 10 пг/мл для воды и 0,1 нг/г для почвы соответственно.

    Статистика

    Статистическая оценка данных была проведена с помощью SPSS версии 17.0. Однородность значений оценивали с помощью теста однофакторного дисперсионного анализа (ANOVA).Двусторонний двумерный корреляционный анализ Пирсона использовали для сравнения уровней генов устойчивости к линкомицину в парных образцах воды и почвы и для корреляции уровней генов устойчивости к линкомицину с концентрациями остатков линкомицина. Относительную количественную оценку генов устойчивости к линкомицину lnu (F), erm (A) и erm (B), присутствующих во всех пробах воды и почвы, проводили с помощью корреляционного анализа.

    Результаты

    Концентрация линкомицина в водах и почвах

    Остатки

    линкомицина обычно обнаруживались во всех пробах воды (в диапазоне от 0.018 до 9,29 нг/мл) и образцы почвы (в диапазоне от 0,024 до 0,97 нг/г) с участков от A до F (рис. 2). Напротив, концентрации линкомицина были ниже предела обнаружения во всех контрольных образцах. Среди образцов воды и почвы самые высокие концентрации линкомицина наблюдались в образце Aw (9,29 нг/мл) и образце As (0,97 нг/г) соответственно, а затем значительно снижались вниз по течению от участка A. Остатки линкомицина обнаружены в пробах воды были выше, чем в пробах почвы.

    Рисунок 2. Относительное количество генов устойчивости к линкомицину: lnu (F), erm (A), erm (B) и сумма девяти генов устойчивости к линкомицину [ lnu (F) , erm (A), erm (B), lnu (A), lnu (D), vga (C), vga (E), vga (A), и vga (D)] и концентрацию линкомицина . Черные столбцы и пустые символы указывают на относительную распространенность генов устойчивости к линкомицину и концентрацию линкомицина в пробах воды соответственно; Серые полосы и символы указывают на относительную распространенность генов устойчивости к линкомицину и концентрацию линкомицина в образцах почвы соответственно.Столбики погрешностей представляют собой стандартное отклонение.

    Наличие и уровни генов устойчивости к линкомицину в водах и почвах

    Распространенность генов устойчивости к линкомицину в каждом тестируемом образце представлена ​​в Таблице A2. Из 16 исследованных генов устойчивости к линкомицину lnu (F), erm (A) и erm (B) были обнаружены во всех пробах воды и почвы, кроме контрольных. vga (C) обнаружен во всех пробах воды; в то время как vga (E) обнаружен только в двух пробах воды (A-w и B-w). vga (A) и vga (D) были обнаружены в двух водных (A-s и B-s) и четырех (A-s, B-s, C-s и D-s) образцах почвы соответственно. Никаких новых последовательностей не наблюдалось.

    Относительная количественная оценка девяти генов устойчивости к линкомицину показана на рисунке 2 и в таблице A3. Уровень отдельных генов устойчивости к линкомицину варьировался в образцах от места к месту, если они присутствовали. Постепенное снижение относительного количества генов устойчивости к линкомицину в образцах воды и почвы было обнаружено от участка А к F.Более того, уровни генов устойчивости к линкомицину в воде были выше, чем в образцах почвы с каждого участка.

    Корреляционный анализ

    Значимая положительная корреляция наблюдалась для концентрации остатков линкомицина между парными образцами воды и почвы ( r = 0,925, p = 0,008). Кроме того, количественная оценка генов устойчивости к линкомицину lnu (F) ( r = 0,981, p = 0,001), erm (A) ( r = 0.958, p = 0,003) и суммарные гены устойчивости к линкомицину [ lnu (F), erm (A), erm (B), lnu (A), lnu (D) , vga (C), vga (E), vga (A) и vga (D)] ( r = 0,885, p = 0,019) в пробах воды достоверно коррелировал с образцы почвы, кроме erm (Б) ( r = 0,626, p = 0,184). Значимые корреляции были выявлены между уровнем erm (A) ( r = 0.982, p < 0,01), erm (B) ( r = 0,919, p < 0,01), сумма девяти генов устойчивости к линкомицину ( r = p < 0,975, ) 1 и остатки линкомицина. Уровень vga (C) достоверно коррелировал с остатками линкомицина в пробах воды ( r = 0,999, p < 0,01). Однако умеренно значимые корреляции между остатком линкомицина и относительным количественным определением lnu (F) ( r = 0.705, p = 0,01) (табл. 1).

    Таблица 1. Корреляционный анализ генов устойчивости к линкомицину в парных образцах воды и почвы, а также корреляция между генами устойчивости к линкомицину и остатками линкомицина .

    Обсуждение

    Поскольку вода со свиным навозом сбрасывалась с площадки А, неудивительно, что самые высокие концентрации наблюдались в пробах A-w и A-s. Концентрации линкомицина в образце A-w и образцах B-w, C-w, D-w, E-w, обнаруженные в этом исследовании, были аналогичны предыдущим исследованиям жидкого свиного навоза и грунтовых вод с внесенных навозом пахотных земель соответственно (Kuchta and Cessna, 2009a; Kuchta et al., 2009). Однако содержание линкомицина в образцах почвы было выше, чем в почве с добавлением навоза, о которой сообщалось ранее (Kuchta et al., 2009). Остатки линкомицина значительно уменьшились ниже участка А, вероятно, в результате разбавления. Накопление линкомицина в пробах воды и почвы из окружающей среды, вероятно, связано с использованием линкомицина в качестве кормовых добавок на предприятии. Наши результаты показали, что вода со свиным навозом была резервуаром линкомицина. Остатки линкомицина в образцах D-s, E-s и F-s поддерживаются на относительно постоянном уровне, что позволяет предположить, что они близки к пределу обнаружения используемого метода обнаружения остатков.

    Всего в этом исследовании было обнаружено девять генов устойчивости к линкомицину. Широкое распространение получили гены erm (А), erm (В) и lnu (F). Они обнаружены практически во всех пробах воды и почвы. Это похоже на предыдущий отчет, в котором высокий уровень гена erm присутствовал в типичном свином навозе (Chen et al., 2010). Хотя водные и почвенные бактериальные сообщества различны, erm (A) и erm (B) могут широко распространяться из-за сброса воды из свиного навоза, содержащей ARG, в окружающую среду.В этом исследовании следует отметить, что уровни vga (A) и lnu (A) в воде из свиного навоза были в 10 раз выше, чем в предыдущих отчетах, в образцах почвы и воды, соответственно (Zhu et al., 2013). ). lnu (D), vga (C), vga (D) и vga (E) спорадически обнаруживались в пробах окружающей среды с участков, близких к участку A. В отличие от предыдущих исследований (Zhu et al. , 2013), vga (B) не был обнаружен ни в одном образце в нашем исследовании.Насколько нам известно, это первое сообщение о наличии генов lnu (F), lnu (D), vga (C), vga (D) и vga (E) у окружающая среда, прилегающая к свинофермам в Китае. Линкозамид O-нуклеотидилтрансферазы, кодируемые lnu (A), lnu (D), lnu (F), и транспортеры АТФ-связывающей кассеты, кодируемые vga (A), vga (C), vga (D) и vga (E) также могли переноситься плазмидами и транспозонами; таким образом, он представляет потенциальный риск распространения (Petinaki et al., 2008; Кадлек и др., 2010; Швенденер и Перретен, 2011).

    Подобно уровням плазмид-опосредованных генов устойчивости к хинолонам в образцах окружающей среды, мы обнаружили, что уровни генов устойчивости к линкомицину в воде были выше, чем в образцах почвы на каждом участке (Li et al., 2012). Обнаружена достоверная корреляция между парными образцами воды и почвы в отношении относительных уровней генов устойчивости к линкомицину и остатков линкомицина. Гены устойчивости к линкомицину и остатки линкомицина не были обнаружены в контрольных образцах (участок G).Это указывает на то, что вода из свиного навоза является резервуаром этих загрязнителей. Подобные резервуары ARG и антибиотиков, вероятно, распространены в Китае и других странах (Zhu et al., 2013). Предыдущие исследования показали, что имел место обмен ARG между экологическими бактериальными и клиническими патогенами, что может представлять риск для здоровья близлежащих жителей, подвергающихся воздействию загрязненной полевой почвы, воды из рыбных прудов и водотоков во время ведения сельского хозяйства (Forsberg et al., 2012; Li et al. др., 2012).

    Учитывая, что высокие уровни vga (C) и vga (D) были обнаружены только в образцах почвы, а уровень vga (C) в значительной степени коррелировал с остатками линкомицина, можно сделать вывод, что количественная оценка содержания линкомицина в окружающей среде на гены устойчивости к линкомицину влиял не только эффект разбавления контаминации, но и селективный эффект остатков линкомицина в окружающей среде.Предыдущие исследования показали, что остатки антибиотиков в окружающей среде (почве и воде) могут влиять на селекцию и распространение генов устойчивости, а также стимулировать или подавлять экологические функции (Ghosh and Lapara, 2007; Naslund et al., 2008; Schauss et al., 2009). ; Дин и Хэ, 2010). Таким образом, длительное применение линкомицина в сочетании с его медленной деградацией в почве и воде (Kuchta et al., 2009; Williams, McLain, 2012) потенциально может привести к селекции резистентных видов бактерий и переносу АРГ, находящихся в переносимых элементы (Луфт и др., 2012). Эта гипотеза будет исследована в дальнейшей работе.

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Работа выполнена при поддержке Национального научного фонда для выдающихся молодых ученых (грант № 31125026), Специального фонда агронаучных исследований в интересах общества (грант №201203040), Национального фонда естественных наук Китая (грант № U0631006) и групповых проектов Фонда естественных наук провинции Гуандун (грант № S2012030006590).

    Каталожные номера

    Чен Дж., Мишель Ф.К. мл., Шриватсан С., Моррисон М. и Ю З. (2010). Возникновение и персистенция генов устойчивости к эритромицину (erm) и генов устойчивости к тетрациклину (tet) в системах обработки отходов на свиноводческих фермах. Микроб. Экол . 60, 479–486. doi: 10.1007/s00248-010-9634-5

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Форсберг, К.Дж., Рейес А., Ван Б., Селлек Э. М., Соммер М. О. А. и Дантас Г. (2012). Общий антибиотический резистом почвенных бактерий и патогенов человека. Наука 337, 1107–1111. doi: 10.1126/science.1220761

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Гош С. и Лапара Т. М. (2007). Влияние субтерапевтического применения антибиотиков у сельскохозяйственных животных на распространение и сохранение устойчивости к антибиотикам среди почвенных бактерий. ИСМЭ J .1, 191–203. doi: 10.1038/ismej.2007.31

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Hornish, R.E., Gosline, R.E., and Nappier, JM (1987). Сравнительный метаболизм линкомицина у свиней, кур и крыс. Препарат Метаб. Версия . 18, 177–214. дои: 10.3109/03602538708998305

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Ху, X., Чжоу, Q., и Луо, Y. (2010). Наличие и анализ источников типичных ветеринарных антибиотиков в навозе, почве, овощах и грунтовых водах из органических растительных баз, северный Китай. Окружающая среда. Загрязнение . 158, 2992–2998 гг. doi: 10.1016/j.envpol.2010.05.023

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Кадлек, К., Помба, К.Ф., Коуто, Н., и Шварц, С. (2010). Небольшие плазмиды, несущие гены vga(A) или vga(C), опосредуют устойчивость к линкозамидам, плевромутилинам и стрептограмину А антибиотикам у метициллин-резистентного штамма Staphylococcus aureus ST398 свиней. J. Антимикроб. Чемотер . 65, 2692–2693. дои: 10.1093/JAC/DKQ365

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Крузе Х. и Сорум Х. (1994). Перенос плазмид множественной лекарственной устойчивости между бактериями различного происхождения в природных микросредах. Заяв. Окружающая среда. Микробиол . 60, 4015–4021.

    Опубликовано Резюме | Опубликован полный текст

    Kuchta, S.L., и Cessna, A.J. (2009b). Концентрации линкомицина и спектиномицина в жидком свином навозе и их стойкость при имитации хранения навоза. Арх. Окружающая среда. Контам. Токсикол . 57, 1–10. doi: 10.1007/s00244-008-9229-z

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Kuchta, S.L., Cessna, A.J., Elliott, J.A., Peru, K.M., and Headley, J.V. (2009). Транспорт линкомицина с поверхностными и грунтовыми водами из пахотных земель с добавлением навоза. Дж. Окружающая среда. Качество . 38, 1719–1727. doi: 10.2134/jeq2008.0365

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Кумар, К., Гупта, С.К., Чандер, Ю., и Сингх, А.К. (2005). Использование антибиотиков в сельском хозяйстве и их влияние на наземную среду. Доп. Агрон . 87, 1–54. дои: 10.1016/S0065-2113(05)87001-4

    Полнотекстовая перекрестная ссылка

    Ли Дж., Шао Б., Шен Дж., Ван С. и Ву Ю. (2013). Возникновение генов устойчивости к хлорамфениколу как загрязнителей окружающей среды на откормочных площадках свиней. Окружающая среда. науч. Технол . 47, 2892–2897. дои: 10.1021/es304616c

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Ли, Дж., Ван Т., Шао Б., Шен Дж., Ван С. и Ву Ю. (2012). Плазмид-опосредованные гены устойчивости к хинолонам и остатки антибиотиков в сточных водах и почве, прилегающих к откормочным площадкам для свиней: потенциальный перенос на сельскохозяйственные угодья. Окружающая среда. Перспектива здоровья . 120, 1144–1149. doi: 10.1289/ehp.1104776

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Ливак, К. Дж., и Шмитген, Т. Д. (2001). Анализ данных об относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метода 2(-Delta Delta C(T)). Методы 25, 402–408. doi: 10.1006/meth.2001.1262

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Лоофт, Т., Джонсон, Т.А., Аллен, Х.К., Бейлс, Д.О., Альт, Д.П., Стедтфельд, Р.Д., и соавт. (2012). Влияние кормовых антибиотиков на кишечный микробиом свиней. Проц. Натл. акад. науч. США . 109, 1691–1696. doi: 10.1073/pnas.1120238109

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Лосано, К., Аспироз, К., Резуста, А., Гомес-Санс, Э., Саймон, К., Гомес, П., и соавт. (2012). Идентификация новых vga(A)-несущих плазмид и Tn5406-подобного транспозона в метициллинорезистентных Staphylococcus aureus и Staphylococcus epidermidis человеческого и животного происхождения. Междунар. Дж. Антимикроб. Агенты 40, 306–312. doi: 10.1016/j.ijantimicag.2012.06.009

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Мендес, Р. Э., Смит, Т. С., Дешпанде, Л., Дикема, Д.Дж., Сэдер, Х.С., и Джонс, Р.Н. (2011). Ген, кодирующий vga(A), переносимый плазмидой, в метициллин-резистентном штамме Staphylococcus aureus ST398, полученном от свиней и свиновода в США. Диагн. микробиол. Заразить. Дис . 71, 177–180. doi: 10.1016/j.diagmicrobio.2011.06.009

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Наслунд, Дж., Хедман, Дж. Э., и Агестранд, К. (2008). Влияние антибиотика ципрофлоксацина на структуру бактериального сообщества и деградацию пирена в морских отложениях. Аква. Токсикол . 90, 223–227. doi: 10.1016/j.aquatox.2008.09.002

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Перу, К.М., Кухта, С.Л., Хедли, Дж.В., и Сессна, А.Дж. (2006). Разработка хромато-масс-спектрометрического анализа гидрофильных взаимодействий на спектиномицин и линкомицин в супернатанте жидкого свиного навоза и стоках с пахотных земель. Ж. Хроматогр. А 1107, 152–158. doi: 10.1016/j.chroma.2005.12.057

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Петинаки, Э., Guerin-Faublee, V., Pichereau, V., Villers, C., Achard, A., Malbruny, B., et al. (2008). Ген устойчивости к линкомицину lnu(D) в Streptococcus uberis . Антимикроб. Агенты Чемотер . 52, 626–630. doi: 10.1128/AAC.01126-07

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Шаусс, К., Фокс, А., Лейнингер, С., Коцерке, А., Хойер, Х., Тиле-Брун, С., и соавт. (2009). Динамика и функциональная значимость аммиакокисляющих архей в двух сельскохозяйственных почвах. Окружающая среда. Микробиол . 11, 446–456. doi: 10.1111/j.1462-2920.2008.01783.x

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Schmitz, F.J., Sadurski, R., Kray, A., Boos, M., Geisel, R., Kohrer, K., et al. (2000). Распространенность генов устойчивости к макролидам в изолятах Staphylococcus aureus и Enterococcus faecium из 24 университетских больниц Европы. J. Антимикроб. Чемотер . 45, 891–894. doi: 10.1093/jac/45.6.891

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Швенденер, С., и Перретен, В. (2011). Новый транспозон Tn6133 в метициллинорезистентном штамме Staphylococcus aureus ST398 содержит vga(E), новый ген устойчивости к стрептограмину А, плевромутилину и линкозамиду. Антимикроб. Агенты Чемотер . 55, 4900–4904. doi: 10.1128/AAC.00528-11

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Уильямс, К. Ф., и Маклейн, Дж.ET (2012). Стойкость в почве и судьба карбамазепина, линкомицина, кофеина и ибупрофена при повторном использовании сточных вод. Дж. Окружающая среда. Качество . 41, 1473–1480. doi: 10.2134/jeq2011.0353

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Ву Н., Цяо М., Чжан Б., Ченг В. Д. и Чжу Ю. Г. (2010). Изобилие и разнообразие генов устойчивости к тетрациклину в почвах, прилегающих к репрезентативным откормочным площадкам свиней в Китае. Окружающая среда. науч. Технол . 44, 6933–6939.дои: 10.1021/es1007802

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Zhu, Y.G., Johnson, T.A., Su, J.Q., Qiao, M., Guo, G.X., Stedtfeld, R.D., et al. (2013). Разнообразные и обильные гены устойчивости к антибиотикам на китайских свинофермах. Проц. Натл. акад. науч. США . 110, 3435–3440. doi: 10.1073/pnas.1222743110

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Приложение

    Таблица A1. Праймеры и условия ПЦР (КПЦР), использованные в этом исследовании .

    Таблица А2. Результаты ПЦР обнаружения генов устойчивости к линкомицину в тотальной ДНК .

    Таблица A3. Относительное количественное определение генов устойчивости к линкомицину в образцах воды и почвы, нормированное к соответствующим копиям 16S рРНК .

    Каталожные номера

    Бах, Х. Дж., Томанова, Дж., Шлотер, М., и Мунк, Дж. К. (2002). Подсчет общего количества бактерий и бактерий с генами протеолитической активности в чистых культурах и в образцах из окружающей среды с помощью количественной ПЦР-опосредованной амплификации. J. Microbiol. Методы 49, 235–245. doi: 10.1016/S0167-7012(01)00370-0

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Bozdogan, B., Berrezouga, L., Kuo, M.S., Yurek, D.A., Farley, K.A., Stockman, B.J., et al. (1999). Новый ген устойчивости, linB, придающий устойчивость к линкозамидам путем нуклеотидилирования в Enterococcus faecium HM1025. Антимикроб. Агенты Чемотер . 43, 925–929.

    Опубликовано Резюме | Опубликован полный текст

    Де Граф, Э.М., Декостер А., Де Леенер Э., Гуссенс Х., Баэле М. и Хазебрук Ф. (2007). Распространенность и механизм устойчивости к макролидам, линкозамидам и стрептограминам среди изолятов Enterococcus faecium от сельскохозяйственных животных и пациентов больниц в Бельгии. Микроб. Лекарственное сопротивление . 13, 135–141. doi: 10.1089/mdr.2007.718

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Хенни, М., Сарас, Э., Шоссьер, С., Трейль, М.и Мадек, Дж. Ю. (2011). ermB-опосредованная резистентность к эритромицину у Streptococcus uberis от мастита крупного рогатого скота. Вет. Дж . 189, 356–358. doi: 10.1016/j.tvjl.2010.06.021

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Jung, Y.H., Shin, E.S., Kim, O., Yoo, J.S., Lee, K.M., Il Yoo, J., et al. (2010). Характеристика двух недавно идентифицированных генов, vgaD и vatG, придающих устойчивость к стрептограмину А у Enterococcus faecium . Антимикроб. Агенты Чемотер . 54, 4744–4749. doi: 10.1128/AAC.00798-09

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Керенберг С., Шварц С., Якобсен Л., Хансен Л. Х. и Вестер Б. (2005). Новый механизм устойчивости к хлорамфениколу, флорфениколу и клиндамицину: метилирование 23S рибосомной РНК по А2503. Мол. Микробиол . 57, 1064–1073. doi: 10.1111/j.1365-2958.2005.04754.x

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Лина Г., Quaglia, A., Reverdy, M.E., Leclercq, R., Vandenesch, F., and Etienne, J. (1999). Распределение генов устойчивости к макролидам, линкозамидам и стрептограминам среди стафилококков. Антимикроб. Агенты Чемотер . 43, 1062–1066.

    Опубликовано Резюме | Опубликован полный текст

    Лютье, П., и Шварц, С. (2007). Молекулярные основы устойчивости к макролидам и линкозамидам среди стафилококков и стрептококков из различных источников животного происхождения, собранных в рамках программы мониторинга устойчивости BfT-GermVet. Междунар. Дж. Антимикроб. Агенты 29, 528–535. doi: 10.1016/j.ijantimicag.2006.12.016

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Мальбруни Б., Верно А. М., Мердок Д. Р., Леклерк Р. и Каттуар В. (2011). Перекрестная устойчивость к линкозамидам, стрептограминам А и плевромутилинам из-за гена lsa(C) в Streptococcus agalactiae UCN70. Антимикроб. Агенты Чемотер . 55, 1470–1474. doi: 10.1128/AAC.01068-10

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Сингх, К.В., Вайншток, Г.М., и Мюррей, Б.Е. (2002). Гомолог Enterococcus faecalis ABC (Lsa) необходим для устойчивости этого вида к клиндамицину и хинупристину-далфопристину. Антимикроб. Агенты Чемотер . 46, 1845–1850 гг. doi: 10.1128/AAC.46.6.1845-1850.2002

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Сатклифф, Дж., Гребе, Т., Тейт-Камрадт, А., и Вондрак, Л. (1996). Выявление детерминант резистентности к эритромицину методом ПЦР. Антимикроб. Агенты Чемотер . 40, 2562–2566.

    Опубликовано Резюме | Опубликован полный текст

    Tait-Kamradt, A., Davies, T., Cronan, M., Jacobs, M.R., Appelbaum, P.C., and Sutcliffe, J. (2000). Мутации в 23S рРНК и рибосомном белке L4 объясняют резистентность пневмококковых штаммов, отобранных in vitro путем пассажа макролидом. Антимикроб. Агенты Чемотер . 44, 2118–2125. doi: 10.1128/AAC.44.8.2118-2125.2000

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Вернер, Г., Cuny, C., Schmitz, FJ, and Witte, W. (2001). Метициллин-резистентный, хинупристин-дальфопристин-резистентный Staphylococcus aureus со сниженной чувствительностью к гликопептидам. Дж. Клин. Микробиол . 39, 3586–3590. doi: 10.1128/JCM.39.10.3586-3590.2001

    Опубликовано Резюме | Опубликован полный текст | Полнотекстовая перекрестная ссылка

    Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка браузера на прием файлов cookie

    Существует множество причин, по которым файл cookie не может быть установлен правильно. Ниже приведены наиболее распространенные причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки браузера, чтобы принять файлы cookie, или спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файл cookie.
    • Ваш браузер не поддерживает файлы cookie. Попробуйте другой браузер, если вы подозреваете это.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы это исправить, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Предоставить доступ без файлов cookie потребует от сайта создания нового сеанса для каждой посещаемой вами страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в файле cookie; никакая другая информация не фиксируется.

    Как правило, в файле cookie может храниться только та информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, если вы не решите ввести его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступ к остальной части вашего компьютера, и только сайт, создавший файл cookie, может его прочитать.

    Имплантационная или инъекционная лекарственная форма Новые лекарства для животных; линкомицин; Техническая поправка

    Начало Преамбула

    Управление по санитарному надзору за качеством пищевых продуктов и медикаментов, HHS.

    Окончательное правило; техническая поправка.

    Управление по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA) вносит поправки в положения о лекарствах для животных, чтобы отразить одобрение сокращенной заявки на новые лекарства для животных (ANADA), поданной Veterinary Laboratories, Inc. ANADA предусматривает использование инъекционного раствора линкомицина у свиней для лечения инфекционного артрита и микоплазменной пневмонии. Принимаются также дополнительные меры, поскольку мы не указали концентрацию раствора линкомицина, одобренную ANADA, в окончательном правиле, опубликованном в Федеральном реестре от 14 мая 2002 г.

    Это правило вступает в силу 28 августа 2003 г.

    Начать дополнительную информацию

    Lonnie W. Luther, Центр ветеринарной медицины (HFV-104), Управление по санитарному надзору за качеством пищевых продуктов и медикаментов, 7519 Standish Pl., Rockville, MD 20855, 301-827-8549, электронная почта: [email protected] .

    Конец дополнительной информации Конец преамбулы Начать дополнительную информацию

    Veterinary Laboratories, Inc., 12340 Санта-Фе Др., Lenexa, KS 66215, поданной ANADA 200-315, которая предусматривает применение линкомицина (моногидрат гидрохлорида линкомицина) для инъекций свиньям для лечения инфекционного артрита и микоплазменной пневмонии. Линкомицин для инъекций компании Veterinary Laboratories, Inc. одобрен как генерическая копия препарата LINCOMIX для инъекций Pharmacia & Upjohn Co., одобренного в соответствии с NADA 034-025. ANADA утверждена 2 апреля 3003 г., и правила изменены в 21 CFR 522.1260, чтобы отразить одобрение. Основа одобрения обсуждается в сводке свободы информации.

    Раздел 522.1260 также пересматривается, чтобы указать концентрацию раствора линкомицина, утвержденную в соответствии с ANADA 200-274 (67 FR 34387, 14 мая 2002 г.).

    В соответствии с положениями о свободе информации 21 CFR, часть 20, и 21 CFR 514.11(e)(2)(ii), сводные данные и информация о безопасности и эффективности, представленные для одобрения этого приложения, можно увидеть в ведомостях. Отделение управления (HFA-305), Управление по санитарному надзору за качеством пищевых продуктов и медикаментов, 5630 Fishers Lane, rm.1061, Rockville, MD 20852, с 9:00 до 16:00 с понедельника по пятницу.

    Агентство определило в соответствии с 21 CFR 25.33(a)(1), что это действие относится к типу, который по отдельности или в совокупности не оказывает существенного влияния на окружающую среду человека. Поэтому не требуется ни экологической оценки, ни заключения о воздействии на окружающую среду.

    Это правило не соответствует определению «правило» в 5 U.S.C. 804(3)(A), потому что это правило «особой применимости».Следовательно, он не подлежит рассмотрению Конгрессом в соответствии с 5 U.S.C. 801-808.

    Стартовый список предметов Конечный список тем Начало поправки, часть

    Таким образом, в соответствии с Федеральным законом о пищевых продуктах, лекарствах и косметических средствах и в соответствии с полномочиями, делегированными Уполномоченному по пищевым продуктам и лекарствам и переданным Центру ветеринарной медицины, часть 522 раздела 21 CFR изменена следующим образом:

    Конец части поправки Стартовая часть Конечная часть Начальная часть поправки

    1.Официальная ссылка на 21 CFR, часть 522, продолжает читаться следующим образом:

    End Amendment Part Стартовый орган

    21 США 360б.

    Конечная власть Начало Поправки, Часть

    2. Раздел 522.1260 изменен путем пересмотра параграфов (a) и (b) следующим образом:

    Конец Поправки, Часть

    Линкомицин.

    (а) Технические характеристики . Один миллилитр раствора содержит линкомицина гидрохлорида моногидрата, что эквивалентно:

    (1) 25, 50, 100 или 300 миллиграммов (мг) линкомицина.

    (2) 25, 100 или 300 мг линкомицина.

    (3) 300 мг линкомицина.

    (b) Спонсоры . См. спонсоров в § 510.600(c) этой главы для использования, как в параграфе (e) этого раздела.

    (1) № 000009 для использования концентраций в пункте (а)(1) этого раздела, как и в пункте (е) этого раздела.

    (2) № 000857 для использования концентраций в пункте (а)(2) этого раздела, как и в пункте (е)(2) этого раздела.

    (3) № 046573 для использования концентрации в пункте (а)(3) этого раздела, как и в пункте (е)(2) этого раздела.

    Стартовая подпись

    Дата: 7 августа 2003 г.

    Линда Толлефсон,

    Исполняющий обязанности директора Центра ветеринарной медицины.

    Конечная подпись Конец дополнительной информации

    линкомицина гидрохлорид для контроля американского гнильца медоносных пчел

    ДОИ: 10.1051/апидо:2001100

    Апидология 32 (2001) 547-554

    линкомицина гидрохлорид для контроля американского гнильца медоносных пчел

    Марк Ф. Фельдлауфер a , Джеффри С. Петтис a , Ян П. Кочански a и Грант Стайлз b

    a Министерство сельского хозяйства США, Служба сельскохозяйственных исследований, Исследовательская лаборатория пчел, корп. 476, BARC-East, Белтсвилл, штат Мэриленд, 20705, США
    b Вылет из Нью-Джерси.сельского хозяйства, Отдел растениеводства, CN330, Trenton NJ 08625, USA

    (Получено 29 декабря 2000 г., пересмотрено 16 июля 2001 г., принято 30 июля 2001 г.)

    Abstract
    Антибиотик линкомицина гидрохлорид был оценен на токсичность для личинок и взрослых особей. медоносных пчел и за эффективность в борьбе с американским гнильцом (AFB). Результаты исследований токсичности с участием девяти применений линкомицина (200-, 600-, или 1000 мг активного ингредиента на одно применение) в виде сахарной пудры для кондитерских изделий не выявили существенных различий в смертности ни в одной из групп лечения. для взрослых особей или личинок по сравнению с необработанными или обработанными сахаром контролями.В полевых исследованиях эффективности 18 колоний с существующей резистентной к окситетрациклину КУМ присыпали три раза с интервалом в одну неделю дозами 100, 200 или 400 мг. линкомицин (на 20 г сахарной пудры). Сорок пять дней после третьего лечения, никаких видимых признаков КУМ не было обнаружено, независимо от начального тяжесть заболевания или применяемая доза.


    Ключевые слова: линкомицин / токсичность / американский гнилец / антибиотик / контроль

    Переписка и оттиски: Марк Ф.Feldlaufer
        e-mail: [email protected]

    © INRA, EDP Sciences, DIB, AGIB 2001

    Линкомицин (LINC) – Брошюра о лекарственных компонентах

    Эта страница является частью репозитория руководящих документов (GDR).

    Ищете сопутствующие документы?
    Поиск связанных документов в репозитории руководящих документов

    Статус : Ветеринарное предписание требуется для утвержденных заявлений

    Дата пересмотра: апрель 2021 г.

    Таблица утвержденных видов и заявлений
    Разрешенные виды скота Утвержденная формула(ы)
    (сокращенно) Примечание к таблице 1
    Время вывода Название утвержденного(ых) бренда(ов)
    Свинья
    1. Уменьшение тяжести микоплазменной пневмонии
    24 часа (мясо)
    1. Линкомикс 44 Премикс
    2. Линкомикс 110 Премикс
    3. Линкомицин 44 Премикс
    4. Линкомицин 110 Премикс
    5. Премикс линкомицина 44 г
    6. Линкомицин 110 G Премикс
    Свинья
    1. Лечение дизентерии свиней и контроль заболевания после лечения.
    0 дней
    1. Линкомикс 44 Премикс
    2. Линкомикс 110 Премикс
    3. Линкомицин 44 Премикс
    4. Линкомицин 110 Премикс
    5. Премикс линкомицина 44 г
    6. Линкомицин 110 G Премикс
    Свинья
    1. Помощь в снижении клинической тяжести пролиферативной энтеропатии свиней
    0 дней
    1. Линкомикс 44 Премикс
    2. Линкомикс 110 Премикс
    3. Линкомицин 44 Премикс
    4. Линкомицин 110 Премикс
    5. Премикс линкомицина 44 г
    6. Линкомицин 110 G Премикс

    Примечание к таблице

    Примечание к таблице 1

    Для того, чтобы соответствовать Положениям о кормах, полное заявление должно быть указано на этикетке лечебного корма.

    Вернуться к примечанию к таблице 1 реферер

    Свинья

    Таблица утвержденных заявлений и брендов
    Утвержденные претензии Название утвержденного(ых) бренда(ов) Концентрация лекарства в продукте DIN
    Пункты 1, 2, 3
    1. Линкомикс 44 Премикс
    Основание линкомицина (в виде гидрохлорида линкомицина) 44 г/кг
    Пункты 1, 2, 3
    1. Линкомицин 44 Премикс
    Основание линкомицина (в виде гидрохлорида линкомицина) 44 г/кг
    Пункты 1, 2, 3
    1. Линкомицин 44 G Премикс
    Основание линкомицина (в виде гидрохлорида линкомицина) 44 г/кг
    Пункты 1, 2, 3
    1. Линкомикс 110 Премикс
    Основание линкомицина (в виде гидрохлорида линкомицина) 110 г/кг
    Пункты 1, 2, 3
    1. Премикс линкомицина 110
    Основание линкомицина (в виде гидрохлорида линкомицина) 110 г/кг
    Пункты 1, 2, 3
    1. Линкомицин 110 G Премикс
    Основание линкомицина (в виде гидрохлорида линкомицина) 110 г/кг

    Пункт 1

    Для снижения тяжести микоплазменной пневмонии у растущих свиней.

    Уровень лечебного ингредиента в полноценном корме

    220 мг/кг (0,022%) линкомицина в полноценном корме.

    Инструкции по использованию в комплексном корме

    Этот корм для скота содержит важный с медицинской точки зрения антибиотик. Чтобы уменьшить развитие устойчивости к противомикробным препаратам и сохранить эффективность, используйте этот антибиотик с осторожностью и в течение кратчайшего периода времени, необходимого для достижения желаемого клинического результата.

    Скармливайте этот лечебный корм растущим свиньям в качестве единственного рациона в течение 21 дня.

    Дополнительная информация (не размещать на этикетках корма)

    Для производителей кормов
    Добавить и тщательно перемешать в рационе со следующей скоростью, чтобы получить 220 мг/кг (0,022%) линкомицина на метрическую тонну (1000 кг ) готового (полноценного) корма:

    • 5,0 кг премиксов Lincomix 44, Lincomycin 44 или Lincomycin 44 G
    • 2,0 кг премиксов Lincomix 110, Lincomycin 110 или Lincomycin 110 G
    Предупреждение
    1. Свиней нельзя забивать для использования в пищу в течение как минимум 24 часов после последней обработки этим препаратом при лечении на рекомендуемом уровне 220 мг/кг (0.022%) линкомицина в комбикорме.
    2. Этот продукт может вызывать раздражение кожи и слизистых оболочек человека. При смешивании и обращении с этим лечебным кормом избегайте вдыхания, перорального контакта и прямого контакта с кожей или глазами. Используйте защитную одежду, непроницаемые перчатки и пылезащитную маску. (Требуется только на этикетках премиксов и добавок)
    3. Хранить в недоступном для детей месте. (Требуется только на этикетках премиксов и добавок)
    Осторожно
    1. У пролеченных свиней может развиться некоторое размягчение стула или легкая диарея в течение 36 часов после начала лечения.Признаки легкого раздражения и отека ануса и/или вульвы могут быть связаны с изменениями стула. В редких случаях у некоторых свиней может наблюдаться покраснение кожи и раздражительность. Если эти реакции будут более серьезными, чем описано выше, прекратите использование этого лекарственного корма.
    2. Не использовать для разведения свиней.
    3. Не использовать в кормах, содержащих связывающие вещества для гранул, за исключением сульфоната лигнина. (Требуется только на этикетках премиксов и добавок)
    4. При приготовлении кормов, содержащих линкомицин, следует соблюдать надлежащую производственную практику.Это включает в себя соответствующие процедуры очистки, чтобы избежать перекрестного загрязнения. Этот продукт необходимо тщательно смешать с кормом перед использованием. (Требуется только на этикетках премиксов и добавок)
    5. Не позволяйте кроликам, хомякам, морским свинкам, лошадям, молочному скоту или другим жвачным животным доступ к кормам, содержащим линкомицин. Проглатывание этими видами может привести к серьезным желудочно-кишечным последствиям или метаболическим нарушениям (например, кетозу у молочного скота).

    Пункт 2

    Для лечения дизентерии свиней (кровавые поносы), связанной с Brachyspira (Serpulina) hyodysenteriae у растущих свиней, и для контроля заболевания после лечения.

    Уровень лечебного ингредиента в полноценном корме

    Лечебный уровень: 110 мг/кг (0,011%) линкомицина в полноценном корме, затем:
    Контрольный уровень: 44 мг/кг (0,0044%) линкомицина в полноценном корме

    Инструкции по использованию в комплексном корме

    Этот корм для скота содержит важный с медицинской точки зрения антибиотик. Чтобы уменьшить развитие устойчивости к противомикробным препаратам и сохранить эффективность, используйте этот антибиотик с осторожностью и в течение кратчайшего периода времени, необходимого для достижения желаемого клинического результата.

    Если у свиней уже появились признаки болезни, скармливайте лечебную дозу (110 мг/кг полного корма) этого лечебного корма в качестве единственного рациона в течение 21 дня или до появления признаков болезни (водянистых, слизистых или кровянистых стул) исчезают. Затем скармливайте контрольную дозу (44 мг/кг полного корма) лечебного корма еще в течение 4 недель. Повторите с вышеуказанным режимом дозирования, если признаки дизентерии свиней появляются снова.

    Дополнительная информация (не размещать на этикетках корма)

    Для производителей кормов
    Добавьте и тщательно перемешайте с рационом со следующей скоростью, чтобы получить 110 мг/кг (0.011%) линкомицина на метрическую тонну (1000 кг ) готового (полного) корма:

    • 2,5 кг премиксов Lincomix 44, Lincomycin 44 или Lincomycin 44 G
    • 1,0 кг премиксов Lincomix 110, Lincomycin 110 или Lincomycin 110 G

    Добавьте и тщательно перемешайте с рационом со следующей скоростью, чтобы обеспечить 44 мг/кг (0,0044%) линкомицина на метрическую тонну (1000 кг) готового (полноценного) корма:

    • 1,0 кг премиксов Lincomix 44, Lincomycin 44 или Lincomycin 44 G
    • 0.4 кг (400 г) премиксов Lincomix 110, Lincomycin 110 или Lincomycin 110 G
    Предупреждение
    1. Отмена не требуется при рекомендуемом уровне до 110 мг/кг (0,011%) линкомицина в полноценном корме.
    2. Этот продукт может вызывать раздражение кожи и слизистых оболочек человека. При смешивании и обращении с этим лечебным кормом избегайте вдыхания, перорального контакта и прямого контакта с кожей или глазами. Используйте защитную одежду, непроницаемые перчатки и пылезащитную маску.(Требуется только на этикетках премиксов и добавок)
    3. Хранить в недоступном для детей месте. (Требуется только на этикетках премиксов и добавок)
    Осторожно
    1. У пролеченных свиней может развиться некоторое размягчение стула или легкая диарея в течение 36 часов после начала лечения. Признаки легкого раздражения и отека ануса и/или вульвы могут быть связаны с изменениями стула. В редких случаях у некоторых свиней может наблюдаться покраснение кожи и раздражительность. Если эти реакции будут более серьезными, чем описано выше, прекратите использование этого лекарственного корма.
    2. Не использовать для разведения свиней.
    3. Не использовать в кормах, содержащих вещества, связывающие гранулы, за исключением сульфоната лигнина. (Требуется только на этикетках премиксов и добавок)
    4. При приготовлении кормов, содержащих линкомицин, следует соблюдать надлежащую производственную практику. Это включает в себя соответствующие процедуры очистки, чтобы избежать перекрестного загрязнения. Этот продукт необходимо тщательно смешать с кормом перед использованием. (Требуется только на этикетках премиксов и добавок)
    5. Не позволяйте кроликам, хомякам, морским свинкам, лошадям, молочному скоту или другим жвачным животным доступ к кормам, содержащим линкомицин.Проглатывание этими видами может привести к серьезным желудочно-кишечным последствиям или метаболическим нарушениям (например, кетозу у молочного скота).

    Пункт 3

    В качестве вспомогательного средства для снижения клинической тяжести свиной пролиферативной энтеропатии (леита), связанной с Lawsonia intracellularis.

    Уровень лечебного ингредиента в полноценном корме

    110 мг/кг (0,011%) линкомицина в полноценном корме.

    Инструкции по использованию в комплексном корме

    Этот корм для скота содержит важный с медицинской точки зрения антибиотик.Чтобы уменьшить развитие устойчивости к противомикробным препаратам и сохранить эффективность, используйте этот антибиотик с осторожностью и в течение кратчайшего периода времени, необходимого для достижения желаемого клинического результата.

    Используйте этот лечебный корм в качестве единственного рациона в течение 21 дня.

    Дополнительная информация (не размещать на этикетках корма)

    Для производителей кормов
    Добавить и тщательно перемешать в рационе со следующей скоростью, чтобы получить 110 мг/кг (0,011%) линкомицина на метрическую тонну (1000 кг ) готового (полноценного) корма:

    • 2.5 кг премиксов Lincomix 44, Lincomycin 44 или Lincomycin 44 G
    • 1,0 кг премиксов Lincomix 110, Lincomycin 110 или Lincomycin 110 G
    Предупреждение
    1. Отказ от кормления не требуется при рекомендуемом уровне 110 мг/кг (0,011%) линкомицина в полноценном корме.
    2. Этот продукт может вызывать раздражение кожи и слизистых оболочек человека. При смешивании и обращении с этим лечебным кормом избегайте вдыхания, перорального контакта и прямого контакта с кожей или глазами.Используйте защитную одежду, непроницаемые перчатки и пылезащитную маску. (Требуется только на этикетках премиксов и добавок)
    3. Хранить в недоступном для детей месте. (Требуется только на этикетках премиксов и добавок)
    Осторожно
    1. У пролеченных свиней может развиться некоторое размягчение стула или легкая диарея в течение 36 часов после начала лечения. Признаки легкого раздражения и отека ануса и/или вульвы могут быть связаны с изменениями стула. В редких случаях у некоторых свиней может наблюдаться покраснение кожи и раздражительность.Если эти реакции будут более серьезными, чем описано выше, прекратите использование этого лекарственного корма.
    2. Не использовать для разведения свиней.
    3. Не использовать в кормах, содержащих вещества, связывающие гранулы, за исключением сульфоната лигнина. (Требуется только на этикетках премиксов и добавок)
    4. При приготовлении кормов, содержащих линкомицин, следует соблюдать надлежащую производственную практику. Это включает в себя соответствующие процедуры очистки, чтобы избежать перекрестного загрязнения. Этот продукт необходимо тщательно смешать с кормом перед использованием.(Требуется только на этикетках премиксов и добавок)
    5. Не позволяйте кроликам, хомякам, морским свинкам, лошадям, молочному скоту или другим жвачным животным доступ к кормам, содержащим линкомицин. Проглатывание этими видами может привести к серьезным желудочно-кишечным последствиям или метаболическим нарушениям (например, кетозу у молочного скота).
    Допустимые совместимости

    Линкомицин совместим со следующими комбинациями лекарств/лекарств. В тех случаях, когда существуют различия во времени вывода для совместимых лекарственных ингредиентов, необходимо использовать более длительное время вывода, и это единственное время, которое должно быть указано на этикетке готового корма.Для получения подробной информации обратитесь к MIB , как указано.

    Линкомицин (свиной)
    Название лекарственного ингредиента MIB код Название утвержденного(ых) бренда(ов) Применимые пункты формулы
    Ивермектин ИВР

    Премикс Ivomec для свиней

    Все претензии (выращивание свиней)
    Дата изменения:

    Повышенная продукция линкомицина за счет ко-гиперэкспрессии metK1 и metK2 в Streptomyces lincolnensis | Журнал промышленной микробиологии и биотехнологии

    Аннотация

    Streptomyces lincolnensis обычно используется для производства линкомицина А (Lin-A), клинически применимого антибиотика для лечения грамположительных бактериальных инфекций.Три стадии метилирования, катализируемые тремя различными S -аденозилметионин (SAM)-зависимыми метилтрансферазами, необходимы для биосинтеза Lin-A, и, таким образом, подчеркивают важность снабжения метильной группой в продукции линкомицина. В этом исследовании мы демонстрируем, что SAM с добавками извне не может быть поглощен клетками и, следовательно, не увеличивает выработку Lin-A. Кроме того, биоинформатика и ферментативные анализы in vitro показали, что существуют два гомолога SAM-синтетазы, MetK1 (SLCG_1651) и MetK2 (SLCG_3830) у S.lincolnensis , которые могли превращать L-метионин в SAM в присутствии АТФ. Несмотря на то, что мы пытались инактивировать metK1 и metK2 , только metK2 были удалены в S. lincolnensis LCGL, названном Δ metK2 . После снижения внутриклеточной концентрации SAM мутант Δ metK2 показал значительное снижение Lin-A по сравнению с его родительским штаммом. Индивидуальная сверхэкспрессия metK1 или metK2 в S.lincolnensis LCGL либо повышал количество внутриклеточного SAM, что сопровождалось увеличением продукции Lin-A на 15% и 22% соответственно. Анализы qRT-PCR показали, что сверхэкспрессия либо metK1 , либо metK2 увеличивала транскрипцию генов биосинтеза линкомицина lmbA и lmbR , а также регуляторного гена lmbU , что указывает на то, что SAM может также функционировать как активатор транскрипции. При совместной экспрессии metK1 и metK2 продукция Lin-A увеличивалась на 27% в LCGL и на 17% в высокоурожайном штамме LA219X.

    Дополнительный электронный материал

    Электронная версия этой статьи (10.1007/s10295-018-2029-1) содержит дополнительные материалы, доступные авторизованным пользователям.

    Исправление к этой статье доступно в Интернете по адресу https://doi.org/10.1007/s10295-018-2036-2.

    Введение

    Линкомицин А (Lin-A) широко используется для лечения грамположительных бактериальных инфекций [26], главным образом продуцируемых актиномицетом Streptomyces lincolnensis .Lin-A состоит из предшественника аминосахара α-метилтиолинкозаминида (MTL) и фрагмента производного аминокислоты N -метилированного 4-пропил-1-пролина (PPL) [34]. Lin-A и его полусинтетическое производное клиндамицин относятся к антибиотикам семейства линкозамидов, и клиндамицин может применяться для лечения протозойных заболеваний, например малярии [26]. Учитывая высокую клиническую значимость линкозамидных антибиотиков, повышение продукции линкомицина в S. lincolnensis осуществлялось с помощью генетических манипуляций, ферментационной инженерии или классических методов мутагенеза в течение последних 50 лет [3, 8, 13, 33].

    Кластер генов биосинтеза линкомицина в S. lincolnensis охватывает более 35 т.п.н. ДНК и содержит 29 генов, касающихся биосинтеза, регуляции и устойчивости [11, 19]. В процессе биосинтеза линкомицина необходимо три стадии метилирования по С -, S — и N -положениям соответственно [9, 25]. В предыдущих сообщениях было показано, что метилтрансфераза LmbJ превращает N -деметиллинкомицин в линкомицин, а LmbW участвует в биосинтезе пропилпролина Lin-A с использованием S -аденозилметионина (SAM) в качестве донора метила [14, 18].Было предсказано, что LmbG отвечает за реакцию S -метила [9, 25] (рис. 1). Эти исследования показывают, что запас метильных групп играет жизненно важную роль в биосинтезе линкомицина у S. lincolnensis . Ряд исследований подтвердил, что SAM является важным донором метила как в первичном, так и во вторичном метаболизме [2, 4], а избыточная экспрессия гена SAM-синтетазы metK или экзогенное добавление SAM усиливает продукцию нескольких типов антибиотиков у актиномицетов [2, 4]. 16, 35, 36].Также обнаружено, что SAM активирует факторы транскрипции, которые, в свою очередь, регулируют биосинтез антибиотиков Streptomyces [4, 15, 22, 32]. Мы полностью секвенировали геном продуцента линкомицина S. lincolnensis LC-G и обнаружили, что существуют два гомолога metK , metK1 ( SLCG_1651 ) и metK2 90CG_193 90CG_1989 (9) CP022744 в Генбанке). Недавно Панг и соавт. [18] сообщили, что ко-сверхэкспрессия lmbW и metK увеличивала продукцию и чистоту линкомицина в промышленном штамме S.линкольненсис SyBE2901. Выравнивание последовательностей показало, что зарегистрированный metK из S. lincolnensis SyBE2901 был идентичен metK1 из S. lincolnensis LC-G. Здесь мы сообщаем о функции metK2, , а также metK1, в S. lincolnensis , которую можно использовать для усиления продукции Lin-A.

    Рис. 1

    Структура линкомицина и сайты, метилированные LmbJ, LmbW и LmbG соответственно

    Рис.1

    Структура линкомицина и сайты, метилированные LmbJ, LmbW и LmbG соответственно

    Материалы и методы

    Штаммы, плазмиды и условия роста

    Все штаммы и плазмиды, использованные в этом исследовании, перечислены в Таблице 1. Escherichia coli культивировали в среде Луриа-Бертани (LB) при 37 °C, при встряхивании при 220 об/мин, с добавлением соответствующих антибиотиков по мере необходимости [20]. S. lincolnensis и его производные выращивали при 30°C при встряхивании при 220 об/мин в жидкой среде TSBY (3% триптон-соевый бульон, 0.5 % дрожжевого экстракта, 10,3 % сахарозы, с/без апрамицина или тиострептона) для выделения ДНК или на твердой среде MGM (2 % растворимого крахмала, 0,5 % соевой муки, 0,1 % KNO 3 , 0,05 % NaCl, 0,05 % MgSO 4 , 0,05% K 2 HPO 4 , 0,001% FeSO 4 , 2% агар, с/без апрамицина или тиострептона) для спорообразования. Споры выделяли и хранили в 20% глицерине при -80°C. Жидкая среда SM (0,4 % дрожжевого экстракта, 0,4 % триптонового соевого бульона, 1 % глюкозы, 0,005 % MgSO 4 , 0.02% KH 2 PO 4 , 0,04% K 2 HPO 4 ) использовали для приготовления протопластов S. lincolnensis [6].

    Штаммы и плазмиды, использованные в этом исследовании

    LC-G / pSOK804 Данное исследование + + Это исследование + 91 943 E.coli, + + 9133 3 ORI (PSG5), AAC (3) IV , LACZ metK1 Это исследование + Novagen + Это исследование Это исследование
    Штаммы или плазмиды . Описание . Источники .
    S. lincolnensis
    LC-G CGMCC 7.209, линкомицин-продуцирующий штамм 4 X, Ltd
    +
    LC-G проведения pSOK804
    LC-G / pPM927 LC-G проведения pPM927 Это исследование
    LCGL производный от LC-G с attB ΦC31 сайта вместо SLCG_7011 Это исследование
    Д metK2 Полученных из LCGL с metK2 удален Это исследование
    Δ metK2 / pIB139 Δ metK2 проведения pIB139 Это исследование
    Δ metK2 / pIB139- metK2 Δ metK2 проведения pIB139- metK2 Это исследование 
    LCGL/pIB139  LCGL, несущий pIB139  Это исследование 
    LCGL/pI B139- metK1 LCGL проведения pIB139- metK1 Это исследование
    LCGL / pIB139- metK2 LCGL проведения pIB139- metK2 Это исследование
    LCGL / pIB139- METK1 METK2 LCGL, несущий PIB139- METK1 METK2 Это исследование
    LA219
    LA219 LINCOMYCIN GROD доходность Xinyu Pharmaceutical Co., ООО
    LA219X производный от LA219 с attB ΦC31 сайта вместо SLCG_7011 Это исследование
    LA219X / pIB139- metK1 metK2 LA219X проведение pIB139- metK1 metK2
    DH5 & alpha; F гесА LacZ М15 Invitrogen
    BL21 (DE3) Р — OmpT HSD SB ( Р.Б. тв ) гал ДХМ (DE3) Novagen
    плазмид
    pUCTSR pUCTSRΔ metK2 pUC18, производное Производное pUCTSR для делеции metK2 [7] Это исследование
    pKC1139 [1]
    PKC1139-Δ METK2 PKC1199-4 × atb

    производное pKC1139 для metK2 делеции pKC1139 производной для attB ΦC31 сайт, чтобы заменить SLCG_7011 Это исследование Это исследование
    pIB139 ΦC31 ATTP INT локус, согласно (3) И.В. , Orit , Р ERME * промотор [29]
    девяносто одна тысяча триста двадцать-девять pIB139- pIB139 производное для экспрессии metK1
    девяносто одна тысяча триста двадцать-девять pIB139 — metK2 pIB139- metK1 metK2   производное pIB139 для экспрессии metK2 производное pIB139 для совместной сверхэкспрессии Sion of Metk1 и METK2 Это изучение этого исследования
    PSOK804 PPM927 ORI , AAC (3) IV , AAC (3) IV , AAC VWB — ATTP INT LOCUS , TSR , Orit [21] [24]
    pET28a кан , P Т7 , His-метки
    pET28a- metK1 производное pET28a для экспрессии metK1
    pET28a- metK2 производное pET28a для экспрессии metK2
    Это исследование + 91 943 E.coli, + + 9133 3 ORI (PSG5), AAC (3) IV , LACZ metK1 Это исследование Novagen Это исследование Это исследование
    штаммов или плазмид . Описание . Источники . +
    S. lincolnensis 91 198
    LC-G CGMCC 7,209, A линкомицин штамм-продуцент Xinyu Фармасьютикал Ко, Лтд
    LC-G / pSOK804 LC-G проведения pSOK804 Данное исследование
    LC-G / pPM927 LC-G проведения pPM927 Это исследование
    LCGL Производное от LC-G с attB ΦC31 сайт вместо SLCG_7011 Это исследование
    Δ metK2 Полученных из LCGL с metK2 удален Это исследование
    Δ metK2 / pIB139 Δ metK2 носитель pIB139 Это исследование
    Δ metK2 /pIB139- metK2   Δ metK2 9119 9 проведения pIB139- metK2 Это исследование
    LCGL / pIB139 LCGL проведения pIB139 Это исследование
    LCGL / pIB139- metK1 LCGL проведения pIB139- metK1 Этот исследование
    LCGL / pIB139- metK2 LCGL балансовую pIB139- metK2 Это исследование
    LCGL / pIB139- metK1 metK2 LCGL проведения pIB139- metK1 metK2   Это исследование
    LA219 Высокопроизводительный штамм линкомицина Xinyu Pharmaceutical Co., ООО
    LA219X производный от LA219 с attB ΦC31 сайта вместо SLCG_7011 Это исследование
    LA219X / pIB139- metK1 metK2 LA219X проведение pIB139- metK1 metK2
    DH5 & alpha; F гесА LacZ М15 Invitrogen
    BL21 (DE3) Р — OmpT HSD SB ( Р.Б. тв ) гал ДХМ (DE3) Novagen
    плазмид
    pUCTSR pUCTSRΔ metK2 pUC18, производное Производное pUCTSR для делеции metK2 [7] Это исследование
    pKC1139 [1]
    PKC1139-Δ METK2 PKC1199-4 × atb

    производное pKC1139 для metK2 делеции pKC1139 производной для attB ΦC31 сайт, чтобы заменить SLCG_7011 Это исследование Это исследование
    pIB139 ΦC31 ATTP INT локус, согласно (3) И.В. , Orit , Р ERME * промотор [29]
    девяносто одна тысяча триста двадцать-девять pIB139- pIB139 производное для экспрессии metK1
    девяносто одна тысяча триста двадцать-девять pIB139 — metK2 pIB139- metK1 metK2   производное pIB139 для экспрессии metK2 производное pIB139 для совместной сверхэкспрессии Sion of Metk1 и METK2 Это изучение этого исследования
    PSOK804 PPM927 ORI , AAC (3) IV , AAC (3) IV , AAC VWB — ATTP INT LOCUS , TSR , Orit [21] [24]
    pET28a кан , P Т7 , His-метки
    pET28a- metK1 производное pET28a для экспрессии metK1
    + pET28a- metK2 производное pET28a для экспрессии metK2

    Штаммы и плазмиды использовали в этом исследовании

    Это исследование + 91 943 E.coli, + + 9133 3 ORI (PSG5), AAC (3) IV , LACZ metK1 Это исследование + Novagen + Это исследование Это исследование
    Штаммы или плазмиды . Описание . Источники . +
    S. lincolnensis 91 198
    LC-G CGMCC 7,209, A линкомицин штамм-продуцент Xinyu Фармасьютикал Ко, Лтд
    LC-G / pSOK804 LC-G проведения pSOK804 Данное исследование
    LC-G / pPM927 LC-G проведения pPM927 Это исследование
    LCGL Производное от LC-G с attB ΦC31 сайт вместо SLCG_7011 Это исследование
    Δ metK2 Полученных из LCGL с metK2 удален Это исследование
    Δ metK2 / pIB139 Δ metK2 носитель pIB139 Это исследование
    Δ metK2 /pIB139- metK2   Δ metK2 9119 9 проведения pIB139- metK2 Это исследование
    LCGL / pIB139 LCGL проведения pIB139 Это исследование
    LCGL / pIB139- metK1 LCGL проведения pIB139- metK1 Этот исследование
    LCGL / pIB139- metK2 LCGL балансовую pIB139- metK2 Это исследование
    LCGL / pIB139- metK1 metK2 LCGL проведения pIB139- metK1 metK2   Это исследование
    LA219 Высокопроизводительный штамм линкомицина Xinyu Pharmaceutical Co., ООО
    LA219X производный от LA219 с attB ΦC31 сайта вместо SLCG_7011 Это исследование
    LA219X / pIB139- metK1 metK2 LA219X проведение pIB139- metK1 metK2
    DH5 & alpha; F гесА LacZ М15 Invitrogen
    BL21 (DE3) Р — OmpT HSD SB ( Р.Б. тв ) гал ДХМ (DE3) Novagen
    плазмид
    pUCTSR pUCTSRΔ metK2 pUC18, производное Производное pUCTSR для делеции metK2 [7] Это исследование
    pKC1139 [1]
    PKC1139-Δ METK2 PKC1199-4 × atb

    производное pKC1139 для metK2 делеции pKC1139 производной для attB ΦC31 сайт, чтобы заменить SLCG_7011 Это исследование Это исследование
    pIB139 ΦC31 ATTP INT локус, согласно (3) И.В. , Orit , Р ERME * промотор [29]
    девяносто одна тысяча триста двадцать-девять pIB139- pIB139 производное для экспрессии metK1
    девяносто одна тысяча триста двадцать-девять pIB139 — metK2 pIB139- metK1 metK2   производное pIB139 для экспрессии metK2 производное pIB139 для совместной сверхэкспрессии Sion of Metk1 и METK2 Это изучение этого исследования
    PSOK804 PPM927 ORI , AAC (3) IV , AAC (3) IV , AAC VWB — ATTP INT LOCUS , TSR , Orit [21] [24]
    pET28a кан , P Т7 , His-метки
    pET28a- metK1 производное pET28a для экспрессии metK1
    pET28a- metK2 производное pET28a для экспрессии metK2
    S. 91 943 lincolnensis Это исследование + 91 943 E.coli, + + 9133 3 ORI (PSG5), AAC (3) IV , LACZ metK1 Это исследование Novagen Это исследование Это исследование
    штаммов или плазмид . Описание . Источники . 91 319
    LC-G CGMCC 7,209, A линкомицин штамм-продуцент Xinyu Фармасьютикал Ко, Лтд
    LC-G / pSOK804 LC-G проведения pSOK804 Данное исследование
    LC-G / pPM927 LC-G проведения pPM927 Это исследование
    LCGL Производное от LC-G с attB ΦC31 сайт вместо SLCG_7011 Это исследование
    Δ metK2 Полученных из LCGL с metK2 удален Это исследование
    Δ metK2 / pIB139 Δ metK2 носитель pIB139 Это исследование
    Δ metK2 /pIB139- metK2   Δ metK2 9119 9 проведения pIB139- metK2 Это исследование
    LCGL / pIB139 LCGL проведения pIB139 Это исследование
    LCGL / pIB139- metK1 LCGL проведения pIB139- metK1 Этот исследование
    LCGL / pIB139- metK2 LCGL балансовую pIB139- metK2 Это исследование
    LCGL / pIB139- metK1 metK2 LCGL проведения pIB139- metK1 metK2   Это исследование
    LA219 Высокопроизводительный штамм линкомицина Xinyu Pharmaceutical Co., ООО
    LA219X производный от LA219 с attB ΦC31 сайта вместо SLCG_7011 Это исследование
    LA219X / pIB139- metK1 metK2 LA219X проведение pIB139- metK1 metK2
    DH5 & alpha; F гесА LacZ М15 Invitrogen
    BL21 (DE3) Р — OmpT HSD SB ( Р.Б. тв ) гал ДХМ (DE3) Novagen
    плазмид
    pUCTSR pUCTSRΔ metK2 pUC18, производное Производное pUCTSR для делеции metK2 [7] Это исследование
    pKC1139 [1]
    PKC1139-Δ METK2 PKC1199-4 × atb

    производное pKC1139 для metK2 делеции pKC1139 производной для attB ΦC31 сайт, чтобы заменить SLCG_7011 Это исследование Это исследование
    pIB139 ΦC31 ATTP INT локус, согласно (3) И.В. , Orit , Р ERME * промотор [29]
    девяносто одна тысяча триста двадцать-девять pIB139- pIB139 производное для экспрессии metK1
    девяносто одна тысяча триста двадцать-девять pIB139 — metK2 pIB139- metK1 metK2   производное pIB139 для экспрессии metK2 производное pIB139 для совместной сверхэкспрессии Sion of Metk1 и METK2 Это изучение этого исследования
    PSOK804 PPM927 ORI , AAC (3) IV , AAC (3) IV , AAC VWB — ATTP INT LOCUS , TSR , Orit [21] [24]
    pET28a кан , P Т7 , His-метки
    pET28a- metK1 производное pET28a для экспрессии metK1
    pET28a- metK2 91 198 производное pET28a для экспрессии metK2

    Ферментация и ВЭЖХ-анализ Lin- А

    Streptomyces lincolnensis LC-G и его производные выращивали на MGM для спорообразования (с соответствующими антибиотиками для рекомбинантных штаммов).Споровую суспензию инокулировали в колбу на 250 мл, содержащую 30 мл посевной среды (2 % растворимого крахмала, 1 % глюкозы, 1 % соевой муки, 3 % сливочной кукурузы, 0,15 % (NH 4 ) 2 SO 4 , 0,4% CaCO 3 для культивирования, с/без апрамицина) при 30 °C при встряхивании при 240 об/мин в течение 2 дней. 2 мл посевной культуры переносили в 30 мл ферментационной среды (10% глюкозы, 2% соевой муки, 0,15% кремовой кукурузы, 0,8% NaNO 3 , 0,5% NaCl, 0,6% (NH 4 ) 2 SO 4 , 0.03% K 2 HPO 4 , 0,8% CaCO 3 , с/без апрамицина). Все ферментационные культуры инкубировали при 30°C и 240 об/мин в течение 7 дней. После ферментации 200 мкл супернатанта ферментационного бульона смешивали с 800 мкл этанола и центрифугировали при 12000 об/мин в течение 10 минут для удаления остатка. Впоследствии линкомицин, экстрагированный из этих жидких ферментационных культур, был количественно определен с помощью системы УЭЖХ Waters h23CHA 394G на колонке Extend-C18 (5 мкм, 150 × 4,6 мм), которая была уравновешена 60% метиловым спиртом и 40% 5 мМ ацетатом аммония (рН 9). .0). Продукты контролировали при 214 нм. Изократическую программу выполняли при скорости потока 0,4 мл/мин.

    Экзогенное добавление SAM в культуральную среду

    Streptomyces lincolnensis LC-G инкубировали при 30 °C, 240 об/мин в ферментационной среде, как описано выше. SAM добавляли в ферментационную среду S. lincolnensis LC-G через 12 часов инокуляции в конечной концентрации 0, 0,1, 0,5, 1 и 2 мМ соответственно.

    Клонирование, экспрессия и очистка MetK1 и MetK2 в штамме

    E.кишечная палочка

    Два фрагмента ДНК, кодирующие MetK1 и MetK2 из LC-G, были получены с помощью ПЦР с использованием праймеров, указанных в таблице S1. Продукты ПЦР расщепляли рестрикционными ферментами Nde I /Eco RI и вставляли в соответствующие сайты pET-28a (Novagen), получая слияния N-концевых His 6 -меток. Сконструированные плазмиды pET28a-MetK1 и pET28a-MetK2 соответственно вводили в штаммов E. coli BL21 (DE3) и индуцировали экспрессию двух белков с помощью IPTG в конечной концентрации 0.5 мМ при 16 °C в течение 20 часов. Белки MetK1 и MetK2, меченные His 6 , экстрагировали и очищали на спин-колонке Ni 2+ –NTA (BIO-RAD). Концентрации очищенных белков определяли количественно с помощью анализов BCA, а их чистоту оценивали с помощью анализа электрофореза в полиакриламидном геле с додецилсульфатом натрия (SDS-PAGE).

    Анализ ферментативной активности MetK1 и MetK2

    Активность MetK1 и MetK2 анализировали, как сообщалось Oh et al.[15]. Вкратце, белок MetK1 или MetK2 инкубировали в течение 2 часов при 37 °C в реакционной смеси (100 мкл), содержащей 0,1 мМ трис/HCl (pH 8,2), 5 мМ АТФ, 5 мМ 1-метионин, 200 мМ KCl и 10 мМ. мМ MgCl 2 . Контроль проводили без MetK1 и MetK2 или без АТФ и l-метионина. Все реакции останавливали, немедленно помещая реакционные сосуды в смесь льда и воды. Реакционные смеси с остановкой реакции анализировали с помощью системы УЭЖХ Waters h23CHA 394G на колонке Extend-C18 (5 мкм, 250 × 4.6 мм), который уравновешивали 100 мМ фосфатным буфером при pH 6,8 (фаза A) и метанолом (фаза B) в соотношении 80:20 ( об./об. ). Продукты контролировали при 254 нм. Изократическую программу выполняли при скорости потока 0,5 мл/мин. Кроме того, определяли кинетические параметры при постоянной концентрации АТФ (10 мМ). Концентрация l-метионина варьировалась от 0 до 5 мМ. Скорость была построена как функция различной концентрации субстрата, и данные были приспособлены к уравнению Михаэлиса-Ментен для расчета значений Km и Vmax [5].

    Определение внутриклеточной/внеклеточной концентрации SAM

    Уровни внутриклеточного и внеклеточного SAM определяли, как описано Oh et al. [15]. Во время ферментации S. lincolnensis LC-G и его производных с дополнительным SAM или без него (2, 4 и 6 дней) 1 мл ферментационного бульона центрифугировали при 5000 об/мин в течение 10 мин. Супернатант наносили непосредственно на UPLC для определения внеклеточной концентрации SAM. После удаления супернатанта внутриклеточный SAM экстрагировали 0.5 мл 1 М муравьиной кислоты при 4 °C в течение 1 часа. После центрифугирования при 12 000 об/мин в течение 15 мин экстрагированный SAM был количественно определен с помощью UPLC с использованием того же метода, что и выше.

    Конструкция

    S. lincolnensis LCGL

    Для использования интегративного вектора pIB139 на основе ΦC31 [31] в Sangon Biotech (Shanghai) Co., Ltd был синтезирован фрагмент ДНК длиной 240 п.н., содержащий четыре тандемных сайта ΦC31 attB [30]. Последовательность была следующей: ААА GAATTC CTTCTC TCTAGA CGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGT GGATCC CTGGAG AAGCTT ААА ( Eco RI / Хва Я и Bam HI / Hin сайты рестрикции DIII были выделены курсивом, и четыре последовательности attB были подчеркнуты).Используя геномную ДНК S. lincolnensis LC-G в качестве матрицы, два фрагмента ДНК длиной 2,0 т.п.н., фланкирующие SLCG_7011 , предположительно кодирующие нерибосомную пептидную синтетазу (NRPS), амплифицировали с помощью ПЦР с использованием двух пар праймеров attB-P1/attB-P2 и attB-P3/attB-P4 (таблица S1). Продукты ПЦР и синтетические 4 × attb ΦC31 были соответственно, перевариваются с ECO RI / KPN I, XBA I / HIN DIII и XBA I / Kpn I, а затем лигировали в соответствующие сайты pKC1139, получая pKC1139-4 ×  attB ΦC31 .С помощью PEG3350-опосредованной трансформации протопластов в LC-G вводили pKC1139-4 ×  attB ΦC31 . После двух круглых гомологичной хромосомной рекомбинации, желаемый мутант с 4 × атт. ΦC31 ΦC31 9119 SLCG_7011 , названный как S. LincolNensis LCGL, был получен и дополнительно подтвержден анализом ПЦР с использованием праймеров -P5/attB-P6 (таблица S1).

    В соответствии с вышеуказанными процедурами мы построили S.lincolnensis LA219X, содержащий 4 ×  attB ΦC31 из высокоурожайного S. lincolnensis LA219.

    Инактивация, комплементация и сверхэкспрессия

    metK1 и metK2 в S. lincolnensis

    Мы испробовали множество методов, чтобы разрушить ген metK1 как в S. lincolnensis LC-G, так и в LCGL, но безуспешно, в то время как получить мутанты Δ metK2 было очень легко.

    Плазмида pKC1139-Δ metK2 с внутренней делецией 717 пар оснований metK2 была сконструирована в два этапа. Во-первых, используя геномную ДНК LC-G в качестве матрицы, два фрагмента длиной 1,5 т.п.н., фланкирующие metK2 , соответственно, амплифицировали с помощью ПЦР с использованием двух пар праймеров metK2-P1/metK2-P2 и metK2-P3/metK2-P4 ( Таблица S1), расщепленные Hin dIII/ Xba I и Kpn I/ Eco RI и лигированные в соответствующие сайты pUCTSR [7], с получением pUCTSR-Δ metK2 .Во-вторых, фрагмент ДНК размером 4,5 т.п.н. расщепляли с помощью Eco RI/ Hin dIII из pUCTSR-Δ metK2 , а затем клонировали в тот же сайт pKC1139 [1], генерируя pKC1139-Δ metK2 . С помощью PEG3350-опосредованной трансформации протопластов в LCGL вводили pKC1139-Δ metK2 . Путем гомологичной хромосомной рекомбинации фрагмент 717 п.н. гена metK2 был заменен геном устойчивости к тиострептону ( tsr ) в S. lincolnensis LCGL.Желаемый мутант Δ metK2 был дополнительно подтвержден с помощью ПЦР-амплификации с использованием праймеров metK2-P5 и metK2-P6 (таблица S1). Для комплементации metK2 в мутанте Δ metK2 1221 п.н. metK2 амплифицировали с праймерами metK2-P7 и metK2-P8 (таблица S1), расщепленными Nde I

    8/Xba I,
    и лигировали в соответствующие сайты pIB139, получая pIB139- metK2 . Затем pIB139 и pIB139- metK2 были индивидуально введены в мутант Δ metK2 , и соответствующие устойчивые к апрамицину Δ metK2 /pIB139 и Δ metK2 /pIB139- met9 были получены и дополнительно подтверждены с помощью ПЦР/pIB139-

    met9199. с праймерами apr-P1 и apr-P2 соответственно (таблица S1).

    Между тем, 1209 п.н. metK1 амплифицировали с праймерами metK1-P1 и metK1-P2 (таблица S1), расщепляли Nde I /Xba I и лигировали в соответствующие сайты pIB139, генерируя pIB139- метК1 . pIB139- metK1 и pIB139- metK2 вводили в LCGL для сверхэкспрессии metK1 и metK2 соответственно.

    Для совместной сверхэкспрессии metK1 и metK2 фрагмент metK2 с промотором PermE* амплифицировали из pIB139- metK2 с использованием праймеров metK2-P11 и cutable Not I/ Eco RV и лигировали с соответствующим сайтом pIB139- metK1 , образуя pIB139- metK1 metK2 .Тогда Co-Expression вектор PIB139- METK1 METK2 METK2 был введен в LCGL и LA219X для генерации штаммов LCGL / PIB139- METK1 METK2 и LA219X / PIB139- METK1 METK2 , соответственно .

    Выделение РНК и количественный ПЦР в реальном времени (qRT-PCR)

    Относительные уровни транскрипции lmbA , lmbR и lmbU определяли с помощью анализа qRT-PCR.Конкретные праймеры были разработаны, как указано в Таблице S1. Тотальную РНК выделяли из S. lincolnensis LCGL и его производных через 24 ч, выращенных в ферментационной жидкой среде с использованием набора для выделения/очистки РНК (SBS), и концентрацию РНК определяли с помощью устройства для считывания микропланшетов (BioTek). Выделенную РНК (500 нг) обрабатывали ДНКазой I (MBI Fermentas), а затем реверсировали с использованием набора для синтеза кДНК (MBI Fermentas). qRT-PCR выполняли на системе Applied Biosystems QuantStudio 6 Flex с помощью Maxima™ SYBR Green/ROX qPCR Master Mix (MBI Fermentas).Ген rpoD в S. lincolnensis использовали в качестве внутреннего контроля, и относительную транскрипцию определяли количественно с использованием сравнительного метода порога цикла [12].

    Результаты

    Добавление SAM в культуральную среду не может увеличить продукцию Lin-A

    Поскольку SAM является основным донором метила в микробных клетках, мы первоначально исследовали влияние экзогенного добавления SAM на продукцию линкомицина. При конечных концентрациях SAM от 0.От 1 мМ до 2 мМ в культуральной среде продукция Lin-A LC-G оставалась неизменной (рис. 2a). Кроме того, мы обнаружили, что внеклеточная концентрация SAM в целом оставалась постоянной на протяжении ферментации LC-G (рис. 2b). Кроме того, внутриклеточная концентрация SAM не менялась в зависимости от увеличения количества дополнительно добавленного SAM (рис. 2c). Эти результаты предполагают, что SAM не может транспортироваться через мембрану клеток S. lincolnensis .

    Рис. 2

    Влияние экзогенного добавления SAM на продукцию Lin-A у S.lincolnensis LC-G. — продукция Lin-A после добавления SAM с различными конечными концентрациями (0, 0,1, 0,5, 1, 2) по анализу UPLC. b Внеклеточные концентрации SAM при различном экзогенном добавлении SAM после 2, 4 и 6 дней инкубации. c Внутриклеточные концентрации SAM при различном экзогенном добавлении SAM после 2, 4 и 6 дней инкубации. Были показаны средние значения как минимум трех независимых экспериментов со стандартным отклонением, указанным планками погрешностей

    Рис.2

    Влияние добавления экзогенного SAM на продукцию Lin-A в S. lincolnensis LC-G. — продукция Lin-A после добавления SAM с различными конечными концентрациями (0, 0,1, 0,5, 1, 2) по анализу UPLC. b Внеклеточные концентрации SAM при различном экзогенном добавлении SAM после 2, 4 и 6 дней инкубации. c Внутриклеточные концентрации SAM при различном экзогенном добавлении SAM после 2, 4 и 6 дней инкубации. Были показаны средние значения по меньшей мере трех независимых экспериментов со стандартным отклонением, указанным планками погрешностей

    И MetK1, и MetK2 ферментативно превращают l-метионин в SAM в присутствии АТФ

    Выравнивание геномных последовательностей S.lcolnensis lc-g (номер вступления CP022744 в Генбанке) и другие Streptomyces штаммов, существуют два гена Sam синтетазы, SLCG_1651 ( METK1 ) и SLCG_3830 ( METK2 ), с высоким сходством с другими гены metK , такие как SCO1476 из S. coelicolor A3(2) (93,5 и 81,5% идентичностей) и SAV_6874 из S. avermitilis MA4680 (93,5 и 83% идентичностей).

    Чтобы проверить, обладают ли MetK1 и MetK2 из LC-G активностью синтетазы SAM, их последовательно экспрессировали и очищали (рис. 3a). Как показано в профилях UPLC, как MetK1, так и MetK2 могут превращать l-метионин в SAM в присутствии АТФ (рис. 3b).

    Рис. 3

    Ферментативный анализ MetK1 и MetK2. a Очистка его 6 с меткой MetK1 и его 6 с меткой MetK2. Сокращения: М – маркер молекулярной массы белка; 1 — очищенный белок MetK1; 2, очищенный белок MetK2. b И MetK1, и MetK2 превращали АТФ и l-метионин в SAM. Реакцию либо с MetK1, либо с MetK2 проводили в смеси АТФ, 1-метионина, KCl и MgCl 2 . 1, KCl, MgCl 2 и MetK1 или MetK2; 2, АТФ, 1-метионин, KCl и MgCl 2 ; 3, АТФ, 1-метионин, KCl, MgCl 2 и MetK1; 4, АТФ, 1-метионин, KCl, MgCl 2 и MetK2; 5, стандартный SAM (время удерживания = 6,9 мин)

    Рис. 3

    Ферментативный анализ MetK1 и MetK2. a Очистка его 6 с меткой MetK1 и его 6 с меткой MetK2. Сокращения: М – маркер молекулярной массы белка; 1 — очищенный белок MetK1; 2, очищенный белок MetK2. b И MetK1, и MetK2 превращали АТФ и l-метионин в SAM. Реакцию либо с MetK1, либо с MetK2 проводили в смеси АТФ, 1-метионина, KCl и MgCl 2 . 1, KCl, MgCl 2 и MetK1 или MetK2; 2, АТФ, 1-метионин, KCl и MgCl 2 ; 3, АТФ, 1-метионин, KCl, MgCl 2 и MetK1; 4, АТФ, 1-метионин, KCl, MgCl 2 и MetK2; 5, стандартный SAM (время удерживания  = 6.9 мин)

    Кроме того, для определения кинетических констант MetK1 и MetK2 использовали уравнение Михаэлиса-Ментен, демонстрирующее значения Km и V max , равные 3,42 мМ и 4,12 мкмоль/л/мин для MetK1, и 2,14 мМ и 4,88. мкмоль/л/мин для MetK2. MetK2 обладал более высокой каталитической активностью, чем MetK1.

    Сверхэкспрессия

    metK1 увеличивает продукцию Lin-A в S. lincolnensis LCGL

    Учитывая, что в геноме S. lincolnensis LC-G отсутствует типичный сайт attB для интеграции вектора pIB139 на основе ΦC31, мы сконструировали новый S.lincolnensis LCGL из LC-G путем замены SLCG_7011 на 4 ×  attB ΦC31 . Между LCGL и LC-G не наблюдалось существенных различий в росте клеток, морфологической дифференцировке и продукции линкомицина (рис. S1).

    Из-за неоднократных неудач при удалении гена metK1 в LC-G и LCGL мы предполагаем, что MetK1 может иметь важное значение для роста LC-G. Для исследования роли гена metK1 в биосинтезе линкомицина плазмиду pIB139- metK1 трансформировали в S.lincolnensis LCGL. По сравнению с контрольным LCGL/pIB139, LCGL/pIB139- metK1 последовательно демонстрировал 1,8-, 2,5- и 1,8-кратное увеличение внутриклеточных концентраций SAM в течение периодов инкубации 2, 4 и 6 дней (рис. 4a). В соответствии с увеличением внутриклеточного SAM, LCGL/pIB139- metK1 показал 15% ( p  4b). Эти результаты показывают, что сверхэкспрессия metK1 в LCGL приводит к увеличению внутриклеточной концентрации SAM и продукции Lin-A.

    Рис. 4

    Сверхэкспрессия metK1 увеличивает выход Lin-A в S. lincolnensis LCGL. a Внутриклеточные концентрации SAM LCGL/pIB139 и LCGL/pIB139- metK1.   b Lin-A производство LCGL/pIB139 и LCGL/pIB139- metK1 . Были показаны средние значения не менее чем в трех повторностях со стандартным отклонением, указанным планками погрешностей. Рис. 4lincolnensis LCGL. a Внутриклеточные концентрации SAM LCGL/pIB139 и LCGL/pIB139- metK1.   b Lin-A производство LCGL/pIB139 и LCGL/pIB139- metK1 . Были показаны средние значения не менее чем в трех повторностях со стандартным отклонением, указанным планками погрешностей. *p  < 0,05, **p  < 0,01

    Сверхэкспрессия

    metK2 увеличивает продукцию Lin-A в S. lincolnensis LCGL Чтобы выяснить, участвует ли metK2 в биосинтезе линкомицина, он был разрушен в S.lincolnensis LCGL через замену tsr , а полученный мутант Δ metK2 был подтвержден анализом ПЦР (рис. 5а, б). Как показано на рис. 5c, внутриклеточные концентрации SAM Δ metK2 снизились примерно на 31, 42 и 50% после 2, 4 и 6 дней ферментации по сравнению с исходным штаммом LCGL соответственно (рис. 5c). Соответственно, Δ metK2 имел снижение выхода Lin-A на 55% после 7-дневной ферментации, с 2,2 до 1,0 г/л ( p metK2 с pIB139- metK2 восстановил продукцию Lin-A (рис. .5г). Δ metK2 продемонстрировал сходную скорость роста в жидкой среде YMG и скорость спорообразования на агаровой среде MGM со своим исходным штаммом S. lincolnensis LCGL, что указывает на то, что MetK2 не участвует в росте клеток и морфологической дифференцировке S. lincolnensis (рис. С2).

    Рис. 5

    Влияние инактивации и сверхэкспрессии metK2 на продукцию Lin-A в S. lincolnensis LCGL. a Схематическая делеция metK2 в LCGL. b ПЦР-подтверждение мутанта Δ metK2 с использованием праймеров metK2-P5 и metK2-P6. Полоса 750 п.н. наблюдалась с LCGL, тогда как полоса 1500 п.н. была обнаружена с Δ metK2 . c Внутриклеточные концентрации SAM в LCGL, Δ metK2 , LCGL/pIB139 и LCGL/pIB139- metK2 , культивируемых в течение 2, 4 или 6 дней. d Продукция Lin-A в LCGL и его производных, культивируемых в течение 7 дней. Были показаны средние значения как минимум трех независимых экспериментов со стандартным отклонением, указанным планками погрешностей. * P <0,05, ** P <0,01, * 0,01, *** P <0,001

    Рис. 5

    Рис. 5

    Эффект инактивации и сверхэкспрессии METK2 на Лин-А производство в S. Lincolnensis LCGL. a Схематическая делеция metK2 в LCGL. b ПЦР-подтверждение мутанта Δ metK2 с использованием праймеров metK2-P5 и metK2-P6. Полоса 750 п.н. наблюдалась с LCGL, тогда как полоса 1500 п.н. была обнаружена с Δ metK2 . c Внутриклеточные концентрации SAM в LCGL, Δ metK2 , LCGL/pIB139 и LCGL/pIB139- metK2 , культивируемых в течение 2, 4 или 6 дней. d Продукция Lin-A в LCGL и его производных, культивируемых в течение 7 дней. Были показаны средние значения как минимум трех независимых экспериментов со стандартным отклонением, указанным планками погрешностей. *p  < 0,05, **p  < 0,01, ***p  < 0,001

    Для дальнейшего исследования участия MetK2 в биосинтезе линкомицина, metK2 9119 сверхэкспрессировали в GL 9111.Как показано на рис. 5c, уровни внутриклеточного SAM в LCGL/pIB139- metK2 были соответственно повышены в 2,6, 3,0 и 2,2 раза в течение инкубационного периода 2, 4 и 6 дней по сравнению с таковой у LCGL/pIB139 (рис. 5c). В соответствии с повышенным количеством внутриклеточного SAM выход Lin-A LCGL/pIB139- metK2 увеличился на 22% ( p  < 0,001) на седьмой день по сравнению с LCGL/pIB139 (рис. 5d). Эти данные еще раз подтверждают, что MetK2, безусловно, участвует в биосинтезе SAM, дополнительно усиливая продукцию Lin-A у S.линкольненсис .

    MetK1 и MetK2 способствуют транскрипции генов, участвующих в биосинтезе и регуляции Lin-A у

    S. lincolnensis Поскольку было обнаружено, что SAM действует как внутриклеточная сигнальная молекула для регуляции биосинтеза антибиотика у Streptomyces независимо от его роли в качестве донора метила [4, 36], мы измерили транскрипты lmbA ( SLCG_0227 , Lin- Ген биосинтеза, кодирующий гамма-глутамилтрансферазу), lmbR ( SLCG_0245 , ген биосинтеза Lin-A, кодирующий трансальдолазу) и lmbU ( SLCG_0253 , положительный регуляторный ген, контролирующий биосинтез Lin-A) с помощью количественной ПЦР. .Уровни транскрипции lmbA , lmbR и lmbU в LCGL/pIB139- metK1 , соответственно, увеличились в 1,75, 1,83 и 2,2 раза через 24 ч по сравнению с уровнями в LCGL/pIB139, в то время как уровни транскрипции lmbA , lmbR и lmbU в штамме metK2 со сверхэкспрессией повысились в 5,5, 3,7 и 6,1 раза (рис. 6). Эти результаты демонстрируют, что SAM, несомненно, действует как сигнальная молекула, способствующая транскрипции генов биосинтеза линкомицина у S.линкольненсис . Кроме того, MetK2 вносит более значительный вклад, чем MetK1.

    Рис. 6

    Сверхэкспрессия metK1 или metK2 усиливает транскрипцию lmbA , lmbR и lmbU в S. S. lincolnensis. qRT-PCR использовали для количественного определения уровней транскрипции lmbA , lmbR и lmbU в культуральной среде LCGL/pIB139, LCGL/pIB139- metK1 и LCGL/pIB139- в среде для культивирования h metK2 .Были показаны средние значения как минимум трех независимых экспериментов со стандартным отклонением, указанным планками погрешностей. * P <0,05, ** P <0,01

    Рис. 6

    Переместительность METK1 или METK2 Улучшает транскрипцию LMBA , LMBR и LMBU в S. LINCOLNENSIS . qRT-PCR использовали для количественного определения уровней транскрипции lmbA , lmbR и lmbU в культуральной среде LCGL/pIB139, LCGL/pIB139- metK1 и LCGL/pIB139- в среде для культивирования h metK2 .Были показаны средние значения как минимум трех независимых экспериментов со стандартным отклонением, указанным планками погрешностей. *p  < 0,05, **p  < 0,01

    Ко-сверхэкспрессия

    metK1 и metK2 дальнейшее увеличение выхода Lin-A у S. lincolnensis

    3
    3
    3 Для дальнейшего улучшения продукции линкомицина metK1 и metK2 ко-оверэкспрессировали в LCGL. Выход Lin-A LCGL/pIB139- metK1 metK2 был заметно увеличен на 27% ( p  7a).

    Рис. 7

    Совместная сверхэкспрессия metK1 и metK2 повышает выход Lin-A в S. lincolnensis . a Lin-A производство LCGL/pIB139 (контроль) и LCGL/pIB139- metK1 metK2 (SLCGL-K1-K2). b Lin-A производство LA219X/pIB139 (контроль) и LA219X/pIB139- metK1 metK2 (SLA219X-K1-K2). Были показаны средние значения не менее чем в трех повторностях со стандартным отклонением, указанным планками погрешностей. **p  < 0,01

    Рис. 7

    Совместная сверхэкспрессия metK1 и metK2 улучшает выход Lin-A в S. lincolnensis . a Lin-A производство LCGL/pIB139 (контроль) и LCGL/pIB139- metK1 metK2 (SLCGL-K1-K2). b Lin-A производство LA219X/pIB139 (контроль) и LA219X/pIB139- metK1 metK2 (SLA219X-K1-K2). Были показаны средние значения не менее чем в трех повторностях со стандартным отклонением, указанным планками погрешностей. **p  < 0,01

    Для изучения применимости и универсальности совместной сверхэкспрессии metK1 и metK2 для увеличения продукции Lin-A, pIB139- metK1

    8 metK9 был введен выход S. lincolnensis штамм LA219X. Как и ожидалось, LA219X/pIB139- metK1 metK2 (2,92 г/л) показал 17% ( p  < 0,01) улучшение продукции Lin-A по сравнению с LA129X/pIB139 (2,5 г/л) при культивировании в 30 мл промышленной ферментационной среды на 7 дней (рис.7б). Вполне вероятно, что совместная сверхэкспрессия metK1 и metK2 в других промышленных штаммах S. lincolnensis будет иметь значительную коммерческую ценность.

    Обсуждение

    Хотя плазмиды pPM927 и pSOK804, содержащие сайты интеграции фага VWB и pSAM2, широко использовались в области исследования актиномицетов [17, 24, 27, 28], мы обнаружили, что выходы Lin-A были снижены примерно на 50%, когда они были введены в S.lincolnensis LC-G (рис. S1C), что указывает на то, что они не подходят для инженерно-промышленных штаммов S. lincolnensis . Из-за отсутствия сайта ΦC31 attB в геноме S. lincolnensis LC-G мы использовали гомологичную рекомбинацию для замены SLCG_7011, , предположительно кодирующих нерибосомную пептидную синтетазу (NRPS), на сайты ΦC31 attB. Полученный мутант LCGL демонстрировал аналогичный рост клеток, морфологическую дифференцировку и продукцию линкомицина по сравнению с LC-G (фиг.S1D, Е и F). Когда pIB139 вводили в LCGL, это не оказывало влияния на продукцию линкомицина (рис. S1D), что указывает на то, что штамм LCGL подходит для плазмид с сайтами ΦC31 attB для экспрессии гетерологичных генов.

    Обоснование использования последовательности attB заключается в том, что интеграза фага ΦC31 катализирует сайт-специфический обмен с образованием стабильных мутантов [23]. Для интеграции сайт attB подвергается рекомбинации с сайтом фага attP плазмиды, полученной из pSET152, с образованием гибридных сайтов attL и attR .Только attL и attR в участках франкирования встроенного линейного вектора на основе ΦC31 эксконъюгантами, остальные attB сайтов были элиминированы [30]. Взятые геномной ДНК S. lcolnensis штаммы lcglnensis , lcgl / pib139- metk1 , lcgl / pib139- metk2 и lcgl / pib139- metk1 metk2 в качестве шаблонов, эти фрагменты ДНК между attL и attR , соответственно, амплифицировали с тремя парами праймеров (фиг.S3A, В и С). Присутствие attL и attR в вышеуказанных рекомбинантных штаммах S. lincolnensis было дополнительно подтверждено секвенированием ДНК (фиг. S4A и B). Таким образом, наша текущая цель введения кассеты 4× attB с подходящим размером 240 пар оснований состоит только в том, чтобы облегчить молекулярное клонирование, в соответствии с описанием использования кассеты 8x attB в Saccharopolyspora erythraea для сайт-специфической рекомбинации [ 30].

    SAM, выступая в качестве основного донора метила, играет жизненно важную роль в первичном и вторичном метаболизме [2].Большинство исследований показали, что добавление экзогенного SAM или сверхэкспрессия SAM-синтетазы вызывало общее повышение выхода антибиотиков у актиномицетов [10, 36]. Однако наши результаты показали, что дополнительный SAM, добавленный в культуральную среду, не мог проникнуть в клетки S. lincolnensis . Это может быть связано с отсутствием транспортера для поглощения SAM у S. lincolnensis, , что сходно с феноменом, наблюдаемым у Streptomyces coelicolor M512 [36].

    Мы полностью секвенировали геном продуцирующего линкомицин штамма S.lincolnensis LC-G и обнаружили два гомолога генов SAM-синтетазы, SLCG_1651 ( metK1 ) и SLCG_3830 ( metK2 ). В соответствии с другими MetKs в Streptomyces [15], как MetK1, так и MetK2 содержат консервативный АТФ-связывающий мотив и две области связывания металлов для Mg 2+ и K + (рис. S5A). metK1 ( SLCG_1651 ) расположен среди генов, кодирующих белок сборки примосом (SLCG_1650), бифункциональную фосфопантотеноилцистеиндекарбоксилазу/фосфопантотенатсинтазу (SLCG_1652) и омега-субъединицу ДНК-зависимой РНК-полимеразы (SLCG_1653) (рис.S5B), делая вывод, что MetK1 может быть в основном вовлечен в модификацию ДНК и первичный метаболизм. Это может быть причиной того, что нам не удалось инактивировать metK1 в LC-G или LCGL. Аналогичное явление было также зарегистрировано у Streptomyces peucetius var. цезиус [15]. Metk2 ( SLCG_3830 ) сгруппирован в METK2 ADOK Meth Metf Гены SAHH Sahh ( SLCG_ 3830 ~ SLCG_3834 ) (Рис.S3B), которые в основном отвечают за цикл SAM [36]. Панг и др. сообщили, что сверхэкспрессия metK может способствовать продукции Lin-A в промышленном S. lincolnensis SyBE2901 [18]. В соответствии с выравниванием последовательностей мы пришли к выводу, что metK , полученный из S. lincolnensis SyBE2901, был идентичен metK1 из S. lincolnensis LC-G. В нашем исследовании мы обнаружили, что сверхэкспрессия как metK1 , так и metK2 увеличивает продукцию Lin-A за счет повышения внутриклеточной концентрации SAM в S.lincolnensis LCGL, а сверхэкспрессия metK2 имела более значительный эффект. Кроме того, совместная сверхэкспрессия metK1 и metK2 значительно повышала выход Lin-A в LCGL даже в штамме S. lincolnensis , продуцирующем более высокий уровень линкомицина. Мы ожидаем, что стратегия совместной сверхэкспрессии двух генов SAM-синтетазы будет широко применима для улучшения других антибиотиков в промышленности.

    Предыдущие результаты намекнули на то, что помимо поставщика метильных групп, SAM также играет роль в транскрипционной регуляции биосинтеза антибиотиков у Streptomyces [15, 22, 32, 36].Таким образом, мы предоставляем новые доказательства того, что SAM действительно является сигнальной молекулой для регуляции транскрипции биосинтетических и регуляторных генов линкомицина, но механизм еще предстоит изучить.

    Благодарности

    Мы благодарны доктору Сабрине Хубер из отдела биологической инженерии Массачусетского технологического института за критическое редактирование рукописи. Работа выполнена при поддержке Национального фонда естественных наук Китая (31300081, 31570074, 31600064), Национальной программы ключевых фундаментальных исследований (973 программы, 2013CB734000), Открытого проекта Государственной ключевой лаборатории микробного метаболизма Шанхайского университета Цзяо Тонг ( MMLKF13-05), Первоначальный фонд докторских научных исследований в Аньхойском университете (01001904, J01001935) и Национальная программа инновационных экспериментов для студентов университетов (J10118516053).

    Соответствие этическим стандартам

    конфликт интересов

    Авторы заявляют, что у них нет конкурирующих интересов.

    Исследования с участием людей и животных

    Эта статья не содержит исследований с участием людей или животных, проведенных кем-либо из авторов.

    Каталожные номера

    1.

    Bierman

    M

    ,

    Logan

    ,

    R

    ,

    R

    ,

    OBRien

    K

    ,

    Seno

    ET

    ,

    RAO

    RN

    ,

    Schoner

    Be

    Plasmid Cloning Vectors для конъюгальный перенос ДНК от Escherichia coli к Streptomyces spp.

    Chiang

    PK

    ,

    Gordon

    RK

    ,

    RK

    J

    ,

    ZENG

    GC

    ,

    GC

    ,

    доктор

    BP

    ,

    Pardhasaradhi

    K

    ,

    MCCANN

    PP

    S -ADENOSYLMETHIONINE и метилирование

    FaseB J

    1996

    10

    10

    471

    480

    3.

    480

    ,

    D

    ,

    чо

    K

    Эффект скорости потребления источника углерода на производство линкомицина из Streptomyces lincolnensis

    J Microbiol Biot

    2004

    14

    532

    539

    4.

    CHU

    J

    ,

    QIAN

    J

    ,

    J

    ,

    Zhuang

    Y

    ,

    Zhang

    S

    ,

    LI

    Y

    Прогресс в исследовании S -Adenosyl-L- Производство метионина

    Appl Microbiol Biot

    2013

    97

    97

    97

    41

    49

    5.

    49

    5.

    49 0004

    RA

    Ферменты: Практическое введение в структуру, механизм и анализ данных

    2000

    2

    Hoboken

     

    Wiley

    6.

    du

    l

    ,

    liu

    r

    ,

    ying

    r

    ,

    ying

    zhao

    ,

    Zhao

    G

    G

    Эффективное межгенерическое сопряжение ДНК от Escherichia Coli до Mycelia of Lincomycin-Producer Streptomyces lincolnensis

    int j mol sci

    2012

    13

    4797

    4806

    33442457.

    HAN

    S

    ,

    песня

    P

    ,

    REB

    T

    ,

    Huang

    x

    ,

    CAO

    C

    ,

    C

    ,

    Чжан

    B

    Определение SACE_7040, член семьи Тетра, связанные с морфологической дифференциацией Saccharopolyspora erythraea

    CROR Microbiol

    2011

    63

    121

    125

     8.

    HOU

    B

    ,

    WU

    H

    ,

    GUO

    M

    ,

    M

    ,

    Petkovic

    H

    ,

    Tao

    L

    ,

    ZHU

    x

    ,

    YE

    J

    ,

    Чжан

    ч

    Н

    Новый регулятор транскрипции LMBU продвигает биосинтез Lincomycin посредством регулирования экспрессии ее целевых генов в Streptomyces Lincolnensis

    J Bacteriol

    2018

    200

    E00447

    E00417

    9.

    Janata

    J Janata

    J

    ,

    Kadlcik

    S

    ,

    Koberska

    M

    ,

    Ulanova

    D

    ,

    Kamenik

    Z

    ,

    Novak

    P

    ,

    KOPECKY

    J

    ,

    Novotna

    J

    ,

    Radoevic

    ,

    Radojevic

    B

    ,

    B

    ,

    B

    ,

    К

    Lincosamide Синтетаза — уникальная система конденсации, сочетающие элементы нерибосомального пептидной синтетазы и микрокоил

    PLOS One

    2015

    10

    10

    10

    10

    10

    10

    10

    10

    10

    10

    10

    10

    10

    e0118850

     435108110.

    KIM

    DY

    ,

    HWANG

    Yi

    ,

    Yi

    ,

    CHOI

    SU

    SU

    SU

    SU

    METK из Actinoplanes Teichomyceticus ATCC31121 и эффект его высокого выражения на производстве антибиотика

    J Microbiol Biot

    2011

    21

    1294

    1294

    1298

    11.

    Koběrska

    M

    ,

    KOPECKý

    J

    ,

    OLSOVSKA

    J

    ,

    Jelinkova

    M

    ,

    Ulanova

    D

    ,

    MAN

    P

    ,

    FLIEGER

    M

    ,

    M

    ,

    JANATA

    J

    Анализ последовательности и гетерологичное выражение биосинтетического кластера Lincomycin тип штамма Streptomyces LincolNensis ATCC 25466

    Folia Microbiol

    2008

    2008

    53

     

    395

     

    401

     12.

    Livak

    KJ

    ,

    Schmittgen

    TD

    TD

    TD

    Анализ относительных данных выражения относительного гена с использованием количественного ПЦР в реальном времени и 2 -ΔΔCT

    6

    2001

    25

    402

    408

    13.

    MENG

    S

    ,

    S

    ,

    WU

    H

    ,

    Wang

    ,

    ,

    Zhang

    ,

    Zhang

    B

    ,

    Bai

    L

    Усовершенствование антибиотиков производства путем постановки нитрата в актиномицетах

     

    Аппл Микробиол Биот

     

    2017

     

    101

     

    5341

     

    5352

     14.

    Najmanova

    Lajmanova

    L

    ,

    Kutejova

    E

    ,

    KADLEC

    J

    ,

    Polan

    M

    ,

    OLSOVSKA

    J

    ,

    Benada

    O

    ,

    Novotna

    J

    ,

    KAMENIK

    Z

    ,

    Z

    ,

    HALADA

    P

    ,

    P

    ,

    BAUER

    J

    Характеристика N-demethyllincosamide Methyltransferases LMBJ и CCBJ

    Chembiochem

    2013

    14

    2259

    2262

    15.

    OH

    T

    ,

    Niaraula

    NP

    ,

    NP

    ,

    LIU

    K

    ,

    SOHNG

    J

    J

    Идентификация дублированных генов на S -Adenosyl-L-метионина Синтетазы ( METK1 -sp и metK2 -sp) в Streptomyces peucetius var. Caesius ATCC 27952

    J App Microbiol

    2010

    16.

    ,

    Lezhava

    ,

    Lezhava

    A

    ,

    HOSAKA

    T

    ,

    Okamotohosoya

    у

    ,

    Очи

    К

    Усиленная экспрессия S-аденозилметионина синтетазы вызывает перепроизводство actinorhodin в Streptomyces coelicolor A3 (2)

    J Bacteriol

    2003

    185

    601

    609

    14532917.

    Ostash

    B

    ,

    Makitrinskyy

    ,

    R

    ,

    R

    ,

    R

    ,

    ,

    ,

    ,

    S

    ,

    Fedorenko

    V

    V

    V

    Выявление и характеристика Streptomyces GhanaEnsis ATCC14672 Комплекты интеграции для трех плазмид на основе актинофага

    плазмида

    2009

    61

    171

    175

    269975118.

    Pang

    Pang

    L

    ,

    LIN

    C

    ,

    QIAO

    J

    ,

    Zhao

    G

    Совёрэкспрессия LMBW и METK и METK и METK привело к увеличению линкокомарицина производства и снижение побочных продуктов Lincomycin B Содержание в промышленном штамме Streptomyces LincolNensis

    J Appl Microbiol

    2015

    119

    1064

    1074

     19.

    Peschke

    U

    ,

    U

    ,

    SCHMIDT

    H

    ,

    H

    ,

    Zhang

    H

    ,

    H

    ,

    Piepersberg

    W

    Молекулярная характеристика генов Lincomycin-производства Стрептомики Lincolnensis 78-11

    моль Микробиол

    1995

    1605

    1605

    1156

    1156

    20.

    20.

    Sambrook

    JRD

    JRD

    Молекулярное клонирование: Лабораторное руководство

    2001

    3

    New York

    Холодная весенняя порка Лаборатории

    21.

    SEKUROVA

    на

    ,

    Brautaset

    T

    ,

    T

    ,

    SLETTA

    H

    ,

    BORGOS

    SEF

    ,

    Jakobsen

    OM

    ,

    ELLINGSEN

    TE

    ,

    STROM

    AR

    ,

    Valla

    S

    ,

    Zotchev

    S

    SB

    SB

    in vivo анализ регуляторных генов в нистатинском биосинтетическом геном кластере стрептомиек Noursei ATCC 11455 показывает свой дифференциальный контроль над биосинтез антибиотика

    J Bacteriol

    2004

    186

     

    1345

     

    1354

     34442122.

    Shin

    S

    ,

    XU

    D

    ,

    D

    ,

    Kwon

    H

    ,

    H

    ,

    H

    J

    J

    S

    S -Adenosylmethionione Activate ADPA Транскрипция и продвижение Стрептомицин Биосинтез в Streptomyces Griseus

    FEMS Microbiol Lett

    2006

    259

    53

    53

    59

    23.

    Smith

    MCM

    ,

    BROWN

    W

    ,

    MCEWAN

    AR

    ,

    ROWLEY

    PA

    сайт -специфическая рекомбинация с помощью φ С31-интегразы и других крупных сериновых рекомбиназ

    SMOOMVINA

    T

    ,

    T

    ,

    Mazodier

    P

    ,

    P

    ,

    Boccard

    F

    ,

    Thompson

    CJ

    ,

    GUERINEAU

    M

    Строительство серии интегративных векторов на основе PSAM2 для использования в Actinomycetes

    Ген

    1990

    94

    53 94

    53

    59

    25.

    Spizkk

    J

    ,

    Rezanka

    ,

    Rezanka

    T

    Lincosamides: химическая структура, биосинтез, механизм действия, сопротивление и приложения

     

    Биохим Фармакол

     

    2017

     

    133

     

    20

     

    28

     26.

    SPIžEK

    J

    ,

    ezanka

    ,

    T

    T

    Lincomycin, Clindamycin и их приложения

    Appl Microbiol Biot

    2004

    64

    64

    455

    40004 27.

    TE Poele

    EM

    ,

    Dijkhuizen

    L

    L

    Actinomycete Интегративные и сопряженные элементы

    Antonie Van Leeuwenhoek

    2008

    94

    127

    143

    28.

    TE POELE

    EM

    ,

    OLIYNYK

    M

    ,

    M

    ,

    LEADLAY

    PF

    ,

    BOOLHUIS

    H

    ,

    DIJKHUIZEN

    L

    Actinomycete Интегративные и сопряженные PMEA-подобные элементы AMYCOLATOPSIS А Saccharopolyspora декодировал

    плазмида

    2008

    59

    202

    202

    216

    29.

    WU

    H

    ,

    CHEN

    M

    ,

    MAO

    Y

    ,

    LI

    W

    ,

    liu

    J

    ,

    Huang

    x

    ,

    Zhou

    y

    ,

    ye

    B

    ,

    Zhang

    L

    ,

    Weaver

    DT

    рассекание и инженерия Регулятор семейства TetR SACE_7301 для усиленного производства эритромицина в Saccharopolyspora erythraea

     900 03 Факт о микробных клетках

     

    2014

     

    13

     

    158

     30.

    WU

    J

    ,

    ZHANG

    Q

    ,

    DENG

    W

    ,

    W

    ,

    qian

    J

    ,

    Zhang

    S

    ,

    LIU

    W

    На пути к улучшению эритромицина производства В промышленном Saccharopolyspora erthraea штамм через упрощение генетических манипуляций с искусственным атт. Сайт для конкретной рекомбинации

    App Envirment Microbiol

    2011

    77

    7508

    7516

    3201.

    WU

    P

    ,

    PAN

    H

    ,

    H

    ,

    Чжан

    C

    ,

    WU

    H

    ,

    юаней

    L

    ,

    Huang

    x

    ,

    Zhou

    y

    ,

    YE

    B

    ,

    Weaver

    DT

    ,

    Чжан

    ,

    Чжан

    L

    SACE_3986, Tetr семейной транскрипционный регулятор, отрицательно контролирует биосинтез эритромицина в SACCHALOPORYSPORA ERYTHRAEA

    J Ind Microbiol Biot

    2014

    41

     

    1159

     

    1167

     32.

    XU

    D

    ,

    KWON

    H

    ,

    H

    ,

    J

    S -Adenosylmethionione индуцирует BLDH и активирует вторичный метаболизм, включая управление TTA-кодоном BLDH в Streptomyces Lividans

    Arch Microbiol

    2008

    180003

    419

    426

    33.

    YE

    R

    ye

    R

    ,

    Wang

    Q

    ,

    ZHOU

    x

    Lincomycin, Rational Selection

    Bioprocess Biosyst Eng

    2009

    32

    521

    529

    34.

    Zhao

    Q

    ,

    Wang

    M

    ,

    M

    ,

    XU

    D

    ,

    Zhang

    Q

    ,

    LIU

    Q

    ,

    LIU

    W

    Метаболическая муфта двух малых молекулярных тиолов Программы биосинтез Lincomycin

    Nature

    2015

    518

    115

    35.

    Zhao

    Zhao

    x

    ,

    Wang

    Q

    ,

    GUO

    W

    ,

    CAI

    Y

    ,

    Wang

    C

    ,

    C

    ,

    Wang

    S

    ,

    Xiang

    S

    ,

    S

    ,

    S

    ,

    S

    ,

    Выерение

    Выетие Metk показывает различные эффекты на Avermectin Production в различных Streptomyces Avermitilis Штаммы

    World J Microbiol Биотехнолог

    2013

    29

    1869

    1875

    36.