Содержание

Актиномикоз фото и лечение

Актиномикоз – лучисто-грибковое инфекционное заболевание, носящее хронический характер. Может поражать кожу и внутренние органы, дно парадонтальных каналов, образовывая абсцессы, гранулемы и свищи, локализовываться в зубном налете и в зубном камне. Поражение протекает тяжело, во многих случаях осложняется вторичной гнойной инфекцией. Наиболее частая локализация процесса – в зоне лица и челюсти.

Развитие заболевания связывают с пониженным иммунитетом. Часто актиномикоз развивается на фоне хронической инфекции или травмы.

Заболевание находит выражение во множестве форм: слизистой и подслизистой, кожной и подкожной, мышечно-подкожной, челюстной и лимфатической, надкостничной и в форме поражения органов рта.

Симптомы

Актиномикоз, который возбуждается грибками, схож по проявлениям с опухолевыми процессами и воспалениями. Его отличительная черта – вялое течение и отсутствие прогресса при противовоспалительном лечении. Врачи отличают это заболевание от некоторых других:

  • Челюстного периостита;
  • Челюстного остеомиелита;
  • Флегмоны, абсцессов и опухолей челюстно-лицевой зоны;
  • Сифилиса;
  • Туберкулеза.

Чтобы правильно диагностировать заболевание, пациентам назначают клиническое и рентгеновское обследование, микробиологические анализы. Цель диагностики – выявление мицелий актиномицетов.

Как проводится лечение

Первое, что необходимо сделать – исключить дислокации грибов. Для этого проводят экстракцию пораженных зубов и хирургическое иссечение разрастаний гранулем.

Параллельно с этими действиями пациент проходит курс лечения общеукрепляющими препаратами и сильным иммуномодулирующим средством Актинолизак.

Успешно применяются физиотерапевтические методы – лазер, электрофорез и ионофорез.

«Нетипичный» актиномикоз – микробиологические аспекты и клинические проявления | #05/08

Разнообразные микроорганизмы, заселяя практически любую природную среду, незримо сопутствуют человеку на протяжении всей его жизни. Обитая в почве, воде, воздухе, на растениях, на стенах жилых и производственных помещений, микроорганизмы постоянно контактируют с человеком. И, как следствие, некоторые из них приспособились к жизни на коже, слизистых и внутренних полостях человека (желудочно-кишечном тракте, верхних отделах дыхательных путей, урогенитальных путей и т. п.), образуя в местах обитания сложные ассоциации со специфическими взаимоотношениями. Организм человека в норме содержит сотни видов микроорганизмов: бактерии, простейшие, вирусы, грибы. Условно-патогенные микроорганизмы составляют нормальную микрофлору человека, не причиняя ему вреда. Термин «нормальная микрофлора» объединяет микроорганизмы, более или менее часто выделяемые из организма здорового человека. Провести четкую границу между сапрофитами и патогенными микробами, входящими в состав нормальной микрофлоры, часто невозможно. Все микробы, обитающие в организме человека, одновременно пребывают в этих двух состояниях. Любой из них может быть причиной инфекционных процессов. Безобидные «помощники» (лактобактерии, бифидобактерии) при высокой степени колонизации способны вызывать заболевания. И наоборот, патогенные бактерии (пневмококки, менингококки, клостридии) колонизируя поверхности органов человека, не вызывают инфекции, чему способствуют конкуренция сформировавшейся ранее микрофлоры и защитные свойства макроорганизма.

Одним их таких «двойных» агентов нормобиоты человека являются актиномицеты.

Они широко распространены в окружающей среде: в почве, воде, в том числе в водопроводной и ключевой, в горячих минеральных источниках, на растениях, на каменистых породах и даже в пустынях. В организме человека актиномицеты сапрофитируют на коже, в ротовой полости, зубном налете, лакунах миндалин, верхних дыхательных путях, бронхах, на слизистой оболочке желудочно-кишечного тракта, влагалища, анальных складок и т. д.

Термин актиномицеты (устаревшее название лучистые грибки) распространяется в настоящее время на широкий круг грамположительных аэробных и микроаэрофильных бактерий, обладающих способностью к формированию ветвящегося мицелия с характерным спороношением, атакже палочек неправильной формы и кокковидных элементов, которые образуются в результате фрагментации мицелия.

К актиномицетам относятся бактерии родов Actinomyces, Actinomadura, Bifidobacterium, Nocardia, Micromonospora, Rhodococcus, Streptomyces, Tsukamurella и др.

Переходу актиномицетов из сапрофитического в паразитическое состояние способствуют снижение иммунозащитных сил организма, наличие тяжелых инфекционных или соматических заболеваний (хронической пневмонии, гнойного гидраденита, диабета и т. д.), воспалительные заболевания слизистых оболочек полости рта, респираторного и желудочно-кишечного тракта, оперативные вмешательства, длительное применение внутриматочных контрацептивов, переохлаждение, травмы и др.

В таких случаях развивается актиномикоз — хроническое гнойное неконтагиозное заболевание, обусловленное формированием характерных синюшно-красных, а затем багровых инфильтратов плотной консистенции с множественными очагами флюктуации и свищами с гнойным отделяемым в мягких и костных тканях практически любых локализаций. Длительность инкубационного периода может колебаться от 2–3 недель до нескольких лет (от времени инфицирования до развития манифестных форм актиномикоза).

Ведущим в развитии актиномикоза является эндогенный способ, при котором возбудитель проникает в ткани из мест его сапрофитического обитания, чаще всего через пищеварительный тракт и полость рта (кариозные зубы, десневые карманы, крипты миндалин). Наиболее благоприятные условия для внедрения актиномицетов создаются в толстой кишке, вследствие застоя пищевых масс и большей вероятности травматизации стенки. При экзогенном способе возбудители проникают в организм из окружающей среды аэрогенно или при травматических повреждениях кожи и слизистых оболочек.

Распространение актиномицетов из первичного очага поражения происходит контактным путем по подкожной клетчатке и соединительнотканным прослойкам органов и тканей. Возможен также и гематогенный путь при прорыве актиномикотической гранулемы в кровеносный сосуд.

Основными возбудителями актиномикоза являются

Actinomyces israelii, A. bovis, Streptomyces albus, Micromonospora monospora; нокардиоза («атипичного актиномикоза») и мицетомы — Nocardia asteroides, N. brasiliensis. Список выявляемых патогенных актиномицетов расширяется. В современной литературе все чаще описываются случаи актиномикоза, вызванного редкими видами: Actinomyces viscosus, A. graevenitzii, A. turicensis, A. radingae, A. meyeri, A. gerencseriae, Propionibacterium propionicum и др.

В возникновении и формировании актиномикотического процесса также существенную роль играют сопутствующие аэробные и анаэробные бактерии. Большинство случаев актиномикоза обусловлены полимикробной флорой. Обычно наряду с актиномицетами выделяют Staphylococcus spp., Streptococcus spp., Fusobacterium spp., Capnocytophaga spp., Bacteroides spp., представителей семейства Enterobacteriaceae и др. Присоединение гноеродных микроорганизмов обостряет течение актиномикоза, изменяет его клиническую картину, способствует распространению процесса.

Клиническая картина актиномикоза разнообразна, встречается во всех странах в практике врачей различных специальностей (стоматологов, хирургов, дерматологов, гинекологов и др.). Основные локализации — челюстно-лицевая (до 80%), торакальная, абдоминальная, параректальная, мицетома (мадурская стопа). Кроме того, актиномикотические поражения проявляются не только в классическом виде с характерной инфильтрацией тканей, абсцессами и свищами, но и в виде доминирующей патогенной флоры неспецифического воспалительного процесса, осложняющего течение основного заболевания.

Актиномицеты могут играть активную роль в этиологии хронического тонзиллита. Небные миндалины колонизируются актиномицетами при хроническом тонзиллите и в ассоциации с другими бактериями часто провоцируют воспалительные реакции. Вследствие стоматологических процедур может возникнуть актиномикотическая бактеримия полости рта. В 30% случаев от 80% выявленных бактеримий определяется актиномикотическая природа стоматита, этиологическими агентами которого являются сапрофиты ротовой полости — A. viscosus, A. odontolyticus

и A. naeslundi. Присоединяясь к местной патогенной флоре, актиномицеты способствуют развитию длительно незаживающего воспалительного процесса при угревой сыпи, трофических язвах, гиперемиях, мацерациях и мокнутиях на коже. Обладая высокой степенью колонизации кишечника, они являются одним из основных агентов дисбактериоза. Обобщая все вышеизложенное, нужно отметить, что бактерии из обширной группы актиномицетов могут фигурировать как участники любых инфекционных и воспалительных проявлений организма человека от дерматита до эндокардита.

Таким образом, актиномикоз, отличающийся многообразием локализаций и клинических проявлений, нужно своевременно диагностировать и возможно эффективно лечить, зная закономерности патогенетического развития, предрасполагающих факторов инфицирования, характеристик возбудителей и методов лечения.

Однако диагностика и лечение заболеваний, связанных с участием актиномицетов, являются предметами единичных специализированных лабораторий и клиник в мире. Трудности в их дифференциальной диагностике служат препятствием широкой известности этих микроорганизмов в клинической практике.

Диагностика актиномикоза

Достоверным признаком актиномикоза является обнаружение характерных актиномикотических друз в виде маленьких желтоватых зерен, напоминающих крупинки песка, в гное из свищей, в биоптатах пораженных тканей. В нативном (не окрашенном) и гистологических препаратах друзы хорошо видны на фоне гнойного детрита в виде лучистых образований с более плотным гомогенно-зернистым центром из тонкого, густо переплетенного мицелия (фото 1). За способность образовывать радиально расположенные нити мицелия, часто с «колбочками» на концах, актиномицеты и были названы в свое время «лучистыми грибами». Ведущее значение в образовании друз — тканевых колоний актиномицетов — имеет ответная реакция макроорганизма на антигены, секретируемые актиномицетами в окружающую среду. Друзообразование способствует замедлению диссеминации возбудителя в пораженном организме, а также локализации патологического процесса. Для актиномикоза характерны специфические тканевые реакции: гранулематозное продуктивное воспаление, лейкоцитарная инфильтрация, микроабсцессы, «ячеистая» структура тканей, специфическая гранулема, окруженная полинуклеарами, гигантскими и плазматическими клетками, лимфоцитами и гистиоцитами.

В организме больных друзы развиваются не на всех этапах заболевания и свойственны не каждой разновидности «лучистого гриба», поэтому их находят не всегда, и отсутствие друз на начальных этапах диагностики не отрицает актиномикоз. Кроме того, эти образования способны спонтанно лизироваться, обызвествляться, деформироваться, кальцинироваться и подвергаться другим дегенеративным изменениям.

Друзы не образуются при нокардиозе. В тканях Nocardia обнаруживается в виде тонких нитей мицелия 0,5–0,8 мкм и палочковидных форм такой же толщины. Благодаря своей кислотоустойчивости Nocardia хорошо окрашивается по Граму–Вейгерту в синий цвет и по Цилю–Нильсену — в красный: все это позволяет проводить дифференциальную диагностику между актиномикозом и нокардиозом, т. к. это диктуется различием методов лечения при этих болезнях.

Важное значение для верификации актиномикоза любых локализаций имеет микробиологическое исследование, которое включает микроскопию и посев патологического материала на питательные среды. Оптимальная температура для роста 35–37°С.

При микроскопии клинического материала и выросших культур, окрашенных по Граму или метиленовой синькой, актиномицеты выглядят как ветвистые нити длиной 10–50 мкм или представлены полиморфными короткими палочками 0,2–1,0×2–5 мкм, часто с булавовидными концами, одиночные, в парах V- и Y-образной конфигураций и в стопках. Грамположительные, но часто окрашивание не типичное, в виде четок.

Многие аэробные актиномицеты хорошо растут на обычных бактериологических средах — мясо-пептонном, триптиказо-соевом, кровяном и сердечно-мозговом агарах. Для выявления микроаэрофильных видов используют тиогликолевую среду. Культуральные признаки актиномицетов весьма разнообразны. На плотных агаровых средах колонии по размерам напоминают бактериальные — диаметром 0,3–0,5 мм. Поверхность колоний может быть плоской, гладкой, бугристой, складчатой, зернистой или мучнистой. Консистенция тестовидная, крошковатая или кожистая. Многие актиномицеты образуют пигменты, придающие колониям самые различные оттенки: сероватые, синеватые, оранжевые, малиновые, зеленоватые, коричневые, черновато-фиолетовые и др.

Клинические аэробные изоляты, например Nocardia asteroids и Streptomyces somaliensis, на богатой питательной среде дают так называемый атипичный рост — плотные кожистые колонии, обычно не опушенные столь типичным для штаммов воздушным мицелием и без спороношения. Для проявления дифференцировки, образования характерных спор и пигментов требуются специальные среды: с коллоидным хитином, почвенным экстрактом или отварами растительных материалов.

В жидкой питательной среде чистые культуры микроаэрофильных актиномицетов образуют взвешенные в субстрате беловатые «комочки». Среда остается прозрачной. При бактериальных примесях — среда мутная, гомогенная.

Описание клинических случаев «нетипичного» актиномикоза

За период 2007 года под нашим наблюдением находилось 25 больных с различными клиническими формами актиномикоза. Среди обследованных пациентов было 12 женщин и 13 мужчин (в возрасте 15–25 лет — 4 человека, 26–35 лет — 4 человека, 36–45 — 2, 46–55 — 5 человек и 56–66 лет — 10 человек).

Помимо «классического» актиномикоза челюстно-лицевой, подмышечной и паховой областей в свищевой стадии нами были диагностированы актиномикотические осложнения различных патологических процессов. Так, например, актиномицеты обнаруживались в вагинальном отделяемом у больной с неспецифическим кольпитом и вульвовагинитом, что серьезно утяжеляло течение основного заболевания, требовало проведения неоднократного курса противовоспалительной терапии. Актиномицеты в диагностически значимом количестве были выявлены при воспалительных процессах в полости рта (в соскобах с зева, миндалин, языка), при отомикозе, при длительно незаживающих мацерациях и гиперемии кожи в перианальной области, со слизистых оболочек ампулы прямой кишки. Присоединение актиномицетов к гноеродной микробиоте трофических язв значительно утяжеляло течение заболевания, осложняло процесс лечения таких больных, замедляя регрессию очагов поражения. У пациентов с угревой болезнью при вскрытии очагов воспаления в себуме нередко обнаруживались актиномицеты, присутствие которых способствовало развитию затяжного течения заболевания.

Под нашим наблюдением находилась больная К., 43 лет с редким случаем первичного актиномикоза кожи мягких тканей паховых областей, свищевая форма.

Больна в течение 1 года, когда появились изменения в паховой области слева вследствие постоянного натирания кожи неудобным нижним бельем. К врачам не обращалась. Ухудшение в декабре 2007 г., когда появились 2 язвы, свищи с гнойным отделяемым. Консультирована дерматологом, который заподозрил неопластический процесс. Обследована онкологом, паразитологом. Диагноз онкологического или паразитарного заболевания установить не удалось. Направлена к микологу с подозрением на глубокий микоз. При осмотре: очаг поражения расположен в левой паховой области размером около 1,7×5 см, функционируют 2 свища со скудным гнойным и сукровичным отделяемым. Больная обследована в микологической лаборатории института им. Е. И. Марциновского ММА им. И. М. Сеченова на актиномикоз и бактериальную инфекцию. В исследуемом патологическом материале при микроскопии препаратов обнаружены актиномицеты, палочки, кокки, лептотрихии. При посеве гнойного отделяемого из свищей на питательные среды получен рост актиномицетов и кокковой флоры.

Диагноз актиномикоза кожи и мягких тканей верифицирован. Больная проходит наблюдение и лечение у миколога.

Больной Н., 24 лет с диагнозом угревая болезнь, актиномикоз (фото 2).

Жалобы на высыпания на коже туловища с детства. Достоверно можно говорить о давности заболевания 10 лет, когда в 14-летнем возрасте был установлен диагноз угревая болезнь. Больной лечился наружными средствами и антибиотиками различных групп с временным эффектом. Общее состояние в настоящее время осложнилось хроническим гастритом. При осмотре: кожа туловища, лица, спины поражены воспалительными элементами (папуло-пустулезная сыпь, открытые и закрытые комедоны), в некоторых местах сливного характера, инфильтрация кожи и мягких тканей. При микроскопическом исследовании себума из элементов угревой сыпи у больного обнаружены кокки и единичные палочки. В посеве из исследуемого материала в условиях микологической лаборатории (фото 3).

Диагноз: угревая болезнь, актиномикоз лица, туловища, спины кожи и мягких тканей вторичного характера, инфильтративная форма в стадии умеренно выраженного обострения. В настоящее время больному проводится лечение микологом в поликлинике института им. Е. И. Марциновского ММА им. И. М. Сеченова.

Лечение

Лечение больных актиномикозом проводится комплексное в различных сочетаниях в зависимости от локализации и клинических проявлений — препаратами йода, антибиотиками, иммунокоррегирующими и общеукрепляющими средствами, актинолизатом, проводят местное лечение мазями, физиотерапевтическими процедурами и хирургическим вмешательством.

Йодистые препараты (до 3 г йодистого калия в день), ранее доминирующие в терапии актиномикоза, в настоящее время могут применяться в комбинации с антибиотиками или рентгенотерапией, как дополнительное средство для размягчения и рассасывания инфильтрата.

Ведущее место в лечении актиномикоза занимают антибиотики. Наиболее часто используются антибактериальные препараты из группы тетрациклинов, пенициллинов, карбопенемов, линкозаминов, аминогликозидов, цефалоспоринов, действующими веществами которых являются гентамицин, амикацин, тобрамицин, линкомицин, левофлоксацин, цефаклор, цефалексин. Хорошо себя зарекомендовали препараты «Панклав», «Флемоксин Солютаб», «Юнидокс Солютаб» и др. Необходим длительный курс антимикробной терапии (от 6 месяцев до 1 года) и высокие дозы препаратов. Традиционная терапия актиномикоза включает внутривенное введение пенициллина в дозе 18–24 миллионов ЕД ежедневно в течение 2–6 недель, с последующим пероральным приемом пенициллина, амоксициллина или ампициллина в течение 6–12 месяцев. В более легких случаях, в частности при шейно-челюстно-лицевом актиномикозе, достаточно менее интенсивного лечения короткими курсами антибактериальной терапии. Имеется опыт эффективного краткосрочного лечения актиномикоза имипенемом в течение 6–10 недель и цефтриаксоном ежедневно в течение 3 недель. Антимикробную терапию продолжают некоторое время после исчезновения симптоматики для предотвращения рецидива.

При лечении актиномикоза также необходимо учитывать присоединяющуюся патогенную микрофлору, которая может проявлять повышенную резистентность к антибиотикам, что объясняется длительным предшествующим применением различных химиопрепаратов. С целью воздействия на сопутствующую флору используют метронидазол (Метрогил, Трихопол, Эфлоран) и клиндамицин (Далацин, Климицин). Хороший противовоспалительный эффект показывает применение сульфаниламидных препаратов (ко-тримоксазол, сульфадиметоксин, сульфакарбамид). При присоединении микотической инфекции назначают противогрибковые препараты: флуконазол, итраконазол, тербинафин, кетоконазол и др.

Иммунокоррегирующие средства. Для коррекции иммунодефицита показан Диуцифон внутрь — по 0,1 г 3 раза в день или внутримышечно в виде 5%-го раствора по 5 мл через день в течение 3–4 недель. По нашему мнению, также хорошо зарекомендовал себя иммунокоррегирующий препарат «Циклоферон» — 2 мл внутримышечно через день, 10 дней.

Общеукрепляющая терапия стимулирует реактивность организма и повышает эффективность иммунотерапии. Дезинтоксикационная терапия проводится внутривенными растворами Гемодеза, 5% раствором глюкозы и др. С целью активации регенерации применяется аутогемотерапия — еженедельно, всего на курс 3–4 переливания. Витамины назначают в среднетерапевтических дозах.

Иммунотерапия Актинолизатом способствует накоплению специфических иммунных тел и улучшает результаты лечения, позволяя снизить объем антибактериальных средств и избежать нежелательных побочных воздействий. Актинолизат вводят внутримышечно 2 раза в неделю по 3 мл, на курс 25 инъекций, курсы повторяют 2–3 раза с интервалом в 1 месяц.

В качестве местной терапии показано мазевое лечение с антибактериальными препаратами указанных групп, промывание свищей растворами антисептиков, препаратами фуранового типа, введение 1%, 2%, 5% спиртового раствора йода, которые способствуют очищению актиномикозных очагов и ликвидации воспалительных явлений.

Физиотерапевтические процедуры. В стадии формирования очага проводят электрофорез кальция хлорида и Димедрола. После вскрытия очагов при остаточных инфильтратах назначают электрофорез йода, Лидазы, флюкторизацию. Ультразвук применяется непосредственно на область очага поражения по общепринятой схеме в течение 12–25 дней (в зависимости от состояния больного и очага поражения) с интервалами в 3–4 месяца.

Хирургическое лечение проводится на фоне консервативной терапии и заключается в радикальном иссечении очагов поражения в пределах видимо здоровых тканей. При невозможности проведения радикальной операции (например, при шейно-челюстно-лицевом актиномикозе) показано вскрытие и дренирование очагов абсцесса.

Литература

  1. Бурова С. А. Актиномикоз // Русский медицинский журнал. Хирургия, дерматология. 2001. Т. 9, № 3–4.

  2. Кашкин П. Н., Шеклаков Н. Д. Руководство по медицинской микологии. М.: Медицина. 1978. 335 с.

  3. Медведев Ю. А. Иммунохимическое изучение актиномикотической инфекции. Автореферат дис. канд. Ленинград. 1977.

  4. Медицинская микробиология: учебное пособие. Поздеев О. К. / Под ред. В. И. Покровского. 4-е изд. испр. М.: ГЕОТАР-Медиа. 2005. 768 с.

  5. Определитель бактерий Берджи. В 2-х т. Т. 2: Пер. с англ. / Под ред. Дж. Хоула, Н. Крига, П. Снита, Дж. Стейли, С. Уилльямса. М.: Мир. 1997. 368 с.

  6. Хмельницкий О. К., Хмельницкая Н. М. Патоморфология микозов человека. СПб.: Издательский дом СПбМАПО. 2005. 432 с.

  7. Acevedo F., Baudrand R., Letelier L. M., Gaete P. Actinomycosis: a great pretender. Case reports of unusual presentations and a review of the literature // Int J. Infect Dis. 2007. Dec 27.

  8. Attar K. H., Waghorn D., Lyons M., Cunnick G. Rare species of actinomyces as causative pathogens in breast abscess // Breast J. 2007. Sep-Oct; 13 (5): 501–515.

  9. Bauer P., Sultan S., Atienza P. Perianal actinomycosis: diagnostic and management considerations: a review of six cases // Gastroenterol Clin Biol. 2006. Jan; 30 (1): 29–32.

  10. Bhatawadekar S., Bhardwaj R. Actinomycotic bacteraemia after dental procedures // Indian J. Med. Microbiol. 2002; 20: 72–75.

  11. Gayraud A., Grosieux-Dauger C., Durlach A., Salmon-Ehr V., Elia A., Grosshans E., Bernard P. Cutaneous actinomycosis in the perianal area and buttocks // Ann. Dermatol Venereol. 2000. Apr; 127 (4): 393–396.

  12. Hall V. Actinomyces-Gathering evidence of human colonization and infection // Anaerobe. 2008. Feb; 14 (1): 1–7. Epub 2007 Dec 5.

  13. Maradeix S., Scrivener Y., Grosshans E., Sabatier X., Riegel P., Cribier B. Actinomycosis of the buttock // Ann Dermatol Venereol. 2005. May; 132 (5): 462–465.

  14. Metgud S. C., Sumati H., Sheetal P. Cutaneous actinomycosis: A rare case // Indian J. Med Microbiol. 2007. Oct-Dec; 25 (4): 413–415.

  15. Starska K., Lukomski M., Lewy-Trenda I. Palatine tonsils colonization with actinomyces species during chronic tonsillitis // Otolaryngol Pol. 2006; 60 (6): 829–833.

  16. Van Lierop A. C., Prescott C. A., Sinclair-Smith C. C. An investigation of the significance of Actinomycosis in tonsil disease // Int J. Pediatr Otorhinolaryngol. 2007. Dec; 71(12): 1883–1888. Epub 2007, Oct 4.

И. В. Курбатова, кандидат биологических наук
Г. А. Плахотная, кандидат медицинких наук
ИМПиТМ им. Е. И. Марциновского ММА им. И. М. Сеченова, Москва

Актиномикоз — Симптомы, лечение — Медицинский справочник АМК

Актиномикоз — это патологический процесс нагноения кожи, который проявляется множественными язвами, свищами и абсцессами. Причиной патологии является анаэробный гриб рода Actinomyces. Чаше всего поражает шею и лицо, грудь, область живота и таза.

Актиномикоз встречается у детей и взрослых. В несколько раз чаще заболеванием страдают мальчики. У человека возбудитель сапрофитирует в ротоглотке и органах желудочно-кишечного тракта. Нередко проявляет себя при попадании в рану после травмы, операции или кожной инфекции.

Признаки актиномикоза

Болезнь проявляется нагноением на коже, окруженным фиброзной тканью. Часто сопровождается формированием свищей. В области раны врач может обнаружить скопления мицелия с фосфатом кальция или так называемые «серные гранулы», которые окружают базофильные клетки. Они имеют желтовато-серый цвет и диаметр до 2 мм.

Чаше всего заболевание локализуется на шее. У детей наиболее вероятный путь заражения – кариозные зубы. Сначала у края нижней челюсти образуется безболезненная припухлость, которая постепенно распространяется на область шеи. Затем кожа в месте поражения становится напряженной, меняет цвет на темно-красный и появляются свищи. Лимфатические узлы воспаляются, щитовидная железа увеличивается в размере. Этот вид патологии редко вызывает сильные болезненные ощущения.

Актиномикоз органов брюшной полости наиболее часто образуется после удаления аппендицита. Ребенок испытывает боль в животе, повышается температура, он начинает худеть, а в области живота пальпируются уплотнения. Когда процесс затрагивает кожу, могут формироваться свищи.

У взрослых очень часто страдает печень и органы грудной клетки. У женщин актиномикоз может поражать органы малого таза.

Если актиномикоз поражает легкие, у человека наблюдается температура, боль в груди, ночная потливость, беспричинное похудение; сильный кашель, кровохарканье. Симптоматика схожа с развитием туберкулеза.

Диагностика актиномикоза

После осмотра пациента врач рекомендует провести гистологическое исследование отделяемого гнойной раны. Если во время анализа обнаруживаются «серые гранулы» и грамположительные микроорганизмы с ветвящимся мицелием, диагностируется актиномикоз. Подтверждением диагноза служит выделение в анаэробных условиях инфицирующего начала.

Лечение актиномикоза

Терапию проводят антибактериальными препаратами. Обычно выбор делают в пользу левомицитина, эритромицина, тетрациклина, кландамицина. Показано дренирование абсцессов, санирование и удаление пораженной ткани. Как правило, лечение занимает достаточно много времени – от нескольких месяцев до года.

это 📕 что такое АКТИНОМИЦЕТЫ

(лучистые грибки) Класс Actinomycetes

Семейство Actinomysetaceae. Род Actinomycer Harz.

Представляет собой обособленную группу бесхлорофилловых микроорганизмов, сходных по строению с плесневыми грибами и отличающихся от них отсутствием ядер в клетках и размером мицелия (грибницы).

Длинный ветвящийся мицелий актиномицетов не имеет перегородок, тонкий в поперечнике (0,2-1,2 микрона), чем сильно отличается от мицелия грибов, имеющих в поперечнике от 3 до 7 микрон (в 3-15 раз больше). Актиномицеты на питательной среде образуют колонию из субстратного мицелия и воздушного мицелия в виде пушистого бархатистого или мучнистого налета. На нитях воздушного мицелия образуются спороносные гифы (спороносцы), которые являются одним из систематических признаков. Форма гифов у различных видов актиномицетов разная: шаровидная, овальная, цилиндрическая. Культуры актиномицетов на питательных средах могут быть бесцветными и окрашенными в разные цвета. Они обладают сложной ферментативной системой, благодаря которой хорошо усваивают органические вещества, что позволяет их легко и быстро культивировать в искусственных условиях и объясняет их широкое распространение в природе. Встречаются в воздухе, водоемах, на растительных и животных остатках, но особенно много их в различных почвах.

Одной из важнейших особенностей актиномицетов является их способность вырабатывать антибиотики, подавляющие жизнедеятельность различных микробов, в том числе и болезнетворных. Наибольшее значение имеют 3 вида:

I. Actinomyces globisporus streptomycin Krassilnikov (Streptomyces griseus Waksman). На агаризованной органической среде растет в виде выпуклых круглых колоний 5-8 мм в диаметре, покрытых беловатым или серовато-зеленоватым воздушным мицелием. Обратная сторона колонии (подошва) буроватая. На синтетических средах колонии более плоские. Диффундирующего в среду пигмента обычно не выделяют. Оптимальный температурный режим роста и образования антибиотика -26-28°С. Является продуцентом стрептомицина. Окультуренные формы отличаются от диких степенью активности. При промышленном производстве стрептомицина культура выращивается в глубинных условиях на специально подобранной сложной питательной среде, включающей кукурузный или мясной экстракт, углеводы, минеральные соли.

Стрептомицин является сильным основанием, легкообразующим соли с различными кислотами. Сульфат и хлоргидрат стрептомицина, применяемые в медицине, представляют собой белый, хорошо растворимый в воде и нерастворимый в спирте и эфире порошок. Получают его из культуральной жидкости методом адсорбации и экстракции. Очищенный препарат содержит 600-700 ЕД в 1 мг, является высокоактивным антибиотиком с широким спектром антимикробного действия, подавляет рост грамположительных, грамотрицательных, кислото- и пенициллиноустойчивых бактерий. Применяется при лечении кишечных инфекций, тулерямии, эндокардита, вызванных пенициллиноустойчивыми микробами.

Наибольшее значение стрептомицин приобрел для лечения различных форм туберкулеза (легких, туберкулезного менингита, гортани, кишечника, мочеполовых органов и т.д.). При приеме больших доз может развиться глухота.

Препараты – стрептомицин серно-кислый и солянокислый для инъекций во флаконах.

II. Actinomyces aureofaciens Duggar.

На агаризованных средах растет в виде круглых колоний, субстратный мицелий золотисто-желтого или оранжевого цвета.

Пигмент в среду не проникает. Воздушный мицелий сначала беловатый, по мере созревания культуры становится серым или серовато-бурым. Является продуцентом аурео-мицина. В промышленных условиях ауреомицин получается путем глубинного биосинтеза на специальной питательной среде.

Ауреомицин (фармацевтическое название – биомицин), хлортетрациклин, представляет собой игольчатые кристаллы, содержит азот и неионизированный хлор, слабо растворим в воде, в спиртах и ацетоне, не растворим в эфире. Выделен в виде хлоргидрата, который является лучшей формой для приготовления лекарственных препаратов и применения в клинике.

Хлоргидрат – это лимонно-желтые пластинки или ромбы.

Выделяется ауреомицин из культуральной жидкости экстрагированием органическими растворителями с последующим осаждением или хроматографированием на различных адсорбянтах (окись алюминия, уголь).

Ауреомицин (биомицин) обладает очень широким спектром действия, подавляет грамотрицательные и грамполо-жительные бактерии, некоторые формы вирусов (пситтакоза, лимфогранулематоза, риккетени). Успешно применяется при лечении сыпного тифа, лихорадки скалистых гор, трахомы, стафилоккокового сепсиса и других заболеваний, при лечении которых не эффективен пенициллин.

Из побочных действий биомицина отмечены тошнота, рвота, понос.

Препараты – биомицин соляно-кислый в виде таблеток.

Actinomyces rimosus sobin., Finlay.

На агаризованных средах колонии выпуклые, глубоко врастающие в агар; субстратный мицелий желтовато-бурый. По мере созревания колонии покрываются белым воздушным мицелием. Одним из характерных признаков некоторых штаммов этого актиномицета является появление на поверхности колонии при полном ее созревании радиальных трещин. Является продуцентом антибиотика террамицина. Для промышленного получения террамицина культуру выращивают в глубинных условиях на ферментационной среде, содержащей соевую муку, дрожжевой или кукурузный экстракт, триптон, углеводы и минеральные соки.

Террамицин (окситетрациклин) – светло-желтое вещество, легко кристаллизуется из воды в виде игольчатых кри-сталлов-дигидрата.

Террамицин – аморфное соединение, образует соли с кислотами и основаниями, растворим в ментоле, ацетоне, хуже – в воде, не растворим в эфире. Кристаллический соляно-кислый террамицин имеет активность 920 ЕД/мг. Террамицин, как и ауреомицин, обладает широким антимикробным спектром действия. Обычно его принимают внутрь при пневмококковой, стафилококковой инфекции, бруцеллезе, туляремии, риккетсиозах (ку-лихорадках). Он хорошо всасывается в желудочно-кишечном тракте в кровь, где его концентрация быстро достигает терапевтического уровня, относительно малотоксичен.

Препараты – террамицин соляно-кислый в таблетках.

Цвет настроения — мицелий – аналитический портал ПОЛИТ.РУ

Сфера интересов микробиолога — это не только бактерии, но и микроскопические грибы, которые разительно отличаются от бактерий. Но есть и еще кое-кто, давайте же с ним скорее познакомимся. Актиномицеты — это порядок бактерий, имеющих способность к формированию в оптимальных для существования условиях ветвящегося мицелия. То есть это будто нечто среднее между бактериями и грибами, представляете? Мне жуть как нравится устаревшее название актиномицетов — лучистые грибки, гораздо более душевно звучит.

И у грибов мицелий, и у актиномицетов мицелий, но путать их не стоит. Некоторые исследователи, подчеркивая бактериальную природу актиномицетов, даже называют их аналог грибного мицелия тонкими нитями, то есть они придумали отдельный термин. Тонкие нити — действительно тонкие, их диаметр 0,4–1,5 мкм. Актиномицеты имеют кислотоустойчивый тип клеточной стенки, которая окрашивается по Граму как грамположительно, однако по структуре ближе к грамотрицательным. Другими словами, эти малыши во всем стараются быть не как все.

Мицелий у актиномицет еще и имеет свойство дифференцироваться на субстратный (тот, которым они «прирастают» к питательной среде) и воздушный. Воздушный толще, он гидрофобен, содержит больше ДНК и ферментов, на поверхности его клеток имеются различные структуры. еще субстратный и воздушный мицелии обычно имеют разную окраску. Много незабываемых часов провели мы в душных университетских лабораториях, погруженные в древние тома определителя бактерий с желтыми страницами и затхлым ароматом, пытаясь по соотношению двух оттенков разгадать личность, выросшую на чашке Петри. Для этого требовалось определить, бежевый перед тобой, слоновая кость или светло-фисташковый, а чем больше смотришь, тем больше сомневаешься.

Наиболее распространены актиномицеты в почве: в ней обнаруживаются представители почти всех родов актиномицетов. Их экологическая роль заключается чаще всего в разложении сложных устойчивых субстратов; предположительно, они участвуют в синтезе и разложении гуминовых веществ. Это такие гигантские органические молекулы, которые образуются при минерализации органического вещества отмирающих организмов. Гуминовые вещества составляют до 90 % органической массы угля и торфа.  Могут выступать симбионтами беспозвоночных и высших растений.

Актиномицеты являются постоянными обитателями кишечника дождевых червей, термитов и многих других беспозвоночных. Разрушая целлюлозу и другие биополимеры, они являются их симбионтами. Представители рода Frankia способны к азотфиксации и образованию клубеньков у небобовых растений (про бобовых и азотфиксацию поподробнее в следующий раз). есть патогенные формы, вызывающие актиномикоз. В организме человека обитают в ротовой полости, в кишечнике, в дыхательных путях, на коже, в зубном налете, в кариозных зубах, на миндалинах. Но лучше пусть живут в почве.

Актиномикоз у собак и кошек — диагностика и лечение

Актиномикоз — это редкая инфекционная патология. Она возникает при попадании в ткани актиномицетов (лучистых грибов). Стоит заметить, что речь идет о нормальных обитателях ротовой полости, с которыми обычно справляется иммунитет. Однако нарушение работы иммунной системы питомца способствуют развитию данного заболевания.

Актиномицеты хорошо растут на питательных средах, образуя колонии неправильной формы, нередко с лучистыми краями.

Наиболее часто актиномикоз поражает свободно гуляющих кошек. Также с ним сталкиваются охотничьи собаки. Обычно это животные с нарушением работы иммунной системы. Стоит заметить, что данная болезнь не передается при контактах.

 

Симптомы актиномикоза и клиническая картина

Как правило, развитию такой инфекции у животных предшествуют ранения проникающего характера или укусы. Также к патологии приводит снижение иммунитета, вызванное переохлаждением, системными заболеваниями и пр.

Актиномикоз у собак вызывает поражения, которые обнаруживаются в течение продолжительного времени после травмы. Признаки актиномикоза локализуются на шее, нижней челюсти и пр. Патология проявляется подкожными отеками и абсцессами. В дальнейшем на этом месте развиваются язвы и свищи. В большинстве случаев, патологические истечения имеют зловонный характер. В них могут содержаться гранулы желтоватого цвета. Речь идет о макроскопических колониях актиномицетов. Поражение грудной и брюшной полостей сопровождается выраженным уменьшением массы тела. Развитие актиномикоза у животных носит хронический характер.

Актиномикоз у кошек может равиваться несколько лет. Подкожные абсцессы могут локализоваться в любой области тела животного. Данное заболевание часто сопровождается развитием остеомиелита и воспаления плевры.

 

Диагностика актиномикоза

Цитологическое исследование патологической жидкости способствует выявлению гнойного воспаления с различными микроорганизмами. Обнаружение самих актиномицетов представляет собой трудности. При гистологическом исследовании выявляется гнойное воспаление кожи, которое может быть ограниченным и распространенным.

Иногда обнаруживаются тканевые зерна с актиномицетами. Для подтверждения диагноза необходимо воспользоваться полимеразной цепной реакцией. Однако для этого исследования характерна высокая стоимость.

 

Дифференциальный диагноз

Актиномикоз у собак и кошек необходимо отличать от следующих заболеваний:

  • Инфекционные гранулемы, возникшие в результате нокардиоза и атипичного ми-кобактериоза.
  • Аллергическая реакция на внедрение в ткани инородного тела.
  • Системные грибковые инфекции.
  • Опухолевые поражения.
  • Асептическая пиогранулематозная болезнь.
  • Бактериальная инфекция, возникшая в результате иммунодефицита.

 

Актиномикоз у собак и кошек — лечение заболевания

Как правило, основным методом борьбы с актиномикозом у собак и кошек является широкое иссечение пораженного участка кожи. При невозможности выполнения операции рекомендуется установка дренажей и осуществление выскабливания, а также применение цитостатических средств. С данной целью пользуются винкристином, азатиоприном.

Кроме того, показано длительное антибактериальное лечение. Клиническое выздоровление не является условием для отмены антибактериальных средств. Как правила, такая терапия длится еще несколько месяцев после выздоровления.

Применяются следующие антибиотики:

  • Антибактериальным препаратом выбора считается пенициллин G. Данное средство назначается 3 раза в день.
  • Клиндамицин вводится под кожу 2 раза в сутки
  • Эритромицин применяется в таблетированной форме 3 раза в день
  • Амоксициллин вводится 4 раза в сутки. Предусматривается внутривенное или подкожное введение лекарственного средства.

Прогноз на выздоровление при актиномикозе у кошек и собак носит осторожный характер. Это связано с частыми рецидивами заболевания.

Актиномикоз — это… Что такое Актиномикоз?

Актиномикоз (новолат. actinomycosis; от др.-греч. ἀκτίς — луч и μύκης — гриб; син. болезнь лучистогрибковая) — хроническое инфекционное заболевание животных и человека из группы микозов, характеризующееся образованием гранулематозных очагов — актиномиком, в различных тканях и органах. Актиномикоз животных распространён во всех странах мира.[1]

Этиология

Основной возбудитель актиномикоза — лат. Nocardia asteroides, относящийся к обширному ряду актиномицетов (лат. Actinomyces).[1] В гранулематозных тканях и экссудатах обнаруживается в виде мелких серых зерен, называемых друзами, размеры которых в зависимости от возраста колоний составляют 20 — 250 мкм; средний размер друз 60 — 80 мкм. Цвет друз серый или желтоватый. При актиномикозных поражениях друзы наблюдаются не всегда.

Возбудитель актиномикоза чувствителен к высокой температуре; при нагревании до 70 — 80 `С погибает в течение 5 мин. Актиномицеты устойчивы к высушиванию; низкая температура консервирует их на 1-2 года. За 5-7 мин убивает актиномицеты 3%-ный раствор формалина.

Актиномикоз человека

Заболевание встречается во всем мире, как правило, спорадически. Чаще заболевают мужчины, преимущественно жители городов.

Инкубационный период не установлен. Актиномикоз может протекать остро или перейти в хроническую форму с периодическими обострениями. При каждой форме характерно развитие плотного малоболезненного отека, который в дальнейшем размягчается и образует свищ. Подкожно-подмышечная форма может сопровождаться повышением температуры тела до 38 `С, головной болью, общим недомоганием. Поражение бронхов протекает по типу гнойного бронхита, поражение легких — как пневмония; возможно возникновение абсцесса легкого. Абдоминальная форма чаще проявляется образованием очага поражения в кишечнике и сопровождается болями, повышением температуры тела, нарушениями функций пищеварительного тракта, признаками раздражения брюшины. Возможно поражение других органов и тканей: полости носа и носоглотки, щитовидной железы, почек и др. Иногда наблюдается распространение возбудителя с кровью, в результате чего развивается генерализованный актиномикоз, клиническая картина которого напоминает сепсис. В этом случае заболевание нередко (80%[источник не указан 433 дня]) заканчивается смертью больного.

Профилактические мероприятия: своевременное лечение очагов инфекции, общее повышение резистентности организма. Меры иммунопрофилактики не разработаны.

Актиномикоз животных

Интересна история изучения актиномикоза. Болезнь известна очень давно. Специалисты обнаружили характерные для актиномикоза изменения в окаменелых челюстных костях носорога, жившего в третичном периоде. Как самостоятельная болезнь животных актиномикоз выделен более 100 лет назад и описан в различных ветеринарных руководствах. В 1878 г. итальянский ученый Ривольта описал грибок как вероятный возбудитель заболевания крупного рогатого скота и назвал его дискомицетом. Позднее в Германии Боллингер и др. обнаружили своеобразный «лучистый» гриб в опухоли, извлеченной из челюсти крупного рогатого скота, и назвали его актиномицетом, а болезнь — актиномикозом. В 1878 г. были описаны два случая актиномикоза человека (в Германии). В 1934 г. С. Ф. Дмитриев установил родство двух основных форм гриба — аэроба и анаэроба — и возможность перехода одного в другой под воздействием условий внешней среды.

К актиномикозу восприимчивы крупный рогатый скот, реже — свиньи, овцы, козы и лошади. Болезнь регистрируется в течение всего года. Чаще она возникает в стойловый период при кормлении животных сухими кормами, а также осенью при выпасах на стерне, когда не исключены повреждения слизистой оболочки ротовой полости.

3аражение актиномикозом происходит с внедрением свободноживущего актиномицета в организм животного, а также грибков, населяющих ротовую полость и желудочно-кишечный тракт. Чаще всего болезнетворный грибок попадает в ткани тела животного через повреждения слизистой оболочки или кожного покрова остями или соломой злаков во время еды. Возможно и аэрогенное заражение, что подтверждается первичным актиномикозом легких.

После того как грибок проник в организм, он вызывает в месте проникновения воспалительный процесс с последующим образованием гранулемы. Дальнейшее развитие процесса приводит к тяжелым поражениям органов и тканей, что резко отражается на жизнедеятельности организма и возможностях использования животного для пищевых целей.

Актиномикоз чаще развивается на фоне гнойных воспалительных заболеваний, травм, при снижении клеточных реакций иммунитета и дисбалансе различных его показателей.

Лечение

В этом разделе не хватает ссылок на источники информации. Информация должна быть проверяема, иначе она может быть поставлена под сомнение и удалена.
Вы можете отредактировать эту статью, добавив ссылки на авторитетные источники.
Эта отметка установлена 22 ноября 2011.

Необходим длительный курс антимикробной терапии и высокие дозы препаратов. Лечение подбирают индивидуально, однако в тяжелых случаях рекомендуется бензилпенициллин, 18-24 млн ед/сут в/в на протяжении 2-6 нед, с последующим приемом внутрь феноксиметилпенициллина или амоксициллина в течение 6-12 мес. В более легких случаях, в частности при шейно-челюстно-лицевом актиномикозе , достаточно менее интенсивного лечения. Если антимикробную терапию продолжают некоторое время после исчезновения симптоматики, риск рецидива (одной из характерных черт этой инфекции) удается свести к минимуму. При аллергии к пенициллинам обычно используют тетрациклин, эритромицин , миноциклин или клиндамицин; иногда годятся цефалоспорины первого поколения. Из новых антимикробных средств, по-видимому, эффективны имипенем/циластатин и цефтриаксон. Метронидазол и аминогликозиды не используют.

Примечания

  1. 1 2 Проф. А. И. Арутюнов, кандидат медицинских наук Н. Я. Васин и В. Л. Анзимиров Справочник по клинической хирургии / Проф. В.И. Стручкова. — Москва: Медицина, 1967. — С. 234. — 520 с. — 100 000 экз.

Ссылки

Актиномицеты — обзор | ScienceDirect Topics

Frankia — Dicotyledon Symbiosis

Аэробные грамположительные актиномицеты, принадлежащие к роду Frankia , представляют собой диазотрофные бактерии, способные индуцировать образование N 2 -фиксирующих узелковых долей в корнях Растения, образуемые штаммами Frankia , известны как актиноризные растения и включают 8 семейств, 25 родов и более 200 видов, большинство из которых представляют собой многолетние древесные кустарники или деревья, распространенные на всех массивах суши, кроме Антарктиды.Актиноризные растения предпочитают малоплодородные почвы, и большинство из них являются пионерами на участках с низким содержанием азота. Кроме того, многие актиноризные виды способны переносить стрессы окружающей среды, такие как тяжелые металлы, высокая соленость, засуха, холод и экстремальный pH. Они обитают в различных экосистемах, включая прибрежные дюны, прибрежные зоны, альпийские сообщества, арктическую тундру, ледниковые поля и леса. Актиноризные растения особенно важны в регионах высоких широт, таких как Скандинавия, Канада, Аляска и Новая Зеландия, где бобовые отсутствуют или встречаются редко, в то время как актиноризные растения многочисленны и способны к бурному росту (Wall, 2000).Большая часть нового азота, поступающего в эти экосистемы, поступает от актиноризных симбиозов, на которые в целом приходится более 15% биологически фиксированного азота во всем мире.

Франкии нитчатые, помимо симбиотической ассоциации с актиноризными растениями, могут встречаться и как свободноживущие диазотрофные организмы (Benson, Silvester, 1993). В чистой культуре штамма Frankia продуцируют обширные гифы и спорангии. В ответ на лишение азота они также дифференцируют везикулы, называемые диазовезикулами, которые содержат нитрогеназу и являются местом фиксации N 2 .Диазовезикулы инкапсулированы серией слоистых липидных слоев, богатых нейтральными липидами, гликолипидами и гопаноидами. Эта оболочка, толщина которой зависит от концентрации O 2 в окружающей среде, работает как барьер для диффузии кислорода, обеспечивая анаэробную среду для функционирования нитрогеназы внутри везикул (Berry et al., 1993).

Штаммы Frankia , образующие клубеньки на актиноризных растениях, могут филогенетически различаться по трем группам (группы I, II и III), которые инфицируют определенные семейства двудольных ( Таблица 3 ).

Таблица 3. Связь между Франкию и actinorhizal растений

Франкию филогенетические группы растений семейства растений родов
Группа I штаммы
Coriariaceae Datiscaceae
Rosaceae
Rhamnaceae
кориария
датиска
Cercocarpus , Chamaebatia , Огуаз , Cowania , Перший краснокоренник
Группа II штаммы берёзовых
казуариновые
восковницевые
Алунус
Касуарина , ALLOCASUARINA , CEUTHOSTOMA , GymnoStoma , Myrica , комптона ,
группа III штаммы A
ELAEAGNACEAE
RAMNACEAE
ELAGNUS , Hippophaë , Shepherdia , Calletia , DECARIA , KENTROTHAMNUS , RETROTAMNUS , RETANILLA , TALGUENEA , Trevoa

actinorhizal растения попадают в семьи трех связанных заказов: Rosales (Rosaceae, Elegnaceae , Rhamnaceae), Fagales (Betulaceae, Casuarinaceae, Myricaceae) и Cucurbitales (Coriariaceae, Datiscaceae).Вместе с Fabales (бобовыми) они образуют единую «азотфиксирующую кладу» внутри покрытосеменных растений (Soltis et al., 1995).

В актиноризных симбиозах образование корневых клубеньков начинается с узнавания симбионта-хозяина посредством обмена молекулярными сигналами, знания о которых все еще ограничены.

Однако некоторые данные свидетельствуют о том, что сигнальные механизмы Frankia -актиноризных растений могут быть сходны с механизмами ризобий-бобовых (Hocher et al., 2011b), а геномный анализ подтверждает гипотезу о возможном едином происхождении бобовых-ризобий. и актиноризные симбиозы (Hocher et al., 2011а).

Штаммы Frankia могут инфицировать корень хозяина внутриклеточными или межклеточными механизмами. Внутриклеточная инфекция, такая как у родов Myrica , Comptonia , Alnus и Casuarina , начинается с проникновения бактериальных гиф в закрученный корневой волосок. После этого гифы перемещаются в клетки коры, инкапсулированные слоем материала клеточной стенки растений, окруженные плазмалеммой хозяина. При межклеточной инфекции, характерной для родов Elaeagnus , Ceanothus и Cercocarpus , бактериальные гифы проникают между двумя соседними клетками ризодермы и апопластически продвигаются через клетки коры, инкапсулированные в пектиновый матрикс.Одновременно клеточные деления, индуцированные в перицикле корня, приводят к образованию зачатка доли клубенька, к которому перемещаются гифы. Зрелая актиноризная доля клубенька напоминает видоизмененный боковой корень с апикальной меристемой, но без корневого чехлика. На нем показана центральная стела с сосудистыми тканями и гиф Frankia , ограниченных клетками коры (, рис. 6, ).

Рисунок 6. Схематический рисунок доли зрелого актиноризного узелка.

В большинстве актиноризных симбиозов N 2 -фиксирующая активность Frankia в инфицированных клетках связана с дифференцировкой диазовезикул, морфология которых строго контролируется растением-хозяином.Как и у свободноживущих франкий, эти везикулы окружены многослойной липидной оболочкой и содержат нитрогеназу. Однако в некоторых симбиозах (с растениями родов Myrica , Coriaria , Comptonia , Casuarina ) гифы Frankia пролиферируют, не образуя пузырьков. Зрелая анатомия доли узелка достигается примерно через 2 недели после инокуляции, тогда как фиксация N 2 может быть обнаружена через три недели (Huss-Danell, 1997).

В инфицированных клетках зрелых долей клубенька действуют некоторые механизмы, снижающие напряжение кислорода рядом с местом локализации непереносимой кислородом нитрогеназы. Первая диффузионная устойчивость к кислороду обеспечивается у диазовезикул многослойной оболочкой, а дальнейшее снижение р О 2 достигается за счет их высокой скорости дыхания. Во многих долях узелков, лишенных диазовезикул, инфицированные клетки содержат высокие уровни гемоглобинов, которые имеют последовательности, гомологичные леггемоглобинам, и, как полагают, играют ту же роль (Fleming et al., 1987). Кроме того, в этих узелках может поддерживаться низкий уровень p O 2 за счет лигнификации клеточных стенок хозяина. Наконец, активность поглощающих гидрогеназ также может помочь защитить нитрогеназу от O 2 как в гифах, так и в диазовезикулах симбиотических франкий (Leul et al., 2009). У свободноживущих штаммов Frankia , как и у других свободноживущих диазотрофов, аммиак, образующийся при фиксации N 2 , усваивается организмом по пути GS-GOGAT.Напротив, эти ферменты по-разному регулируются у симбиотических франкий. В диазовезикулах долей корневых клубеньков активность ГС очень низкая и аммиак остается неусвояемым (Alloisio et al., 2010). Как и при симбиозе ризобий и бобовых, NH 3 высвобождается в клетку-хозяина, где его ассимиляция приводит к образованию аминокислот и других органических соединений азота. Некоторые из них снабжены бактерией, но большинство из них переносятся на побеги растений.

Дефицит или отсутствие активности GS у диазотрофных симбионтов также характеризует бобовые ризобии, а также некоторые цианобактериальные симбиозы, такие как Anabaena Azolla , демонстрируя замечательную конвергенцию физиологических стратегий в N 2 -фиксирующих ассоциациях .

Актиноризное растение должно обеспечивать фотосинтез симбиотической бактерии. Как и в случае ризобиально-бобового симбиоза C 4 , дикарбоксилаты, полученные в результате метаболизма сахарозы, происходящего в клетке-хозяине, вероятно, являются источниками углерода для штаммов Frankia в актиноризном симбиозе.

Кроме того, как это происходит при симбиозе ризобий и бобовых, актиноризные растения могут контролировать инфекцию Frankia и регулировать количество и развитие долей клубеньков на корнях с помощью системных ауторегуляторных процессов (Wall et al., 2003).

Актиномикоз | ДермНет NZ

Автор: Мари Хартли, штатный сотрудник, 2010 г. Проверено и обновлено доктором Амандой Окли, дерматологом, Гамильтон, Новая Зеландия; и Ванесса Нган, штатный писатель; Июнь 2014.


Что такое актиномикоз?

Актиномикоз представляет собой хроническую или медленно прогрессирующую инфекцию, вызываемую различными видами бактерий рода Actinomyces , чаще всего Actinomyces israelii . Actinomyces являются нормальными обитателями полости рта, желудочно-кишечного тракта и женских половых органов и не вызывают инфекции, если нет повреждений кожи или слизистых оболочек. Actinomyces также требует присутствия других сопутствующих бактерий, чтобы вызвать заболевание.

Заболевание характеризуется образованием абсцесса и дренированием свищевых ходов (небольших тоннелей, открывающихся на поверхность кожи или слизистых оболочек и выводящих гной). Вытекающий гной содержит желтые гранулы, называемые гранулами серы. Они названы по цвету гранул, а не по их содержанию.

Актиномикоз следует дифференцировать от актиномицетомы, которая является хронической инфекцией кожи и подкожной клетчатки, обычно поражающей стопы (см. мицетома).Actinomycetoma вызывается различными видами Actinomyces, которые встречаются в почве и растительном материале в тропических регионах.

Кто подвержен риску актиномикоза?

Актиномикоз встречается относительно редко, но следующие факторы повышают риск инфекции:

  • Плохая гигиена полости рта после стоматологических операций или травм
  • Нарушение иммунитета, например, иммунодепрессанты или хронические состояния, такие как сахарный диабет
  • Недоедание
  • Проживание в тропических странах

Каковы клинические признаки актиномикоза?

Шейно-лицевой актиномикоз

Шейно-лицевой (шеи и головы) актиномикоз является наиболее распространенной формой инфекции, на которую приходится 50–70% случаев.Инфицированию обычно предшествуют стоматологические операции, травмы полости рта или лица или местные повреждения тканей, вызванные раком или лучевой терапией. Инфекция обычно начинается с медленно прогрессирующего, безболезненного, твердого образования на щеке или вокруг челюсти. Это развивается в абсцессы и дренирующие свищевые ходы. Окружающие ткани отекают. Иногда присутствуют лихорадка и другие симптомы системной инфекции. Актиномикоз вокруг челюсти может вызвать тризм (длительный спазм мышц челюсти).

Лимфатические узлы обычно не увеличены и, как правило, малоболезненны, если только соседние структуры не сдавлены.Инфекция медленно распространяется на окружающие ткани и органы, такие как кожа головы, глаза, уши, язык, гортань и трахея. Иногда происходит инвазия соседней кости. Инфекция может распространиться на мозговые оболочки (оболочки, окружающие головной и спинной мозг), вызывая менингит.

Актиномикоз брюшной полости

Заболевание брюшной полости (10–20% случаев) обычно следует за повреждением слизистой оболочки желудочно-кишечного тракта, например, после операции, аппендицита, дивертикулита или проглатывания инородных тел, таких как куриные или рыбьи кости.Это заболевание трудно диагностировать, так как у пациентов часто наблюдаются неспецифические медленно прогрессирующие симптомы, такие как лихорадка, потеря веса, диарея или запор, боль в животе. Любой орган брюшной полости может быть вовлечен в прямое распространение болезни. Иногда обнаруживаются свищевые ходы, распространяющиеся на кожу брюшной стенки или на слизистую ткань прямой кишки или заднего прохода.

Легочный актиномикоз

Легочное заболевание (15–20% случаев) обычно вызывается аспирацией (вдыханием) оральных или желудочно-кишечных выделений.Инфекция проявляется медленно прогрессирующими неспецифическими симптомами, такими как кашель, выделение мокроты, затрудненное дыхание и боль в груди. Инфекция может медленно распространяться, вовлекая местные структуры, такие как сердце и грудную стенку, при этом свищевые ходы иногда распространяются на кожу грудной клетки.

Тазовый актиномикоз

Тазовый актиномикоз встречается редко и связан с использованием внутриматочных противозачаточных средств. Общие симптомы этой инфекции включают дискомфорт внизу живота, аномальное вагинальное кровотечение и выделения из влагалища.

Первичный кожный актиномикоз

Первичный кожный актиномикоз встречается очень редко и поражает открытые участки кожи после прямой имплантации микроорганизма во время травмы.

Как диагностируется актиномикоз?

  • Материал, полученный при аспирации абсцесса или свищевого хода, или из образца биопсии, можно культивировать в лаборатории; для выращивания Actinomyces требуются строгие условия выращивания. Часто будут присутствовать различные сопутствующие бактерии.
  • Гранулы серы можно исследовать под микроскопом на наличие признаков, характерных для Actinomyces ; однако это не окончательный тест, так как другая бактерия под названием Nocardia имеет аналогичный вид.

Что такое лечение актиномикоза?

Целью лечения актиномикоза является лечение инфекции большими дозами антибиотиков и хирургическим вмешательством для создания неблагоприятных аэробных условий для роста видов Actinomyces .

  • Актиномикоз лечится антибиотиками, такими как пенициллин. Высокие дозы пенициллина внутривенно с последующим пероральным введением пенициллина обычно необходимы для проникновения в области фиброза и нагноения. Для предотвращения рецидива часто требуется длительное лечение.
  • Альтернативные антибиотики включают тетрациклины, эритромицин и клиндамицин.
  • Хирургическое лечение включает дренирование глубоких абсцессов, иссечение свищевых ходов и удаление объемных инфицированных масс.
  • Комбинированное лечение пенициллином и хирургическим вмешательством почти всегда приводит к излечению

Очертания патологии – актиномикоз

Просмотров страниц в 2021 году: 17 340

Просмотров страниц в 2022 году на сегодняшний день: 4 762

Процитируйте эту страницу: Soni A.Актиномикоз. Сайт PathologyOutlines.com. https://www.pathologyoutlines.com/topic/skinnontumoractinomycosis.html. По состоянию на 31 марта 2022 г.

Основные признаки

  • Возбудитель Actinomyces israelli
  • Обработанные высокими дозами пенициллина
  • Феномен Сплендора-Хёппли — гистологический признак

Коды по МКБ

  • МКБ-10: A42.9 — актиномикоз неуточненный

Зоны

  • Шейно-лицевой (после стоматологической инфекции), кожный (посттравматическое повреждение, создающее анаэробную среду), тазовый (после установки внутриматочной спирали), брюшной (состояние после разрыва аппендикса или перфорации кишечника) и легочный (курильщики с плохой гигиеной полости рта) , аспирация инфекционного материала) (Infect Drug Resist 2014; 7:183)

Патофизиология

  • Предрасполагающие факторы включают плохую гигиену полости рта, травму, мужской пол, сахарный диабет, иммуносупрессию, алкоголизм и недоедание (Infect Drug Resist 2014;7:183)
  • Нитевидные бактерии — нормальные комменсальные обитатели ротовой и щечной полостей, желудочно-кишечного тракта и женских половых органов
  • Этиология инфекции кожи обычно связана с травматическим повреждением, укусом человека или сквозным повреждением, что создает анаэробную среду для роста Actinomyces israelii (J Clin Diagn Res 2014;8:YD03)

Этиология

  • Вызывается Actinomyces israelii у человека и Actinomyces bovis у животных

Клинические признаки

  • Локальная боль, отек и дренирующие свищи

Диагностика

  • Культура на среде с шоколадным агаром при 37 °C
  • Окрашивание по Граму более чувствительно, чем посев, особенно если пациент принимает антибиотики
  • Окрашивание GMS выделяет нитевидные бактерии, которые не визуализируются при окрашивании H&E (Infect Drug Resist 2014; 7:183)
  • Полимеразная цепная реакция (ПЦР) и зонды нуклеиновых кислот разрабатываются для более быстрой и точной идентификации

Лечение

  • Высокие дозы пенициллина необходимы для проникновения в зоны фиброза и нагноения/гранул (Clin Infect Dis 2004;38:444)
  • Дренирование абсцессов или радикальное иссечение свищевых ходов

Клинические изображения


Предоставлено Dhiraj B.Никумбх, MBBS, MD

Множественные пазухи стопы

Изображения, размещенные на других серверах:

Уплотненное поражение

Поражение на спине

Поражение левого бедра

Внешний вид моляра

Общее описание

  • Уплотненная, опухшая область на коже с множественными дренирующими абсцессами и фистулами
  • Желтые гранулы серы, выводящие гной

Всего изображений


Изображения, размещенные на других серверах:

Наружная/внутренняя поверхность и поперечный срез иссеченной ткани

Микроскопическое (гистологическое) описание

  • Лимфоциты, нейтрофилы, гигантские клетки и фибробласты
  • Бактериальные колонии (гранулы серы), обнаруженные в центре воспалительной реакции, состоящие из базофильных лучистых нитей

Микроскопические (гистологические) изображения

Цитологическое описание

  • Смешанный воспалительный инфильтрат, многоядерные гигантские клетки инородного тела и скопления нитчатых организмов

Положительные красители

  • Грамположительные
  • Окрашивание GMS демонстрирует нитчатые бактерии, которые не окрашиваются H&E или PAS

Образец отчета о патологии

  • Кожа, биопсия:
    • Первичный кожный актиномикоз

Дифференциальный диагноз

  • Нокардиоз:
    • Ветвящиеся нитчатые бактерии частично кислотоустойчивые положительные
    • Гистологический вид Nocardia подобен другим членам семейства актиномицетов; культуральное и биохимическое тестирование необходимо для диагностики/идентификации
  • Туберкулез:
    • Характерные гистологические находки включают казеозные гранулемы
    • Выявляется с помощью окраски по Цилю-Нильсену и посева Mycobacterium
  • Споротрихоз :
    • Характерные гистологические данные включают смешанный острый и хронический воспалительный ответ
    • Организмы «sporothrix asteroids» могут быть обнаружены с помощью окрашивания PAS, GMS
  • Паракокцидиоидомикоз :
    • Характерные гистологические данные включают смешанный острый и хронический воспалительный ответ
    • Организмы, называемые по морфологии капитанским колесом, могут быть обнаружены с помощью окраски PAS, GMS

Дополнительные ссылки

  • eMedicine: Actinomycosis [По состоянию на 19 августа 2021 г.], Cheng: Essentials of Anatomic Pathology, 3-е издание, 2011 г., MDDK: Actinomycosis [По состоянию на 19 августа 2021 г.], Mohantal: Practical, Pathology for Dental 1-е издание, 2013 г., Уидон: патология кожи Уидона, 3-е издание, 2009 г.

Вопрос № 1 в стиле обзора совета директоров


Как называется уникальный гистологический паттерн, который имеет место при кожных актиномикозных инфекциях?
  1. Реакция астероидного тела
  2. фигурки пламени
  3. Подагра
  4. Феномен Сплендора-Хёппли

Вопрос в стиле обзора совета № 2

Гранулы какого типа обнаруживаются в абсцессах, образованных инфекцией Actinomyces ?
  1. Метахроматические гранулы
  2. гранулы полифосфата
  3. полисахаридные гранулы
  4. Гранулы серы
Back to top

Tiny Things Tour — Станция 14

Почвенная пищевая сеть — актиномицеты  

 

Расположение станции: западная сторона тропы под открытым небом, GPS: 38°56’51.69”N, 76°13’48.45”W

[Перейти к списку станций тура] [Вернуться к станции 13] [Вернуться на страницу приветствия тура (станция 1)]

 

Таксономия
  • Домен: Бактерии
  • Королевство: Бактерии
  • Тип: Actinobacteria
  • Класс: Actinobacteria
  • Отряд: Actinomycetales
  • Семейство: Actinomycetaceae
  • Род/вид: репрезентативный организм – виды Actinomyces

 

Термин «актиномицеты» — это не таксономический термин, который используется для описания большой группы бактерий со сходными характеристиками, которые обычно относятся к отряду Actinomycetales .Члены группы имеют похожие клеточные стенки и имеют тенденцию образовывать нитевидные нити, которые растут как мицелий, часто с воздушными гифами. Эти характеристики аналогичны характеристикам грибов, но актиномицеты являются прокариотами (грибы являются эукариотами) и, как правило, намного меньше грибов. Актиномицеты — это лишь одна группа бактериальной биомассы в почве. По оценкам, чайная ложка продуктивной почвы обычно содержит от 1 миллиона до 1 миллиарда бактерий. [1]

Почвенные бактерии необходимы для круговорота питательных веществ, который обеспечивает переработку различных минералов и питательных веществ и делает их доступными для живых организмов.Актиномицеты вносят свой вклад в этот цикл, разлагая определенные биологически произведенные материалы (например, хитин и целлюлозу), которые трудно катаболизировать другим почвенным микроорганизмам. Актиномицеты обычно выполняют эту деятельность по разложению в почвах с высоким (базовым) рН. Грибы выполняют аналогичную функцию, как правило, в почве с низким (кислым) рН.

Если вы посещаете эту станцию ​​в весенний или осенний день, или после ливня, вы можете почувствовать характерный аромат «перевернутой земли».Актиномицеты в основном ответственны за этот запах. Этот «запах земли» получил название «петрикор» и связан с выделением химического вещества под названием геосмин из почвенных актиномицетов. Человеческий нос исключительно чувствителен к геосмину и способен обнаруживать его даже при концентрации всего 5 частей на триллион. [2] Ученые исследовали роль геосмина в эволюции человека. [3]

Актиномицеты также важны как источник жизненно важных антибиотиков. Первое лекарство, активное против бактерии, вызывающей туберкулез ( Mycobacterium tuberculosis ), было выделено из актиномицета Streptomyces griseus почвенным микробиологом Зельманом Ваксманом (открытие, принесшее ему Нобелевскую премию по медицине 1952 года).Актиномицеты являются источником многих других антибиотиков и могут представлять собой источник будущих методов лечения устойчивых к лекарствам патогенов.

Узнать больше:

Химия ароматов: аромат дождя

Живая почва: почвенные бактерии

Белая чума в городе ангелов – научное открытие стрептомицина, 1946 г.

Противомикробные препараты из актиномицетов – назад в будущее

Примечания и ссылки:

[1] Служба природных ресурсов Министерства сельского хозяйства США: почвы

[2] Википедия: Геосмин

[3] Журнал Smithsonian Online: «Что делает дождь таким приятным?»

атрибуция фото: Actinomycete – Wikimedia Commons

Всестороннее исследование потенциальных новых морских психротолерантных актиномицетов sp.Выделено из Бенгальского залива

Curr Genomics. 2020 май; 21(4): 271–282.

Кришна Кант Пулихерла

4

1 Факультет биотехнологии, Отдел исследований и разработок, Профессиональный университет Лавли, Пенджаб-144411, Индия; 2 Кафедра биотехнологии животных, Школа наук о жизни, Лаборатория генной инженерии и молекулярной биологии, Национальный университет Чеджу, Чеджу-До, Республика Корея; 3 Кафедра ботаники, Центральный университет имени Махатмы Ганди, Мотихари, 845801, Бихар, Индия; 4 Департамент науки и технологий, Министерство науки и технологий, Technology Bhavan, New Mehrauli Road, New Delhi-110016, India

* Адресная корреспонденция с этими авторами на факультете ботаники, Центральный университет им. Махатмы Ганди, Мотихари- 845801, Бихар, Индия; Тел/факс: +91-87458-55570; Электронная почта: [email protected] и Департамент науки и технологий Министерства науки и технологий, Технологии Бхаван, Нью-Мехраули-роуд, Нью-Дели-110016, Индия; Тел/факс: +91-11-265; Электронная почта: [email protected]

Поступила в редакцию 14 декабря 2019 г.; Пересмотрено 5 марта 2020 г .; Принято 12 марта 2020 г.

Это статья с открытым доступом, лицензированная в соответствии с условиями Creative Commons Attribution-Non-Commercial 4.0 International Public License (CC BY-NC 4.0) (https://creativecommons.org/licenses/by-nc /4.0/legalcode), который разрешает неограниченное некоммерческое использование, распространение и воспроизведение на любом носителе при условии надлежащего цитирования работы.

Abstract

История вопроса: Это исследование было проведено для классификации разнообразия глубоководных психротолерантных актиномицетов sp. nov., в Бенгальском заливе, и эксплуатировать производство холодоактивных промышленных и фармацевтических биомолекул.

Цель: 1) Характеристика, оптимальные условия роста и классификация разнообразия новых изолированных глубоководных психротолерантных актиномицетов sp из Бенгальского залива. 2) Поиск промышленно важных биокатализаторов и определение антимикробной активности против пяти ужасных патогенов.3) Профилирование дифференциальной экспрессии генов-кандидатов для регуляции биосинтеза выбранных ферментов.

Методы. Адаптированные к холоду актиномицеты были выделены из коллекций глубоководных вод на глубине 1200 м от поверхности в Бенгальском заливе. Фенотипические и генотипические характеристики были проведены, чтобы понять устойчивое разнообразие этих новых морских психротолерантных видов актиномицетов. Продукцию холодоактивных ферментов, таких как амилаза, целлюлаза, липаза, пектиназа и L-аспарагиназа, подвергали скринингу, а гены профиля экспрессии определяли с помощью qRT PCR.Также были исследованы антибактериальная и противогрибковая активность.

Результаты: Всего было выделено 37 новых актиномицетов, и фенотипические и генотипические характеристики определили род, в котором доминируют Streptomyces (17 различных подгрупп) в качестве основной группы, за которыми следуют Micromonospora, Actinopolyspora, Actinosynnema, Streptoverticillium, Saccharopolyspora, Нокардиопсис и нокардия. Оптимальный рост и обильное образование мицелия наблюдаются при температуре от 15°С до 20°С, а также способность к развитию при 4°С.Все изоляты сыграли важную роль в производстве биокатализаторов, а также были отмечены антагонистические активности в отношении пяти основных выбранных патогенов.

Заключение: Streptomyces из Бенгальского залива обладают высоким биосинтетическим потенциалом и могут служить хорошим ресурсом для исследования биоактивных природных продуктов.

Ключевые слова: Антимикробная активность, психротолерантность, актиномицеты, метаболиты, психрозим, стрептомицеты

1.67 × 10

30 ) отдельных микробов, нигде в земной среде не встречающихся [1, 2]. Морская среда действует как большой резервуар природных соединений и, таким образом, предлагает колоссальный ресурс для новых соединений, которые необходимо оценить для фармацевтических и промышленных применений.

Быстрое появление устойчивых к лекарствам патогенов привело к спросу на новые противомикробные соединения. Однако, несмотря на интенсивные усилия по поиску лекарств, в течение десятилетий не было разработано ни одного нового класса антибиотиков.Таким образом, необходимые для эффективных антимикробных препаратов, исследовательский интерес смещается в сторону экстремофилов-обитателей в поисках потенциально богатого источника новых антимикробных соединений. Следовательно, неисследованные глубоководные микробные территории представляют собой колоссальный пул возможно необходимого микробного биоразнообразия и могут быть потенциальным источником многочисленных биоактивных молекул [3-5].

Наличие глубоководного микробного разнообразия родов актиномицетов и их потенциала метаболитов в Бенгальском заливе редко документируется.С этой точки зрения настоящее исследование направлено на характеристику актиномицетов, адаптированных к холоду, из глубоких вод, собранных на четырех разных станциях Бенгальского залива. Также были предприняты усилия для скрининга биоактивных холодоактивных ферментов глубоководных актиномицетов и оценки антибиоза против ужасных патогенов. Streptomyces является крупнейшим родом актинобактерий и важным источником биоактивных соединений, поэтому было также проведено дополнительное исследование генотипической характеристики и гомологичного распределения в роде Streptomyces и их экономической значимости.В этом исследовании изучается разнообразие глубоководных психротолерантных актиномицетов и сообщается о коммерческих биомолекулах, полученных из этих наземных источников.

2. МЕТОДЫ

2.1. Сбор проб глубоководных вод

«Экспедиция Сагар Канья» была организована Национальным центром антарктических и океанических исследований (NCAOR), в настоящее время известным как Национальный центр полярных и океанических исследований при правительстве Индии, для сбора проб воды. на глубине 1200 метров (4000 футов от поверхности).Пробы воды были отобраны на глубине 1200 м из четырех разных мест в Бенгальском заливе т. е. ., (1) 8° 23′ с.ш.; 84° 54′ в.д. (2) 10° 54′ с.ш.; 89° 94′ в.д. (3) 9° с.ш.; 81°5′ в. д. (4) 8° 76′ с. ш.; 81°15′ в.д., во время экспедиции (NCAOR). Все пробы воды хранились в темном ящике со льдом в контролируемых условиях для дальнейшей обработки в лаборатории.

2.2. Выделение актиномицетов из проб морской воды

Выделение актиномицетов проводили путем фильтрации 5 мл проб глубоководной воды с использованием нитратцеллюлозного фильтра Sartorius (0.размер пор 45 мкм), а затем переворачивают на чашках с крахмал-казеиновым (СК) агаром, содержащим крахмал – 10 г, казеин – 0,3 г, CaCO 3 – 0,02 г, FeSO 4 .7H 2 O- 0,01 г, KNO 3 — 2 г, NaCl- 2 г, K 2 HPO 4 — 2 г, MgSO 4 .7H 2 O- 0,05 г, агар 15 г, морская вода 500 мл, дистиллированная воды 500 мл и инкубируют при 20°С в течение 72 часов. В планшеты SC добавляли 50 мкг/мл циклогексимида, чтобы свести к минимуму грибковое загрязнение. Отдельные колонии собирали и затем высевали штрихами на агар SC и среду International Streptomyces Project 2 (ISP-2) с агаром, содержащим (на литр) дрожжевой экстракт — 4 г, солодовый экстракт — 10 г, декстрозу — 4 г, агар — 20 г. .Выросшие колонии актиномицетов наблюдали под световым микроскопом по кожистому или меловидному виду, размеру и форме колоний, цвету мицелия и нитевидной природе. Субкультуры поддерживали на скосах SC.

2.3. Морфологическая и биохимическая характеристика морских актиномицетов

Для изучения морфологической дифференциации, такой как количество спор, присутствующих в цепочке, цвет воздушного и субстратного мицелия, применяли методику культивирования покровных стекол. Окрашивание по Граму, восстановление нитратов, каталазы, тест на гидролиз крахмала, образование экзополисахаридов (ЭПС), растворимых и диффундирующих пигментов проводили в соответствии со стандартными протоколами.Было исследовано использование различных источников углерода, чтобы достичь возможной классификации изолированных видов.

2.4. Физиологическая характеристика морских актиномицетов

Все морские изоляты инкубировали при температуре от 4ºC до 40ºC, pH от 6,5 до 9 в бульонной среде SC. Для изучения влияния NaCl на рост изоляты инокулировали при концентрации NaCl от 0 до 20%. Рост морских актиномицетов был разделен на три категории, такие как обильные, умеренные и медленнорастущие.Все изоляты морских актиномицетов выращивали на СК бульонных средах при 20°С, 150 об/мин и наблюдали за ростом до 30 сут.

Структуры микроорганизмов, появляющиеся на чашках с SC-агаром, исследовали с помощью светового микроскопа, а затем более подробно с помощью сканирующего электронного микроскопа (СЭМ). Колонии и структуры фиксировали путем помещения в 2% (об./об.) глутаральдегида в 0,1 М растворе какодилата натрия [Na(CH 3 ) 2 .AsO 2 ] буфера (pH 7.2-7.4) с последующей обработкой смачивателем Тритон на ночь в течение 5 сут [6, 7].

2.5. Генотипическая характеристика и филогенетическая классификация Streptomyces

Молекулярная характеристика Streptomyces была проведена с помощью анализа 16S рРНК. Клетки из биомассы собирали центрифугированием, промывали и ресуспендировали в буфере ТЕ (10 мМ Трис/HCl, 1 мМ ЭДТА, рН 8,0). Геномную ДНК экстрагировали по стандартному протоколу, а ПЦР-амплификацию проводили в градиенте Eppendorf Master Cycle AG22331 (модель No.5331), используя соответствующий прямой праймер 27F (5′ AGA GTT TGA TCC TGG CTC AG 3′) и обратный праймер 1525R (5′ AGA AAG GAG GTG ATC CAG CC 3′) в системе нумерации E. coli [8, 9]. Амплифицированные продукты секвенировали в Applied Biosystem Sequencer (анализатор ДНК ABI 3730XL) с соответствующими праймерами.

Эта последовательность гена 16S рРНК была использована для филогенетического анализа. Таксоны, связанные с последовательностью гена 16S рРНК, были получены из базы данных GenBank, а праймер был разработан с использованием программного обеспечения Primer 3.Множественное выравнивание последовательностей проводили с помощью программы Clustal W, а филогенетическое дерево строили методом соседнего соединения [10, 11] с использованием программы MEGA7 (https://www.megasoftware.net/) и программы филогенеза (http:/ /www.phylogeny.fr/). Эволюционные расстояния для дерева объединения соседей и дерева максимального правдоподобия были рассчитаны с помощью двухпараметрического метода Кимуры. Топологии каждого дерева были оценены с использованием методов повторной выборки начальной загрузки на основе 1000 повторений.

2.6. Скрининг на холодоактивные ферменты промышленного значения

Изоляты подвергали скринингу на холодоактивные катализаторы, такие как амилаза, целлюлаза, липаза, пектиназа и L-аспарагиназа. Отдельный род актиномицетов инокулировали точечно и инкубировали при 20°С на чашке с агаром с соответствующими субстратами.

Анализ амилазы проводили на модифицированном агаре Беннета, содержащем декстрин — 10 г, дрожжевой экстракт — 1 г, N-Z Амин А — 2 г, экстракт говядины — 1 г, CoCl 2 .6H 2 O — 0,01 г, агар — 15 г, с добавлением 1% (масса/объем) крахмала при рН 7,6. Организмы инокулировали точечно и инкубировали в течение 5 дней, а затем заливали йодом Грама. Развитие прозрачной зоны указывало на продукцию амилазы тест-организмами.

Анализ целлюлазы проводили точечным посевом на среду Менделя и Риза, состоящую из KH 2 PO 4 — 2 г, (NH 4 ) 2 SO 4 — 1,4 г, CO (NH 2 ) 2 — 0.3 г, MgSO 4 .7H 2 O- 0,3 г, CaCl 2 — 0,3 г, пептон- 1 г, твин80- 2 мл, FeSO 4 .7H 2 г, MnSO 0- 0 4 .H 2 O- 0,002 г, ZnSO 4 .7H 2 O- 0,001 г, CoCl 2 — 0,002 г, агар- 15 г ). Через 72 часа инкубации планшеты заливали раствором йода и йодида калия для подтверждения продукции целлюлазы.

Анализ липазы проводили на питательной агаризованной среде с экстрактом говядины (0.3%), пептона (0,5%) и агара (1,5%), с добавлением 31,25 мл оливкового масла и 10 мл раствора родамина Б (0,001%, масса/объем). Изоляты инокулировали в течение 72 часов при 20°С. Липазную активность изолятов определяли по образованию ореола флуоресценции оранжевого цвета при УФ-облучении.

Для скрининга активности пектиназы был проведен анализ на чашках. С указанной целью использовали агаризованную среду SC с 1% пектина. Тестовые микроорганизмы инокулировали и инкубировали при 20ºC в течение 72 часов при pH 6.5. Затем в планшеты добавляли раствор рутениевого красного (вес/объем 0,005%), и наличие просветленных зон указывало на выработку пектиназ.

Скрининг L-аспарагиназы проводили с использованием методики быстрого анализа на чашках, описанной в более ранних публикациях [12, 13]. Для скрининга продукции L-аспарагиназы использовали индикатор феноловый красный и 0,1% аспарагин. После 48 часов инкубации у актиномицетов, продуцирующих L-аспарагиназу, появились зоны розового цвета из-за изменения рН среды.

2.7. Профиль экспрессии генов-кандидатов из Streptomyces

Профиль экспрессии генов-кандидатов, которые регулируют биосинтез выбранных ферментов, определяли с помощью количественной ПЦР в реальном времени (RT-qPCR). qRT-PCR проводили с использованием системы ПЦР Applied Biosystems Step-One в реакционном объеме 10 мкл, 2,5 мкл кДНК с 200 мкМ каждого набора праймеров с использованием красителя EvaGreen в качестве детектора (Biotium, Hayward, CA, USA). Праймеры были разработаны с помощью онлайн-программы Primer-3 (www.bioinfo.ut.ee/primer3-0.4.0/) (Таблица 1 ). Эксперимент был количественно определен в трех повторностях при следующих условиях амплификации: 95°С в течение 10 мин, затем 40 циклов 95°С в течение 30 с и 60°С в течение 1 мин.

2.8. Скрининг антибактериальной и противогрибковой активности вновь выделенных актиномицетов

Антибактериальную активность морских актиномицетов определяли методом диффузии в агар. Морские изоляты высевали штрихом вдоль периферии культуральной чашки на агаровую среду Мюллера-Хинтона, состоящую из (г/л) экстракта говядины-2, казеина-17.5, крахмал-1,5, агар-17 (рН 7,5) и инкубировали при 20°С. После четырех дней инкубации штамма Staphylococcus aureus (MTCC 96), штамма Pseudomonas aeruginosa (MTCC 1688), штамма Bacillus subtilis (MTCC 441) и штамма Shigella flexneri (MTCC 1457) подвергли штрих-полоске под прямым углом. против ранее посевной культуры актиномицетов. Зоны ингибирования в отношении патогенов наблюдали через 48 часов инкубации.

Антагонистическую активность актиномицетов в отношении грибкового патогена оценивали по ранее описанному методу [14].Выделенные штаммы высевали штрихами на чашки с картофельно-декстрозным агаром и инкубировали в течение 48 ч при 20°С. Мицелиальный диск Rhizoctonia solani (MTCC 4633) перфорировали в центре чашки. Зону ингибирования измеряли через 72 часа инкубации при 20°С.

2.9. Статистический анализ

Данные анализируются как среднее значение ± стандартная ошибка среднего, при этом значение P<0,05 считается значимым. Данные анализировали с помощью дисперсионного анализа (ANOVA) относительной количественной экспрессии генов с помощью qRT-PCR в реальном времени.

3. РЕЗУЛЬТАТЫ

3.1. Характеристика и филогенетическое распространение глубоководных актиномицетов

Общее количество 37 грамположительных глубоководных актиномицетов sp. nov., были выделены с использованием агаровой среды SC, которые образовывали выпуклые, порошкообразные или приподнятые колонии на чашках с агаром SC. Обильный рост наблюдался у 13 изолятов, умеренный рост был обнаружен у 11 изолятов, а остальные 13 изолятов демонстрировали медленную скорость пролиферации (таблица S1 ). Первичные микроскопические наблюдения и морфологические исследования подтвердили, что большая часть (45.94%) изолятов относились к роду Streptomyces , за которым следуют роды Micromonospora, Actinopolyspora, Actinosynnema, Streptoverticillium, Saccharopolyspora, Nocardiopsis, и Nocardia (табл. S2 ). СЭМ-изображение показало, что штаммы дикого типа содержали много цепочек спор с очень небольшим количеством видимых спорообразующих воздушных гиф (рис. 1A ).

3.2. Оптимальная температура роста и устойчивость к NaCl

Обильный рост и обильное образование мицелия наблюдались при температуре от 15°C до 20°C, а также способность развиваться при 4°C.Всем выделенным актиномицетам для роста требовалась высокая концентрация солей. Оптимальный рост наблюдался при концентрации NaCl от 2 до 5%, а устойчивость к засолению была зарегистрирована при 16% (таблица 2 ), что обычно считается крайне галофильной природой. Среди 37 изолятов серые и белые пигментированные морские актиномицеты были более заметными в глубоководных районах Бенгальского залива. Кроме того, было также отмечено, что из всех изолятов 18 изолятов продуцировали диффундирующие пигменты, а 30 изолятов проявляли ЭПС на агаре ISP-2.

3.3. Фенотипическая характеристика морских Streptomyces

Streptomyces демонстрировали различные морфологические признаки в морфологии споровых цепей, цвете мицелия, пигментации и производстве ЭПС. Фенотипическая характеристика была проведена для определения распределения 17 различных подгрупп Streptomyces . Поверхность спор была гладкой, колючей и морщинистой, каждая цепочка содержала от 3 до 14 спор. При исследовании под световым микроскопом были обнаружены морфологические характеристики спор, таких как споры в виде разветвленных цепочек с образованием прямогибких (n = 9), retinaculipetri (n = 4) и спиральных (n = 4) спор.

В цепочке более 50 спор наблюдалось у Streptomyces sp. S1L-72 и Streptomyces sp. Изолят С3Л-4. Среди всех выделенных штаммов наиболее выделялся белый воздушный и светло-бежевый субстратный мицелий. Было замечено, что из 17 изолятов 11 штаммов продуцировали диффундирующие пигменты, 14 штаммов проявляли ЭПС и 4 штамма проявляли растворимые пигменты в среде ISP-2 (таблица S3 ).

3.4. Генотипическая характеристика Streptomyces

Анализ гена 16S рРНК 17 выделенных штаммов показал гомологию более 94% с Streptomyces (рис. 1B ) и было выявлено гомологическое родство среди 17 Streptomyces (таблица 3 ). Ближайшее совпадение (99,51%) наблюдалось между Streptomyces S1L-39 и Streptomyces — YIMM10400, за которым следует гомология 98,69% с Streptomyces sp. S1L-89, Streptomyces sp. S4L- 25 и Streptomyces sp. С4Л- 68.

3.5. Скрининг активности ферментов адаптированных к холоду актиномицетов

Все представители родов Micromonospora, Actinopolyspora, Actinosynnema, Streptoverticillium, Saccharopolyspora, и Nocardiopsis показали целлюлазную активность (таблица 2 ).Активность амилазы была заметно обнаружена у трех родов, включая Streptoverticillium , Micromonospora, и Actinopolyspora . Интересно, что представители родов Streptoverticillium и Nocardia не обладали липазной активностью. Активность пектиназы была хорошо обнаружена у родов Nocardiopsis, Actinosynnema, и Nocardia, , тогда как L-аспарагиназная активность выявлена ​​у Saccharopolyspora , Streptoverticillium , Micromonospora,

4

4 и Actinopolyspora

4.Роды

Actinosynnema, Streptoverticillium, и Nocardia процветали при оптимальном рН 8,5 и выше, солености до 15% и оптимальной температуре около 15°С.

3.6. Оптимизация условий роста для изолированных Streptomyces

Использование углеводов штаммами Streptomyces показало идентичные вариации в использовании источника углерода (таблица S4 ). Оптимальный рост наблюдался при концентрации NaCl от 2 до 6%, а устойчивость до 10% (масса/объем), классифицируемые как умеренные галофилы. Streptomyces штаммов sp. С1Л-89 и сп. S3L-32 показал максимальный допуск до 16% (вес/объем).

Также были изучены и оценены физиологические характеристики штаммов Streptomyces (таблица 4 ). Все штамма Streptomyces проявляли гидролиз крахмала, а каталазная активность была обнаружена в основном у девяти штаммов. Все штаммы проявляли рост при температуре от 15°С до 35°С, при рН от 7,5 до 8,5. Из 17 штаммов 12 штаммов Streptomyces продемонстрировали обильный рост на среде ISP-2.

3.7. Активность холодоактивных ферментов Streptomyces

Все 17 идентифицированных подгрупп изолятов Streptomyces проявляли ферментативную активность липазы (рис. 2 ). Максимальная активность амилазы (34,89 ЕД/мл), целлюлазы (36,89 ЕД/мл), липазы (43,32 ЕД/мл), пектиназы (18,54 ЕД/мл) и L-аспарагиназы (23,67 ЕД/мл) выявлена ​​у Streptomyces сп. С1Л-89, С1Л-72, С2Л-41, С4Л-54 и С3Л-72 соответственно. Напротив, Streptomyces sp.С4Л-68, сп. С2Л-41, сп. С4Л-24, сп. С2Л-8 и сп. S4L-25 показал минимальную активность амилазы (15,89 ЕД/мл), целлюлозы (10,78 ЕД/мл), липазы (8,89 ЕД/мл), пектиназы (3,02 ЕД/мл) и L-аспарагиназы (7,78 ЕД/мл) соответственно ( рис. 2 ). Ферментативная активность выбранных пяти ферментов в Streptomyces была подтверждена относительными уровнями экспрессии генов (RQ). Количественную ОТ-ПЦР проводили для проверки генов-кандидатов, ответственных за биосинтез амилазы ( aml ; GenBank: {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»Y13601.1″,»term_id»:»4151100″}}Y13601.1), целлюлаза ( CelStrep ; GenBank: {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»HE862416.1″ ,»term_id»:»399498932″}}HE862416.1), липаза ( lipA ; GenBank: {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»U80063″,»term_id» :»2435398″}}U80063), пектиназа ( chb1 ; GenBank: {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»X78535.1″,»term_id»:»861136″ }}X78535.1), L-аспарагиназа ( аспарагиназа ; GenBank: {«type»:»entrez-protein»,»attrs»:{«text»:»WP_037798283.1″,»term_id»:»739947998″}}WP_037798283.1) в Streptomyces (рис. 3 ).

Ферментативная активность от 10% до 30% наблюдалась при температуре от 5°C до 15°C, в то время как 90-100% активности сохранялось между

20°С и 30°С.Термостабильность ферментов была обнаружена между 0°С и 35°С. Однако выше 40°С все ферменты быстро теряли свою активность.

3.8 Антибактериальная и противогрибковая активность всех выделенных актиномицетов

Была оценена антимикробная активность этих изолятов в отношении выбранных патогенов.Роды Saccharopolyspora, Actinosynnema, и Micromonospora не проявляли противогрибковой активности (рис. 4 ). Из всех видов активность против опасного патогена Shigella flexneri была обнаружена только у Streptoverticillium и Nocardiopsis .

Антибактериальная активность была обнаружена у всех подгрупп штаммов Streptomyces . Среди 17 изолятов 15 продемонстрировали многообещающую противомикробную активность в отношении Staphylococcus aureus , 14 изолятов проявили активность в отношении Bacillus subtilis и Pseudomonas aeruginosa , а 13 штаммов проявили активность в отношении Shigella flexneri. Однако пять подгрупп из Streptomyces , а именно sp. С1Л-72, сп. С3Л-4, сп. С3Л-35, сп. С4Л-24 и сп. S4L-68 не проявлял активности против Rhizoctonia solani (рис. 4 ). Кроме того, в общей сложности 6 подгрупп штаммов Streptomyces проявляли высокую активность как против вышеупомянутых патогенных бактерий, так и против грибков.

4. ОБСУЖДЕНИЕ

Согласно проведенному Брууном экологическому зонированию морской температуры, среднегодовая температура 90% морской среды колеблется от 10°С до 5°С [15, 16] и содержит широкий спектр уникальных микробы, которые не могут быть обнаружены в земной среде [17].Биологически активные соединения глубоководных микробных сообществ имеют непревзойденное и непревзойденное значение. Таким образом, все эти микробы в совокупности произвели революцию в области холодной морской биологии и промышленной биотехнологии [3]. Здесь мы описали новые измерения, которые привели к появлению разнообразных групп актиномицетов, которые процветают в глубоких водах Бенгальского залива, и обнаружили доказательства того, что эти

морских видов действуют как ящик Пандоры, который может производить различные биоактивные метаболиты, ускорить возможность их применения в фармацевтической и биотехнологической промышленности [1, 2].

Большинство актиномицетов привлекли мало внимания исследователей в области геномной информации и связанного с ней биосинтетического потенциала. Восемь различных родов актиномицетов из глубинных вод (1,2 км) были выделены в модифицированной агаровой среде SC с добавлением морской воды, которая позволяет размножаться только морским актиномицетам. Первичную идентификацию различных родов актиномицетов проводили по морфологии колоний на поверхности агаровых чашек. Внешний вид колоний, морфология спор, цвет мицелия и диффундирующие пигменты считались важными характерными свойствами для идентификации и дифференциации Streptomyces от других соответствующих видов актиномицетов [18].Предварительное наблюдение показало, что род Streptomyces является наиболее зарегистрированным родом в Бенгальском заливе. Хорошо известно, что большинство морских изолятов имеют серо-белый воздушный спиральный мицелий. Споры в цепочке были спиралевидными, прямогибкими или retinaculipetri, а также продуцировали диффундирующие и ЭПС пигменты. В отличие от других, этот диффундирующий пигмент и ЭПС являются вспомогательным механизмом для выживания морских актиномицетов в морской среде [19].

Разнообразие глубоководных актиномицетов ранее подробно не исследовалось [20]. Благодаря обильному росту в щелочных средах, успешному развитию при низких температурах и высокой солености

среды эти изоляты относятся к категории психотолерантных галофилов [21, 22]. Из-за нехватки исследований глубоководных психротолерантных животных из Бенгальского залива это исследование может помочь в дальнейших исследованиях генетической дивергенции актиномицетов и уникального потенциала промышленных подходов.Несмотря на то, что среди 17 подгрупп Streptomyces были обнаружены высокие уровни гомологичных отношений, определенные различия в оптимальной температуре роста, солеустойчивости и физико-химических свойствах указывают на гетерогенность внутри рода.

Актиномицеты хорошо известны продукцией биоактивных метаболитов с широким спектром паразитарной, противоопухолевой, инсектицидной и противомикробной активности [23-25]. Большинство выделенных актиномицетов наряду с липазной, L-аспарагиназной, амилазной и пектиназной активностью проявляли целлюлазную активность [26-29].Усовершенствования в производстве и активности биокатализатора из этих новых актиномицетов дополнительно направлены на оптимизацию условий роста.

Были оценены антибактериальные и противогрибковые свойства этих морских изолятов в отношении четырех опасных для человека патогенных бактерий и одного агропатологического грибка. Было замечено, что наши шесть лучших новых штаммов рода Streptomyces показали эффективную активность параллельно как против бактерий, так и против грибков [30]. Мы не обнаружили противогрибковой активности у всех актиномицетов, не относящихся к стрептомицетам, и у пяти штаммов Streptomyces .Наше наблюдение очень похоже на данные, согласно которым часть стрептомицетов и большинство нестрептомицетов из образцов почвы не являются продуцентами фармацевтических метаболитов [31].

Актиномицеты, особенно неуловимые Streptomyces sp. привлекли значительное внимание во всем мире из-за производства многих полезных биоактивных метаболитов [32]. Эти психозимы пользуются большим спросом из-за дефицита и доступности [2]. Исследования проводятся независимо для оптимизации и усиления выработки холодоактивных ферментов и антагонистических метаболических экссудатов. Streptomyces являются сапрофитами и способствуют круговороту сложных биополимеров как в наземных, так и в морских средах обитания, а также проявляют широкий спектр антимикробной активности [33-35]. В настоящее время Streptomyces sp. является важнейшим источником антибиотиков для медицины, ветеринарии и сельского хозяйства [4, 36-38]. Научные исследования, в ходе которых были опубликованы отчеты о филогении глубоководных галофилов в сочетании с устойчивостью к экстремальным физико-химическим условиям окружающей среды и ростом для производства биоферментов и антимикробных соединений за одну попытку, редки и бесценны.

ЗАКЛЮЧЕНИЕ

В этом исследовании мы сообщили, что глубоководные актиномицеты Бенгальского залива эволюционировали с наибольшим геномным и метаболическим разнообразием, которое должно быть направлено на изучение источников новых вторичных метаболитов. Успех зависит от молекулярных исследований вторичного метаболита, продуцируемого глубоководными актиномицетами, которые могут быть полезны для дальнейшей разработки фармацевтических препаратов и важных сельскохозяйственных соединений. Все выделенные штаммы, о которых сообщалось в данном исследовании, проявляли мультиферментную активность.Высокая специфичность при низких температурах, термическая устойчивость и антагонистическая активность в отношении грибковых патогенов указывают на универсальность глубоководных актиномицетов, выделенных из Бенгальского залива. Холодоактивные ферменты не только ускоряют интрижку, снижая экономическую нагрузку на процесс за счет сокращения времени метода, но, кроме того, уменьшают несчастья в нестабильных ферментативных компонентах [39-41]. Однако физиологические, биохимические и молекулярные свойства 95% морских актиномицетов еще недостаточно изучены.Таким образом, распространение генетической дивергенции и расширение популяции актиномицетов в Бенгальском заливе потребуют дальнейших углубленных исследований и исследований.

( A ) Сканирующая электронная микроскопия стрептомицетов. Электронная фотография изолированных стрептомицетов, штамма дикого типа, который содержит много цепочек спор с очень небольшим количеством спорообразующих воздушных гиф; ( B ) Метод соседнего соединения, отображающий разнообразие и филогенетические отношения среди Streptomyces на основе последовательностей генов 16S рРНК (значения начальной загрузки выше 50% указывают на основные узлы).Секвенирование гена 16S рРНК 17 изолятов показало, что все штаммы проявляли гомологию более 94% с родом Streptomyces . ( Более высокое разрешение / цветная версия этого рисунка доступна в электронной копии статьи ).

Активность пяти промышленных важных адаптивных ферментов к холоду свойства штаммов Streptomyces . Все 17 идентифицированных штаммов из Streptomyces проявляли ферментативную активность.( Более высокое разрешение / цветная версия этого рисунка доступна в электронной копии статьи ).

Относительные уровни экспрессии. Столбцы, показывающие экспрессию пяти генов, регулируют биосинтез выбранных ферментов в Streptomyces . ( Более высокое разрешение / цветная версия этого рисунка доступна в электронной копии статьи ).

Антимикробные свойства штаммов Streptomyces в отношении селективных патогенов.Среди 17 изолятов Streptomyces 15 из них показали многообещающую антимикробную активность против Streptomyces aureus , 14 изолятов проявили активность против Bacillus subtilis и 204 Pseudomonas aeruginosa , а 13 штаммов показали активность против штаммов Pseudomonas aeruginosa и 13 штаммов. ( Более высокое разрешение / цветная версия этого рисунка доступна в электронной копии статьи ).

Таблица 1

Праймеры детализируют гены-кандидаты.

Имя гена Последовательности праймеров Температура отжига (Ta) Размер изделия Идентификатор GenBank
AML F 5 ‘CTGCACCTCGCAGATAAACA 3’ 60 ° C 60 ° C 246 {«Тип»: «Entrez-Nucleotide», «attrs»: {«текст»: «Y13601. 1 «,» term_id «:» 4151100 «}} y13601.1
R 5’GCCTCGTGCTTTCAGTAGAGAC 3 ‘ 60 ° C
CELSTEP F 5’TACAACGCCTCGTACGACAT 3′ 59 ° C 241 {«type»:»entrez-нуклеотид»,»attrs»:{«текст»:»HE862416.1 «,» term_id «:» 399498932 «}} he862416.1
R 5’AGTCCATCACGTCGAAGCTC 3 ‘ 60 ° C
Lipa F5’GGTagatggccgaagaccttg 3′ 59 ° C 238 {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»U80063″,»term_id»:»2435398″}}U80063
R 5’GGTAACCACGTCACCTTCGT 3′ 59°C
chb1 F 5’GGTCCGTGATTGGTATGGAC 3′ 60°C 237 237 237 .1 «,» term_id «:» 861136 «}} x78535.1
R 5’CACATTTTTCCCCTGCTGAC 3 ‘ 59 ° C
ASPARAGINASE F 5’CCCGGGGGAAAACCTGTATGATG 3′ 60 ° C 167 {«type»:»entrez-protein»,»attrs»:{«text»:»WP_037798283.1″,»term_id»:»739947998″}}WP_037798283.1
R 5′ CAATTTTGCCCAGCAGTTCT 3′ 60°C

Таблица 2

Физиологическое распространение глубоководных актиномицетов.


— 9 1094 —
Характеристики Сахарополиспора Стрептовертициллиум Нокардиопсис Актиносиннема Микромоноспора Нокардия Актинополиспора
Всего изолятов 2 3 1 31250 1 3 6 1 4
PH диапазон 7.0-8.5 8.0-8.5 8.0- 80046 8.0- 8.5 7.0- 8.5 7.5- 7.0 7.5-80 7.5- 8.5 7.5-804
Рост на уровне
4 ° C
41 ° C

W
+ +
+
W
+

W
+
+
Оптимальная температура роста (° C) 38 ± 2.0 15±2,0 35±2,0 20±2,0 35±2.0 15 ± 2.0 15 ± 2.0 15 ± 2.0
NaCL Концентрация (%) 0.5-16 0.5- 140046 0.5-4.0 1.0- 13 0.5-10 2,0-10,0 0.5- 15.0
Оптимальный NaCL
Концентрация (%)
2.0 2.0 2,5 2.5 3.0 5.0
Антимикробная активность
(зона ингибирования в мм )
С.Aureus 15 ± 0.2 11 ± 0,4 0 ± 0 0 ± 0 14 ± 0,2 9,0 ± 0.5 9,0 ± 0 0 ± 0 11 ± 0.2
14 ± 0,6 0 ± 0 0 ± 0 0 ± 0 10 ± 0 10 ± 0.3 11 ± 0.4 14 ± 0.2 14 ± 0,2 14 ± 0,3
P. aeruginosa 0 ± 0 0 ± 0 0±0 11±0,2 17±0,4 12±0.4 10 ± 0,4
S. Flexneri 0 ± 0 0 ± 0 18 ± 0,2 13 ± 0,2 0 ± 0 0 ± 0 0 ± 0 0 ± 0 0 ± 0
R. Solani

R. Solani

0 ± 0 15 ± 0,2 14 ± 0,2 0 ± 0 0 ± 0 0 ± 0 0 ± 0.3 22 ± 0,2 14 ± 0.2
Ферментная активность +
Амилаза + + +
целлюлазы + + + + + + +
Липаза + + + + +
Пектиназа + + +
L-Asperaginase + + + +
+

Таблица 3

Глонологические отношения между 17 изолятов Streptomyces.Степени гомологии указаны в процентах.

0 0 — 0 0 0 — 0
STREPTOMECES SP.S1L-89
0 0 0 —
1 стрептомы 1 С3Л-78 STREPTOMECES SP. S3L-78 0 — 0
Streptomyces sp. С1Л-26 Streptomyces sp. С1Л-89 Streptomyces sp. С4Л-25 Streptomyces sp. С4Л-68 Streptomyces sp. С3Л-72 Streptomyces sp. С3Л-78 Streptomyces sp. С1Л-39 Streptomyces sp.С3Л-35 Streptomyces sp. С3Л-4 Streptomyces sp. С3Л-56 Streptomyces sp. С3Л-11 Streptomyces sp. С4Л-54 Streptomyces sp. С3Л-78 Streptomyces sp. С1Л-72 Streptomyces sp. С3Л-32 Streptomyces sp. С2Л-8 Streptomyces sp. С2Л-41
Streptomyces sp.S1L-26 100
98,8 100
Streptomyces Sp.S4L-25 98,2 98,7 100
Streptomyces Sp.S4L-68 98 98,5 99,2 100
Streptomyces Sp. С3Л-72 97.89 97,3 98 98,5 100
97.01 97.7 98 98,3 99 100
Streptomyces sp. С1Л-39 96 96,8 97 97.4 98 98,5 100
Streptomyces sp. С3Л-35 96 96,2 96,9 97 97 98 98.7 100
Streptomyces sp. S3L-4 94,1 94,7 95 95 95 95,4 96 96,8 100
СтрептомияS3L-56 94 94,4 94,8 95 95 95,2 95,8 96 99 100
Streptomyces sp. S3L-11 94 94,2 94,5 94,89 94.7 95 95 96 99 99,6 100
Streptomyces sp. S4L-54 93 94 94 94.1 94.1 94 94.34 94.2 94.2 95 95 95.8 98.5 100
93 94 94 93,3 93,8 94 94 94,65 95,2 95 98 99 100
Streptomyces sp.S1L-72 93 93,89 93,94 93,1 93 93,4 93,9 94 95 95 97 98 98 100
Streptomyces sp. S3L-32 93 93,32 93,54 93 93,4 93 93.67 93.98 94 94.23 94.23 95 97 97 99 100
Streptomyces Sp. S2L-8 92 92,18 93 93 93 93 93 93,58 93,89 94 94,38 95 96 97 97 100
Streptomyces sp.S2L-41 89 89,54 90,43 90,86 91 91,07 91,68 92 92,13 92,8 93,13 96 96,2 96,8 97 99 100

Таблица 4

Физиологические характеристики изолятов Штаммы Streptomyces .

+
Streptomyces
SP. S2L-8
Streptomyces
SP.S2L-41
Streptomyces
SP. S3L-4 + + 8 8 Streptomyces S4L-54
Изоляты Штаммы Streptomyces рН Рост на
4°С 41°С
Оптимальная температура (°C) Восстановление нитратов Концентрация NaCl (%) Оптимальный NaCl (%) Скорость роста Активность каталазы Гидролиз крахмала
Streptomyces
sp.S1L-26
7.5 ± 0.2 + — + — + + 0.5- 6.0 2 +
Streptomyces
SP. S1L-39
8.5 ± 0.2 + — + — 20 ± 2.0 + 0.5-10,0 2 +
Streptomyces
SP. С1Л-72
8,0±0,2 + — 20±2.0 + 0,5- 6,0 2 Медленный + +
Streptomyces 9004ces 9004ces 9004ces S1L-89 8.5 ± 0.2 — + — + 35 ± 2.0 2.0- 16.0 5 обильный +
7.0 ± 0.2 + — + — 20 ± 2.0 + 2.0- 10.0 3 + W
7.5 ± 0.2 + — + — 20 ± 2.0 + 1,0- 8,0 2 обильный +
7.5 ± 0.2 W — W — 30 ± 2.0 2.0- 10.0 2 обильный + +
Streptomyces
SP. С3Л-11
8,0±0,2 + — 15±2.0 0,5- 8,0 2 Умеренная +
Streptomyces 9004ces 9004ces 9004ces S3L-32 7.5 ± 0.2 + — + — 20 ± 2.0 2.0- 16.0 5 Ударь +
Streptomyces
SP. С3Л-35
7,5±0,2 — ш 35±2,0 + 0,5-6.0 1 Обильные + w
Streptomyces
sp. S3L-56
8.5 ± 0.2 + — + — 20 ± 2.0 + 1.0- 8.0 2 Обитый +
Streptomyces
SP. S3L-72
8.5 ± 0.2 + — + — 20 ± 2.0 1.0- 8.0 2 + +
Streptomyces
SP.S3L-78
8,0 ± 0.2 + — + — 25 ± 2.0 + 0.5-6.0 1 +
Streptomyces
SP. S4L-24
7.5 ± 0.2 + — + — 15 ± 2.0 0.5- 6.0 2 медленный +
Streptomyces
SP. С4Л-25
7,5±0,2 — + 35±2.0 2,0- 10,0 3 Обильный w
7.5 ± 0.2 + — + — 20 ± 2.0 0.5-10.0 3 Обшибатель + +
Streptomyces
SP. С4Л-68
8,0±0,2 + — 20±2,0 2,0-10.0 4 Медленно +

Благодарности

Сбор данных, формальный анализ и исследование проведены Мринмоем Пулирнахом Гошем и Кнулирнахом; Администрирование проекта Кришна Кант Пуличерла; научная помощь и коррекция: д-р Мита Гера; Валидация, Мринмой Гош; Написание — первоначальный вариант, Мринмой Гош; Рецензирование и редактирование, Мринмой Гош, Кришна Кант Пуличерла, Рам Прасад и Джогиндер Сингх Панвар.Все авторы рассмотрели рукопись. Авторы выражают благодарность профессору Донгки Чону за его научную поддержку при проведении этого эксперимента.

ДОПОЛНИТЕЛЬНЫЕ МАТЕРИАЛЫ

Дополнительные материалы доступны на веб-сайте издателя вместе с опубликованной статьей.

Одобрение этики и согласие на участие

Неприменимо.

Права человека и животных

В исследованиях, лежащих в основе данного исследования, не использовались животные/люди.

Согласие на публикацию

Неприменимо.

Наличие данных и материалов

Неприменимо.

КОНФЛИКТ ИНТЕРЕСОВ

Авторы заявляют об отсутствии конфликта интересов, финансового или иного.

ЛИТЕРАТУРА

1. Чатер К.Ф. Streptomyces изнутри: новый взгляд на бактерии, дающие нам антибиотики. Филос. Транс. Р. Соц. Лонд. Б биол. науч. 2006;361(1469):761–768. doi: 10.1098/rstb.2005.1758. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]2.Пулихерла К.К., Гош М., Суреш П.К., Рао К.Р.С.С. Психрозимы — промышленные ферменты следующего поколения. Дж. Мар. Науч. Рез. Дев. 2011;1:102. doi: 10.4172/2155-9910.1000102. [Перекрестная ссылка] [Академия Google]3. Магарви Н.А., Келлер Дж.М., Бернан В., Дворкин М., Шерман Д.Х. Выделение и характеристика новых таксонов актиномицетов морского происхождения, богатых биоактивными метаболитами. заявл. Окружающая среда. микробиол. 2004;70(12):7520–7529. doi: 10.1128/AEM.70.12.7520-7529.2004. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]4.Эллайя П., Редди А.П.С. Выделение актиномицетов из морских отложений Вишакхапатнама, восточное побережье Индии. Индиан Дж. Гео-Мар. науч. 1987; 16: 134–135. [Google Академия]5. Дженсен П.Р., Минсер Т.Дж., Уильямс П.Г., Феникал В. Разнообразие морских актиномицетов и открытие натуральных продуктов. Антони ван Левенгук. 2005;87(1):43–48. doi: 10.1007/s10482-004-6540-1. [PubMed] [CrossRef] [Google Scholar]6. Кастильо У., Харпер Дж.К., Стробел Г.А., Сирс Дж., Алези К., Форд Э., Лин Дж., Хантер М., Маранта М., Ге Х., Явер Д., Дженсен Дж. Б., Портер Х., Робисон Р., Миллар Д., Хесс В. М., Кондрон М., Теплоу Д. Какадумицины, новые антибиотики из Streptomyces sp NRRL 30566, эндофит Grevillea pteridifolia. FEMS микробиол. лат. 2003;224(2):183–190. doi: 10.1016/S0378-1097(03)00426-9. [PubMed] [CrossRef] [Google Scholar]7. Зин Н.М., Сармин Н.И.М., Гадин Н., Басри Д.Ф., Сидик Н.М., Хесс В.М., Стробель Г.А. Биоактивные эндофитные стрептомицеты Малайского полуострова. ФЭМС микробиол.лат. 2007;274(1):83–88. doi: 10.1111/j.1574-6968.2007.00819.x. [PubMed] [CrossRef] [Google Scholar]8. Хютц А., Шуберт К., Оверманн Дж. Thalassospira sp. выделенный из олиготрофной восточной части Средиземного моря, проявляет хемотаксис по отношению к неорганическому фосфату во время голодания. заявл. Окружающая среда. микробиол. 2011;77(13):4412–4421. doi: 10.1128/AEM.00490-11. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]9. Джеймс Г. Универсальная идентификация бактерий с помощью ПЦР и секвенирования ДНК гена 16S рРНК.В: Шуллер М., редактор. ПЦР для клинической микробиологии. Нью-Йорк: 2010. С. 209–214. [Google Академия] 10. Проенса Д.Н., Франсиско Р., Сантос К.В., Лопес А., Фонсека Л., Абрантес И.М.О., Мораис П.В., Мораис П.В. Разнообразие бактерий, связанных с Bursaphelenchus xylophilus и другими нематодами, выделенными из деревьев Pinus pinaster с болезнью увядания сосны. ПЛОС Один. 2010;5(12):e15191. doi: 10.1371/journal.pone.0015191. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]11.Gascuel O. BIONJ: улучшенная версия алгоритма NJ, основанная на простой модели данных последовательности. Мол. биол. Эвол. 1997;14(7):685–695. doi: 10.1093/oxfordjournals.molbev.a025808. [PubMed] [CrossRef] [Google Scholar] 12. Chevenet F., Brun C., Bañuls AL, Jacq B., Christen R. TreeDyn: к динамической графике и аннотациям для анализа деревьев. Биоинформатика BMC. 2006;7:439. дои: 10.1186/1471-2105-7-439. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]13. Майлунд Т., Бродал Г.С., Фагерберг Р., Педерсен К.Н.С., Филлипс Д. Переработка метода соседнего соединения. Биоинформатика BMC. 2006; 7:29. дои: 10.1186/1471-2105-7-29. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]14. Dereeper A., ​​Audic S., Claverie J.M., Blanc G. BLAST-EXPLORER помогает создавать наборы данных для филогенетического анализа. БМС Эвол. биол. 2010;10:8. дои: 10.1186/1471-2148-10-8. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]15. Гулати Р., Саксена Р.К., Гупта Р. Быстрый анализ на планшетах для скрининга микроорганизмов, продуцирующих L-аспарагиназу.лат. заявл. микробиол. 1997;24(1):23–26. doi: 10.1046/j.1472-765X.1997.00331.x. [PubMed] [CrossRef] [Google Scholar] 16. Баша Н.Б., Реха Р., Комала М., Руби Р. Производство внеклеточного антилейкемического фермента ласпарагиназы из морских актиномицетов путем твердофазной и погруженной ферментации, очистки и характеристики. Троп. Дж. Фарм. Рез. 2009; 8: 353–360. doi: 10.4314/tjpr.v8i4.45230. [Перекрестная ссылка] [Академия Google] 17. Ланда Б.Б., Эрвас А., Беттиол В., Хименес-Диас Р.М. Антагонистическая активность бактерий из ризосферы нута в отношении Fusarium oxysporum f.сп. цицерис. Фитопаразиты. 1997; 25: 305–318. doi: 10.1007/BF02981094. [Перекрестная ссылка] [Академия Google] 18. Гош М., Пуличерла К.К., Рекха В.П.Б., Виджая А., Рао К.Р.С. Оптимизация условий процесса гидролиза лактозы в панировочной сыворотке с помощью адаптивной к холоду β-галактозидазы из психрофильного штамма Thalassospira frigidphilosprofundus. Междунар. Дж. Молочная технология. 2013;66:256–263. doi: 10.1111/1471-0307.12020. [Перекрестная ссылка] [Академия Google] 19. Пулихерла К.К., Кумар П.С., Манидип К., Рекха В.П.Б., Гош М., Самбасива Р.К.Р. Статистический подход к усиленному производству холодоактивной β-галактозидазы из Thalassospira frigidphilosprofundus : нового морского психрофила из глубоких вод Бенгальского залива. Подготов. Биохим. Биотехнолог. 2013;43(8):766–780. doi: 10.1080/10826068.2013.773341. [PubMed] [CrossRef] [Google Scholar] 20. де Врис Д.Дж., Беарт П.М. Лов наркотиков в море: статус и стратегии. Тренды Фармакол. науч. 1995;16(8):275–279. doi: 10.1016/S0165-6147(00)89045-8.[PubMed] [CrossRef] [Google Scholar] 21. Кокаре Ч.Р., Махадик К.Р., Кадам С.С. Выделение биоактивных морских актиномицетов из отложений, выделенных на побережье Гоа и Махараштры (западное побережье Индии). Курс. науч. 2004; 33: 248–256. [Google Академия] 22. Рамеш С., Раджеш М., Мативанан Н. Характеристика термостабильной щелочной протеазы, продуцируемой морским Streptomyces fungicidicus MML1614. Биопроцесс Биосист. англ. 2009;32(6):791–800. doi: 10.1007/s00449-009-0305-1. [PubMed] [CrossRef] [Google Scholar] 23.Минсер Т.Дж., Дженсен П.Р., Кауфман К.А., Феникал В. Широко распространенные и устойчивые популяции крупного нового таксона морских актиномицетов в океанских отложениях. заявл. Окружающая среда. микробиол. 2002;68(10):5005–5011. doi: 10.1128/AEM.68.10.5005-5011.2002. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]24. Рамеш С., Мативанан Н. Скрининг морских актиномицетов, выделенных из Бенгальского залива, Индия, на антимикробную активность и промышленные ферменты. Мировой Дж. Микробиол. Биотехнолог. 2009;25:2103–2111. дои: 10.1007/s11274-009-0113-4. [Перекрестная ссылка] [Академия Google] 25. Котарле М., Негоита Т., Бахрим Г., Стоугард П. Адаптированные к холоду амилаза и протеаза из нового антарктического штамма водоросли Streptomyces 4. иннов. ПЗУ. Пищевая биотехнология. 2009; 5:23–30. [Google Академия] 26. Атта Х.М., Ахмад М.С. Антимицин — биосинтез антибиотика, продуцируемый Streptomyces sp. AZ-AR-262: таксономия, ферментация, очистка и биологическая активность. Ауст. J. Основное приложение. науч. 2009;3:126–135. [Google Академия] 27. Бальц Р. Х. Ренессанс в открытии антибактериальных средств из актиномицетов.Курс. мнение Фармакол. 2008;8(5):557–563. doi: 10.1016/j.coph.2008.04.008. [PubMed] [CrossRef] [Google Scholar] 28. Zheng Z., Zeng W., Huang Y., Yang Z., Li J., Cai H., Su W. Обнаружение противоопухолевой и антимикробной активности актиномицетов, ассоциированных с морскими организмами, выделенных из Тайваньского пролива, Китай. ФЭМС микробиол. лат. 2000;188(1):87–91. doi: 10.1111/j.1574-6968.2000.tb09173.x. [PubMed] [CrossRef] [Google Scholar] 29. Castresana J. Выбор консервативных блоков из нескольких выравниваний для их использования в филогенетическом анализе.Мол. биол. Эвол. 2000;17(4):540–552. doi: 10.1093/oxfordjournals.molbev.a026334. [PubMed] [CrossRef] [Google Scholar] 30. Пила С., Курада Б.В.В.С.Н., Терли Р. Исследование антагонистических морских актиномицетов из Бенгальского залива. Мировой Дж. Микробиол. Биотехнолог. 2005; 2: 583–585. doi: 10.1007/s11274-004-3493-5. [Перекрестная ссылка] [Академия Google] 31. Леон Дж., Лиза Л., Сото И., Куадра Д., Патино Л., Зерпа Р. Биоактивные актиномицеты морских отложений центрального побережья Перу. Реви Пери Биол. 2007; 14: 259–270.[Google Академия] 32. Селвам К., Вишнуприя Б., Бозе К.В.С. Скрининг и количественная оценка морских актиномицетов, продуцирующих промышленные ферменты амилазы, целлюлазы и липазы, с южного побережья Индии. Междунар. Дж. Фарм. биол. Арка 2011;2:1481–1487. [Google Академия] 33. Кокаре Ч.Р., Махадик К.Р., Кадам С.С., Чопаде Б.А. Выделение, характеристика и антимикробная активность морских галофильных видов Actinopolyspora Ah2 с западного побережья Индии. Курс. науч. 2004; 86: 593–597. [Google Академия] 34.Хосака Т., Охниси-Камеяма М., Мурамацу Х., Мураками К., Цуруми Ю., Кодани С., Йошида М., Фуджи А., Очи К. Открытие антибактериальных штаммов актиномицетов с мутациями в РНК-полимеразе или рибосомном белке С12. Нац. Биотехнолог. 2009;27(5):462–464. doi: 10.1038/nbt.1538. [PubMed] [CrossRef] [Google Scholar] 35. Ахмад М.С., Эль-Генди А.О., Ахмед Р.Р., Хассан Х.М., Эль-Каббани Х.М., Мердаш А.Г. Изучение антимикробного и противоопухолевого потенциала Streptomyces sp. AGM12-1 выделен из египетской почвы.Передний. микробиол. 2017;8:438. doi: 10.3389/fmicb.2017.00438. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]37. Дешмукх М.Б., Шридхар К.Р. Распространение и антимикробная активность актиномицетов пресноводного прибрежного водотока. Азиатский J. Microbiol. Биотехнолог. Окружающая среда. науч. 2002; 4: 335–340. [Google Академия] 38. Субрамани Р., Алберсберг В. Морские актиномицеты: постоянный источник новых биоактивных метаболитов. микробиол. Рез. 2012;167(10):571–580. doi: 10.1016/j.micres.2012.06.005. [PubMed] [CrossRef] [Google Scholar] 39.Гош М., Шарма Н., Сингх А.К., Гера М., Пуличерла К.К., Чон Д.К. Трансформация геномики животных с помощью технологий секвенирования следующего поколения: десятилетние вызовы и их влияние на генетическую архитектуру. крит. Преподобный Биотехнолог. 2018;38(8):1157–1175. doi: 10.1080/07388551.2018.1451819. [PubMed] [CrossRef] [Google Scholar]40. Гош М., Пуличерла К.К., Рекха В.П.Б., Раджа П.К., Самбасива Рао К.Р. Холодноактивная β-галактозидаза из Thalassospira sp. 3SC-21 для гидролиза молочной лактозы: новый источник из глубоких вод Бенгальского залива.Мировой Дж. Микробиол. Биотехнолог. 2012;28(9):2859–2869. doi: 10.1007/s11274-012-1097-z. [PubMed] [CrossRef] [Google Scholar]41. Кумар П.С., Пуличерла К., Гош М., Кумар А., Рао К.С. Структурное предсказание и сравнительные исследования стыковки психрофильной β-галактозидазы с лактозой, ONPG и PNPG по сравнению с аналогами мезофильных и термофильных ферментов. Биоинформация. 2011;6(8):311–314. doi: 10.6026/97320630006311. [PMC бесплатная статья] [PubMed] [CrossRef] [Google Scholar]

Гингивит как вероятный источник торакального актиномикоза, вызванный Actinomyces israelii и Actinobacillus actinomycetemcomitans

Актиномикоз — хроническое гранулематозное заболевание шейно-лицевой (55%), брюшной (20%) или грудной (15%) локализации, вызываемое Actinomyces israelii . 1 Он часто сопровождается копатогенами, такими как Actinobacillus actinomycetemcomitans , который также тесно связан с гингивитом. 2

Мы сообщаем о 9-летнем мальчике, у которого в течение шести недель наблюдался кашель, потеря веса и недомогание, но не было лихорадки. При физикальном осмотре у него была тупая правая нижняя доля и признаки гингивита с кариесом нижних моляров.

Скорость оседания эритроцитов (СОЭ) 110 мм, С-реактивный белок (СРБ) 91 мг/л, лейкоциты 14.7×10 9 /л со сдвигом влево. Рентгенологическое исследование грудной клетки x показало консолидацию правой нижней доли с плевральным выпотом; плевральная пункция не диагностическая.

Состояние пациента улучшилось после перорального приема эритромицина; последующее рентгенологическое исследование с разрешением x показало регресс исходных данных. Шесть недель спустя он был повторно госпитализирован с болезненным отеком мягких тканей над правой латеро-дорсальной частью грудной клетки. x Рентгенологическое исследование снова показало правую нижнюю консолидацию; заподозрено костное разрушение одного ребра.Открытая биопсия опухоли показала хронический воспалительный процесс с гноем, содержащим грамположительные нитевидные палочки, напоминающие актиномицеты. Культура была положительной на A israelii и A actinomycetemcomitans . Хотя эти микроорганизмы не были выделены из культуры десны, A actinomycetemcomitans был обнаружен в трех из четырех поражений десны с использованием специфических гибридизационных зондов (IAI-Pado-Test 4.5). 2 В послеоперационном периоде у больного развилась лихорадка.Он полностью выздоровел с помощью ампициллина/сульбактама в течение четырех недель внутривенно, а затем перорально ампициллин/сульбактам в течение трех месяцев.

Актиномикоз редко встречается в Европе и может быть ошибочно принят за злокачественные новообразования или другие гранулематозные или смешанные анаэробные инфекции. Наш пациент, вероятно, аспирировал болезнетворные микроорганизмы из периодонтальных поражений. 3 В то время как A israelii в большинстве случаев чувствителен к пенициллину, тетрациклину, эритромицину и клиндамицину, A actinomycetemcomitans может быть устойчивым, 4, 5 , как это наблюдалось у нашего пациента.Таким образом, адекватные диагностические процедуры, санация раны и длительная антибактериальная терапия могут спасти жизнь при тяжелых актиномикотических инфекциях.

Каталожные номера

  1. Руссо ТП . Возбудители актиномикоза. В: Манделл GLBJ, Долин Р., ред. Принципы и практика инфекционных заболеваний. Филадельфия: Черчилль Ливингстон, 2000: 2645–54.

  2. Вольф Х , Боливар И.Mikrobiologische Diagnostik in der Parodontologie — Eine therapie-unterstützende Maßnahme. Swiss Dent 2002; 23:11–18.

  3. Suzuki JB , Delisle AL. Легочный актиномикоз пародонтального генеза. J Periodontol 1984;55:581-4.

  4. Мартин М.В. . Лечение антибиотиками шейно-лицевого актиномикоза у пациентов с аллергией на пенициллин: клиническое исследование и исследование in vitro.Br J Oral Maxillofac Surg 1985; 23: 428–34.

  5. Моррис Дж.Ф. , Сьюэлл Д.Л. Некротизирующая пневмония, вызванная смешанной инфекцией Actinobacillus actinomycetemcomitans и Actinomyces israelii: клинический случай и обзор. Clin Infect Dis 1994;18:450–2.

фигура 1

  КТ грудной клетки показывает правосторонний плевральный выпот с легочной консолидацией и эрозией ребра (стрелка).

Actinomycetes – определение, классификация/характеристика и культура

Определение, классификация, характеристики, экология и культура


Определение: Что такое актиномицеты?


Actinomycetes — одноклеточные грамположительные бактерии, принадлежащие к отряду Actinomycetales.

Члены этой группы широко распространены в природе и могут быть найдены в различных средах обитания по всему миру. Было показано, что они имеют ряд общих характеристик с грибами (например,грамм. мицелиальный рост) и вызывают те же заболевания, что и грибки в глазах.

Помимо того, что актиномицеты широко распространены, они также универсальны в отношении питания и способны производить различные виды спор. Эти характеристики позволили группе успешно конкурировать с другими организмами в их окружении.

Хотя некоторые представители этой группы вызывают заболевания (например, актиномикоз, вызываемый Actinomyces israelii), они являются важными почвенными организмами (где они расщепляют различные неподатливые органические соединения), а также производят биологически активные соединения, которые использовались в качестве антибиотиков и инсектицидов. и т.п.


Примеры актиномицетов включают:


  • АсНпотусез meyeri
  • Actinomyces israelii
  • Nocardia Brasiliensis
  • Nocardia asteroides
  • Streptomyces coelicolor
  • Streptomyces чесотки

* Имя Актиномицеты является производным от греческих слов «atkis», что означает, что луч и «mykes/mukes», что означает грибы.

 


Классификация


Царство: Бактерии — Являясь представителями царства Бактерии, актиномицеты представляют собой одноклеточные организмы, характеризующиеся простой клеточной структурой.Хотя их можно найти в различных средах по всему миру, некоторые виды могут вызывать заболевания у людей. Как грамположительные бактерии, они также содержат пептидогликановый слой в своей клеточной стенке.

 

Тип: Actinobacteria  — Являясь представителями типа Actinobacteria, Actinomycetes представляют собой грамположительные бактерии, характеризующиеся высоким содержанием G+C в их ДНК. Их можно найти в наземной и водной среде, где они демонстрируют высокую универсальность в питании.Члены этой группы также производят мицелий.

 

Подкласс: Actinobacteridae  — Подкласс Actinobacteridae разнообразен и состоит из широкого круга организмов, которые можно найти в различных средах обитания. В качестве подкласса под типом Actinobacteria члены этой группы производят мицелий.

 

Отряд: Actinomycetales  — Представители отряда Actinomycetales известны как Actinomycetes. Они разнообразны по своей природе и могут быть найдены как в водной, так и в наземной среде.Актиномицеты являются грамположительными бактериями и аэробами (некоторые представители группы являются анаэробами). Для них также характерен нитевидный характер роста.

Отряд (Actinomycetales) далее делится на несколько подотрядов.

Некоторые подотряды включают:

  • Corynebacterineae
  • Micrococcineae
  • Actinomycineae
  • Catenulisporineae


Распространение и экология


Как представители типа Actinobacteria, Actinomycetes широко распространены в различных частях мира.Поскольку они могут жить в разных средах и демонстрируют высокую гибкость в своем питании, это позволяет им распространяться и процветать в разных регионах земного шара и конкурировать с другими организмами в их окружении.

Хотя такие заболевания/инфекции, как актиномикоз (вызванный актимикозом), также встречаются во всем мире, исследования показали, что на их распространенность влияют такие факторы, как социально-экономический статус, гигиена и т. д. 

они существуют в почве в значительных количествах, что делает их одними из наиболее распространенных микроорганизмов в различных типах почвы (около 1 миллиона клеток на грамм почвы).Однако здесь множество факторов (например, pH) влияют на виды, населяющие разные типы почвы.

Некоторые другие факторы, которые могут влиять на тип видов в почве, включают температуру и кислород. В почве актиномицеты особенно полезны, поскольку они разрушают различные прочные соединения/полимеры, от лигноцеллюлозы до пектина и клеточной стенки грибов.

При этом они играют важную роль в переработке органического вещества в почве, а также контролируют рост других микробных организмов, которые обычно являются патогенными для растений.

 

* Актиномицеты также участвуют в фиксации азота в почве.

 

* Землистый запах свежевспаханной почвы обусловлен деятельностью актиномицетов в почве.

 

Помимо почвы, некоторые виды могут быть найдены в водной среде. Хотя их можно найти как в морской, так и в пресноводной среде, они составляют меньшую популяцию в морской среде обитания по сравнению с их преобладанием в наземной и пресноводной среде.

Как и в случае наземных/почвенных местообитаний, актиномицеты также участвуют в разложении различных материалов в морских местообитаниях. Было показано, что они помогают в разложении целлюлозы, альгинатов и различных углеводородов.

 

* Термофильные актиномицеты можно обнаружить в компосте/навозе, особенно на ранних стадиях разложения. Благодаря их участию в разложении повышается уровень тепла в навозе/компосте, что обеспечивает благоприятную среду обитания.

 

* На основании исследований, направленных на изучение характеристик актиномицетов, обитающих в пресных водах (озера, реки и т.д.), показано, что большинство этих организмов смывается с суши.

Здесь споры, происходящие из почвы, гидратируются, что активирует их для высвобождения подвижных спор. Нет убедительных доказательств того, что виды, встречающиеся в морских средах обитания, произошли с суши, учитывая, что они во все большем количестве встречаются на более низких глубинах и хорошо приспособлены к этой среде.

 

 

Некоторые виды способны выживать в различных экстремальных условиях и поэтому могут быть классифицированы на основе этих местообитаний.

Они включают в себя:

· алкалофильные виды — идентифицированы в почве Soda Lake (например, Bogoriella Caseilytica)

· галофильные виды — выживают в районах с высокими концентрациями соли (например, Saccharomomonospora Halophila )

·        Психрофильные виды — Обычно встречаются при очень низких температурах (напр.грамм. Modestobacter multiseptatus)

 


Морфологические характеристики


* Морфологическое сходство между актиномицетами и грибами частично объясняется адаптацией к одной и той же среде обитания.

 

Учитывая, что жизненный цикл многих актиномицетов чередуется между спорами и ростом гиф/мицелия, важно понимать жизненный цикл этих организмов и морфологию различных форм.

Для большинства этих видов спорообразование характеризуется разделением на несколько промежутков надземных гиф. Это включает инвагинацию плазматической мембраны, а также разрыв внутренней стенки. Затем внутренняя стенка гифы начинает утолщаться, образуя толстую стенку.

Стоит отметить, что во время споруляции ядерный материал, который делился, сжимается в перегородке и в конечном итоге делится по окончании процесса разделения. Вокруг каждой споры образуется толстая стенка по мере того, как к стенке добавляется новый материал (в перегородках).

Согласно ряду исследований, процесс спорообразования может происходить за счет фрагментации гиф или образования эндогенных спор. В случаях, когда споры образуются в результате фрагментации/разделения гиф, образовавшиеся споры могут быть покрыты оболочкой даже после фрагментации. Однако это относится не ко всем видам.

В результате фрагментации образуются споры нескольких типов. Это включает; алевриоспоры (продуцируются гифами без оболочки), артроспоры (продуцируются покрытыми оболочкой гифами) и эндоспоры (образуются внутри пузырьков).

В зависимости от вида они различаются по размеру от 0,5 до 1,5 мкм. Помимо более толстой структуры стенки, некоторые споры имеют острые шипы, отходящие от оболочки. Более того, они также содержат генетический материал и цитоплазму родителя.

 

* В почве или при неблагоприятных условиях окружающей среды споры (спящие) способны сохраняться в течение длительного периода времени.

 

При благоприятных условиях окружающей среды споры прорастают, образуя зародышевые трубки.Затем эти зародышевые трубки растут/расширяются, образуя мицелий, состоящий из ветвящихся нитей, также известных как гифы.

В то время как некоторые из этих ветвей закрепляют организм (субстратный мицелий), другие растут вверх (воздушные гифы). Здесь вегетативный мицелий играет важную роль не только в закреплении организма, но и в поглощении питательных веществ.

Воздушные гифы, с другой стороны, выходят в воздух и могут делиться на несколько отсеков, которые удлиняются и производят споры.Затем эти споры попадают в окружающую среду, позволяя циклу продолжаться при благоприятных условиях окружающей среды.

В зависимости от вида актиномицеты имеют размер от 0,5 мкм до более 5,0 мкм. По мере развития воздушных репродуктивных гиф они могут быть удлиненными или слегка изогнутыми. Однако было показано, что по мере подготовки к спороношению они трансформируются и образуют спиральные гифы. Там ДНК, расположенная в цитоплазме, состоит из высокого содержания G+C (гуанина и цитозина) от 55 до 75 %.

 

* Как и многие другие бактерии, актиномицеты имеют клеточную стенку (мицелиальную стенку), покрывающую организм. Эта клеточная стенка состоит из ряда компонентов, включая аминокислоты, сахара, а также аминосахара. Эта клеточная стенка также состоит из слоя пептидогликана, который у большинства видов состоит из диаминопимелиновой кислоты.


Питание


В отличие от цианобактерий актиномицеты являются гетеротрофными организмами и поэтому зависят от различных органических материалов как источника пищи/энергии.Это достигается за счет разложения различных органических материалов (например, целлюлозы, лигнина и т. д.) в их окружении.

Для эффективного расщепления этих соединений актиномицеты производят ряд ферментов, включая целлюлазы и кератиназы.

Ниже приведены некоторые из ферментов, продуцируемых актиномицетами, и органический материал, который они разрушают в окружающей среде: в сахара 

 

·        Протеазы  – несколько групп порядка Actinomycetales (например,грамм. Nocardia и Streptomyces и др.) продуцируют протеазы, расщепляющие различные белковые вещества на более простые компоненты (аминокислоты/полипептиды). Из-за их способности продуцировать протеазы эти организмы используются в различных отраслях промышленности для обработки таких промышленных отходов, как волосы, растительные отходы и т. д. Они используются для расщепления различного ороговевшего материала, содержащегося в различных растениях (напр.грамм. шерсть и т.д.) и останки животных

Некоторые другие ферменты, произведенные актиномицетами, включают в себя:

2

    • Xylanases — разрыв полисахаридов ксилана для производства ксилозы
    • Липазы — разрушение таких липидов в виде триглицеридов
    • Chinases — разрыв Читин
    • Pectinases — разрыв пектина

     

    * Некоторые виды, такие как представители рода Frankia, выживают, образуя симбиотические отношения с бобовыми растениями.Здесь они преобразуют атмосферный азот в пригодные для использования формы (например, нитраты и аммиак).

    * Некоторые виды, такие как виды Actinomyces, могут быть обнаружены во рту и кишечнике, где они существуют как комменсалы. Однако после травмы/повреждения ткани они проникают и продолжают распространяться в ткани, вызывая заболевание (актиномикоз). Здесь патология была связана с их пролиферацией.

     


    Значение актиномицетов


    Как уже упоминалось, актиномицеты играют важную роль в разрушении различных органических материалов в почве.Это важно в сельском хозяйстве, поскольку они помогают перерабатывать материалы, которые могут использоваться растениями. Они также производят различные ферменты, которые используются в различных отраслях промышленности.

    Одним из самых больших преимуществ этих организмов является то, что они производят различные биологически активные метаболиты, которые используются для производства различных лекарств (противогрибковых, противопаразитарных, антибиотиков и т. д.).

     

    *  В настоящее время более 75 процентов антибиотиков получают из видов актиномицетов, особенно представителей рода Streptomyces и Micromonospora.

    См.: Как антибиотики убивают бактерии?

    Некоторые из антибиотиков, полученных из актиномицетов, включают в себя:

    · · Cephamycins — структурно похожи на цефалоспорины, эти антибиотики представляют собой антибактериальные и функционирующие, препятствующие синтезу бактериальной сотовой стенки

    ·

    ·

    · Тетрациклины  – используются против ряда организмов, включая микоплазмы и бактерии, и функционируют, препятствуя синтезу белка

     

    ·        Макролиды  – это антибиотики, используемые для лечения инфекций, вызванных бактериями.Они происходят от Streptomyces и функционируют, вмешиваясь в процесс синтеза белка (перевод)


    Некоторые из других антибиотиков, полученные из актиномицетов, включают в себя:

    • Gentamicin
    • Rifamycin
    • erierthromycin
    • Streptomycin
    • Стрептомицин


    Актиномицеты против грибов


    Как уже упоминалось, актиномицеты ранее принимали за грибы из-за того, что они производят мицелий.Однако они отличаются рядом различий в своей структуре и морфологии.

    Например, несмотря на то, что они оба имеют клеточную стенку, актиномицеты, которые являются грамположительными бактериями, имеют пептидогликановый слой в своей клеточной стенке, в то время как грибы имеют в своей клеточной стенке полимер N-ацетилглюкозамина хитин (у них нет пептидогликанового слоя). .

    Эти два вида также отличаются тем, что грибы являются эукариотами, а актиномицеты — прокариотами. Как прокариоты, актиномицеты лишены связанных с ядром органелл (например,грамм. ядро, аппарат Гольджи и др.), присутствующие в клетках грибов.

    Хотя у них обоих есть нити (они оба производят гифы), нити, продуцируемые актиномицетами, обычно меньше по размеру по сравнению с нитями, продуцируемыми грибами.

     


    Культура



    Требования

     


    Процедура приготовления агаровой среды:

    Чтобы приготовить среду для культивирования, выполните следующие несколько шагов:

     

    Налейте 1000 мл дистиллированной воды в контейнер (большой стакан и т. д.)

    Добавьте 63.0 г крахмала в химический стакан/контейнер

     

    * Затем смесь автоклавируют при 121°C в течение примерно 15 минут при давлении 15 фунтов для целей стерилизации.

     


    Процедура

    ·        Возьмите образец почвы – актиномицеты могут быть обнаружены в почве

    ·        Дайте среде отстояться

    ·        Поместите мембранный фильтр в центр каждой чашки и тщательно разбрызгайте. почва на фильтрах

    ·        Инкубируйте чашки в течение примерно 4 дней при температуре около 25 °C

    ·        Удалите фильтры и продолжайте инкубацию, пока бактерии не станут видимыми

     

    Наблюдение

    Актиномицеты образуют колонии, цвет которых может варьироваться от белого до желтого.

    Возврат из Actinomycetes в дом MicroscopeMaster

    сообщить об этом объявлении


    Каталожные номера

    Эссаид Айт Барка и др. (2016). Таксономия, физиология и натуральные продукты актинобактерий.

     

    Джон Г. Торри. (1978). Фиксация азота покрытосеменными клубеньками актиномицетов.

     

    Мукеш Шарма, Пинки Данги и Минакши Чоудхари. (2014). Актиномицеты: источник, идентификация и их применение.

      

    Пасинду Чамикара. (2016). актиномицеты.

     

    Пол Ньенга В., Мваура Ф.Б., Вагача Дж.М. и Гатуру Э.М. (2017). Методы выделения актиномицетов из почв кратера Мененгаи в Кении.

     

    Т. Роузбери. (1944). Паразитические актиномицеты и другие нитчатые микроорганизмы полости рта: обзор их характеристик и взаимоотношений, бактериологии актиномикоза и слюнных камней у человека.

     

     

    Ссылки

     

    https://www.sciencedirect.com/topics/medicine-and-dentistry/actinomyces

    https://www.researchgate.net/figure/Schematic-representation-of-the-life-cycle-of-sporulating-actinomycetes_fig1_284716361

    Узнайте, как размещать рекламу на MicroscopeMaster!

    .