Содержание

Лечение периодонтита в Нижнем Тагиле. Клиника GalaDent

Периодонтит — это опасное воспаление корня зуба, передающееся на прилегающие к нему мягкие ткани. Характеризуется воспалением соединительных тканей, расположенных между корнем зуба и альвеолой. Эта прослойка тканей удерживает зуб, не дает ему смещаться при надавливании или жевании. Болезнь часто протекает без ярко выраженных симптомов, и человек замечает её только при обострении, когда увеличивается риск развития осложнений. В активных фазах симптоматика характеризуется острыми болевыми ощущениями, в том числе в виде пульсации.

Если периодонтит не лечить, то бактерии проникают за пределы зубных каналов, провоцируя воспалительный процесс в окружающих тканях. В худших случаях это приводит к потере зуба.

Виды периодонтита

Причины возникновения и состояния иммунитета человека определяют различное течение болезни. Патология может дать о себе знать в первые дни появления или на протяжении нескольких месяцев никак не проявлять себя для больного.

В зависимости от наличия либо отсутствия болевых ощущений, наличия сопутствующих проявлений, а также степени распространения воспаления, различают следующие виды периодонтита:

  1. Острый периодонтит. Встречается довольно редко. Характеризуется сильной болью, которая усиливается при надавливании. Кроме того, вызывает отёк десны, повышение температуры тела. В случае отсутствии лечения переходит в хронический.
  2. Хронический периодонтит. Длительное время протекает бессимптомно для больного. Сильная боль отсутствует. Средние или слабые болезненные ощущения возникают только при надавливании. Приступы боли могут возникать при переохлаждении или стрессе.  У больного зуба появляется явная подвижность.
  3. Гранулезный периодонтит. Характеризуется появлением гнойного свища на поверхности десны. Такая болезнь требует экстренного лечения, так как несет опасность для всего организма.
  4. Гранулематозный периодонтит. Воспалительный процесс распространяется на костные ткани и десна. Сопровождается невыносимой болью.
  5. Фиброзный периодонтит. Главное отличие – появление кисты с гнойным экссудатом под корнем зуба. Киста провоцирует расшатыванию зуба. Возникшие болезненные ощущения настолько сильны, что человек не способен не только жевать, но и лежать на щеке.

Причины появления периодонтита

Врачи различают ряд причин появления периодонтита, которые делятся на следующие категории.

  • Инфекционная. Причина развития воспалительного процесса — вредоносные микроорганизмы. Попасть они могут через кариозное отверстие в зубе или через кровоток.
  • Контактная. Вызвана разложением застрявших в корневых каналах частичек пищи при наличии коронок, в достаточной степени разрушенных кариесом. Продукты разложения могут спровоцировать воспаление.
  • Травматическая. Воспалительный процесс проявляется после повреждения тканей возле зуба из-за сильных ударов, падений или других травм.
  • Медикаментозная. Спровоцировать периодонтит может лекарственное средство или пломба, используемая стоматологом при лечении зубов.

Как правило, патология развивается, как и большинство болезней зубочелюстной системы, из-за отсутствия должного ухода за ротовой полостью или халатности врача. Если при лечении кариеса недостаточно тщательно почищены каналы или в зубе остались частички инструмента, вероятность развития периодонтита многократно увеличивается.

Основные симптомы периодонтита

Главная сложность периодонтита кроется в длительном отсутствии симптомов его проявления. В большей степени это касается хронической формы заболевания. Обнаружить периодонтит можно только по болезненным ощущениям, которые возникают при надавливании.

  • Острый периодонтит сопровождается следующими симптомами:
  • Сильная боль, усиливающаяся при надавливании или прикусывании;
  • Неприятный гнилостный запах изо рта;
  • Покраснение десны;
  • Появление на поверхности десны кисты с гноем.

Кроме того, при тяжелом протекании патологии может подниматься температура, появиться тошнота из-за интоксикации. В таком случае обращение к врачу нельзя откладывать.

Лечение периодонтита

Некоторые пациенты предпочитают использовать нетрадиционную медицину для лечения периодонтита, заниматься самолечением. Однако, стоматологи категорически запрещают это делать. Народные средства допустимо применять только в качестве вспомогательных методов после обследования у врача.

Для диагностики применяется рентген. Лечение состоит из нескольких этапов.

  • В первую очередь врач удаляет гной и экссудат.
  • При необходимости происходит рассверливание зуба сверху или сбоку, если стоит несъемная коронка.
  • Место локации воспаления в обязательном порядке промывается антисептиком.
  • Далее врач накладывает лекарство, которое ускоряет заживление раны и предупреждает распространение инфекции. Иногда требуется прием антибиотиков внутрь.
  • Зуб закрывается временной пломбой или остается открытым. Во втором случае пациенту нужно регулярно полоскать зуб раствором с антисептиком. Постоянная пломба накладывается уже после заживления раны.

Лечение периодонтита в Одинцово: цена, отзывы, процедуры

Лечение острых форм периодонтита

Цель лечения острых форм периодонтита заключается в том, чтобы устранить воспаление и прекратить образование гнойного экссудата. Существует две формы терапии: консервативная и хирургическая. При консервативном лечении требуется рентген, анестезия, обеспечение доступа к каналам, удаление нерва, очищение канала и его расширение. В канал помещается антисептик. После этого назначаются антибиотики и противовоспалительные медикаменты. Через 2-3 дня временную пломбу удаляют, промывают каналы антисептиком, пломбируют временным материалом. Срок третьего посещения устанавливает врач. Пациенту выполняется рентген, удаляются временные пломбы, промывают канал антисептиком и устанавливают постоянную пломбу.

При хирургическом лечении удаляют корень зуба частично или полностью, а потом удаляют зуб. Такие меры принимаются в крайних случаях. При щадящем варианте производят резекцию затронутой воспалительным процессом частью зуба.

Лечение хронических форм периодонтита

Хроническая форма болезни лечится в зависимости от его подвида. На терапию фиброзной требуется 2-3 визита, на лечение других форм займет 2-3 месяцев. Главные задачи лечения: сохранение и восстановление формы зуба, избавление от воспаления.

Процесс лечения фиброзной формы начинается с того, что стоматолог раскрывает полость зуба, обрабатывает каналы зуба, вскрывает апекс корня, проводит антисептическую обработку каналов, устанавливает временную пломбу.

Пациент проходит физиотерапевтические процедуры с целью снятия воспалительного процесса. Если осложнений нет, врач прочищает канал и устанавливает постоянную пломбу.

Гранулематозный и гранулирующий периодонтит лечится 2-6 месяцев. После вскрытия зуба удаляется пульпа, раскрываются и углубляются каналы зубов, в канал закладывают турунду, ставят временную пломбу. Пациент принимает НПВС или антибиотики.

Антисептик ставится на 2-3 дня. После ликвидации воспаления временная пломба убирается, каналы повторно обрабатываются антисептиками, вводят специальные пасты в пространство за верхушкой корня.

Каналы пломбируют временными пломбами, назначают физиотерапию на два месяца. Временную пломбу ставят на 2-6 месяцев, пациент посещает врача для профосмотра и контроля при помощи рентгена. После окончания физиотерапии каналы прочищаются, устанавливается постоянная пломба, восстанавливается коронка.

Современное лечение периодонтитов у детей

Периодонтит у детей необходимо лечить, чтобы по возможности сохранить молочный или постоянный зуб, выполнить профилактику поражения зачатков коренных зубов. Лечение позволяет сохранить прикус и равномерную нагрузку на зубы и избавление от хронической интоксикации.

Лечение молочного зуба от периодонтита возможно в начальной стадии. Если не лечить зуб, инфекция может поразить зачатки постоянных зубов. В большинстве случаев молочные зубы с периодонтитом удаляют.

Протокол лечения

Минздрав разработал протокол лечения периодонтита, главной целью которого является предупреждение прогрессирования процесса, сохранение формы зуба и зубочелюстной системы. Этапы протокола:

  • Во время лечения необходима местная анестезия.
  • Обеспечение доступа к полости зуба путем ее раскрытия.
  • Обеспечение прямого доступа к каналам корня.
  • Распломбирование канала зуба.
  • Установление рабочей длины каналов корней.
  • Механическая и лекарственная обработка каналов корней.
  • Установка временной или постоянной пломбы в корневых каналов.
  • Контроль при помощи рентгена.

Клиника в Одинцово предлагает лечение периодонтита всех форм. Современное оборудование, новейшие материалы и опытные сотрудники стоматологии помогут пациентам избавиться от боли и восстановить зуб.

симптомы, развитие болезни, диагностика, лечение, обострение

Обновлено 21 мая 2019 г.

Стоматологии, в которых возможно лечение периодонтита.

Содержание:

Гранулематозный периодонтит – это разновидность хронического апикального периодонтита, для которой характерно развитие в тканях периодонта новообразования – гранулемы. Иногда эта форма периодонтита со временем перетекает в более тяжелый хронический гранулирующий периодонтит.

Гранулематозный периодонтит

Клиническая картина и симптомы заболевания

Обычно гранулематозный периодонтит протекает без симптомов, никак не беспокоя пациента (это не относится к коротким периодам обострений, когда ощущения становятся похожи на симптомы острого периодонтита). Из-за этого заболевание обычно удается обнаружить только при тщательном рентгенологическом обследовании. Впрочем, иногда пациенты жалуются на небольшой дискомфорт в зубе во время приема пищи. Иногда зуб может изменять цвет, а в исключительных случаях из него выпадает пломба.

При осмотре врач может заметить, что в зубе наблюдается большая кариозная полость, в том числе и под коронкой или пломбой. Чаще всего эта полость сообщается с полостью зуба. Зондирование обычно не вызывает болевых ощущений. Возможен неприятный запах изо рта. Слизистая оболочка ротовой полости над верхушкой корня немного отекает, однако при прощупывании безболезненна.

Лимфатические узлы не изменяются, общего ухудшения самочувствия вне периодов обострений также не наблюдается.

Развитие гранулезного периодонтита

При гранулезном периодонтите у верхушки корня зуба появляется новообразование, которое с течением времени изменяет свою структуру.

  1. Гранулема – уплотнение периодонта с несколько разросшейся соединительной тканью. Появляется на начальном этапе воспалительного процесса. Так как токсическое воздействие на периодонт продолжается, новообразование развивается и постепенно превращается в полостное образование из соединительной ткани, заполненное фиброзными элементами, грануляциями, микробами и клетками, которые отвечают за иммунитет. Размеры гранулемы – до 5 миллиметров в диаметре;
  2. Кистогранулема – следующая стадия развития гранулемы. Для нее характерна внутренняя слизистая выстилка образования, торможение развития остеобластов, активизация клеток, разрушающих костную ткань, а также формирование кислой среды в очаге воспаления. Размеры кистогранулемы обычно составляет от 5 миллиметров до сантиметра в диаметре;
  3. Киста – последняя стадия развития гранулематозного периодонтита. Представляет собой полностью сформировавшуюся полость с соединительной капсулой, выстланную слизистой тканью. Внутренний слой кисты продуцирует секрет, который создает избыточное давление на костную ткань и активно разрушает ее. Постепенно в жидкости внутри кисты оседают кристаллы холестерина.

Диагностика гранулематозного периодонтита

Чаще всего гранулематозный периодонтит диагностируется при помощи рентгена. На рентгенограмме в районе верхушки корня хорошо виден очаг разрушения костной ткани с четкими, ровными контурами, как правило, округлой формы.

Следует отличать гранулематозный периодонтит от других разновидностей хронического периодонтита, а также от среднего кариеса, корневой кисты и хронического пульпита:

  • При фиброзном периодонтите можно увидеть расширение периодонтальной щели;
  • Для гранулирующего периодонтита характерно разрушение кости с неровными и нечеткими контурами;
  • Хронический пульпит и средний кариес никак не видны на рентгенограмме;
  • Корневая киста характеризуется расхождением зубов, выбуханием костной стенки над кистой, а очаг разрушения костной ткани имеет большие размеры.

Лечение гранулематозного периодонтита

Лечение этой формы периодонтита – дело долгое и достаточно трудное. Оно зависит от размера гранулемы, ее строение, возраста пациента, проходимости корневых каналов и ряда других факторов. Если размеры гранулемы небольшие, каналы хорошо проходимы, а в структуре образования практически нет компонентов эпителиальной ткани, то консервативного лечения может оказаться достаточно.

Консервативное

Данный метод лечения начинается с расширения корневых каналов и их антисептической обработки. Затем через корневые каналы за верхушку корня вводят препарат, уничтожающий патогенную микрофлору, разрушающий соединительную оболочку гранулемы и ускоряющий регенерацию костной ткани. Обычно используется препарат Метапекс.

Хирургическое

Если гранулема достаточно большая, либо даже перешла в стадию кистогранулемы, то единственным способом вылечить гранулематозный периодонтит становится хирургическое вмешательство – резекция верхушки корня зуба. Если при этом нужно провести резекцию более чем трети корня, то обычно удаляют весь зуб целиком.

Этапы резекции верхушки корня зуба:

  • Анестезия;
  • Разрез над корнем зуба;
  • Откидывание десневого лоскута;
  • Выпиливание специальным инструментом костного окна;
  • Спиливание выступающей части корня;
  • Если необходимо, то пломбирование дистальной части корневого канала;
  • Выскабливание костной полости и заполнение ее специальным материалом;
  • Наложение швов на слизистую оболочку полости рта.

Обострение хронического гранулематозного периодонтита

Одна из главных опасностей хронического гранулематозного периодонтита – это высокая вероятность возникновения обострения заболевания. Для обострения характерна ощутимая боль, которая значительно усиливается при малейшем прикосновении к зубу.

В области десны очень быстро нарастает отек, нередко образуется свищ. При этом сильно увеличиваются и начинают болеть лимфатические узлы, расположенные ближе всего к больному зубу. Чтобы понять, что это именно обострение гранулематозного периодонтита, необходимо прибегнуть к рентгенодиагностике.

Если пациент решает сохранить зуба, то первым делом снимаются острые симптомы за счет антибактериальной терапии и обеспечения оттока гнойного экссудата. В дальнейшем лечение проводится по стандартной для гранулематозного периодонтита схеме.

Читайте больше полезной информации в Вконтакте

Полезная статья?

Сохрани, чтобы не потерять!

Отказ от ответственности: Этот материал не предназначен для обеспечения диагностики, лечения или медицинских советов. Информация предоставлена только в информационных целях. Пожалуйста, проконсультируйтесь с врачом о любых медицинских и связанных со здоровьем диагнозах и методах лечения. Данная информация не должна рассматриваться в качестве замены консультации с врачом.

Читайте также

Нужна стоматология? Стоматологии Москвы

Выберите метроАвиамоторнаяАвтозаводскаяАкадемическаяАлександровский садАлексеевскаяАлтуфьевоАнниноАрбатскаяАэропортБабушкинскаяБагратионовскаяБаррикаднаяБауманскаяБеговаяБелорусскаяБеляевоБибиревоБиблиотека имени ЛенинаНовоясеневскаяБоровицкаяБотанический СадБратиславскаяБульвар Дмитрия ДонскогоВаршавскаяВДНХВладыкиноВодный СтадионВойковскаяВолгоградский ПроспектВолжскаяВолоколамскаяВоробьевы ГорыВыхиноДеловой ЦентрДинамоДмитровскаяДобрынинскаяДомодедовскаяДубровкаИзмайловскаяПартизанскаяКалужскаяКантемировскаяКаховскаяКаширскаяКиевскаяКитай-ГородКожуховскаяКоломенскаяКомсомольскаяКоньковоКрасногвардейскаяКраснопресненскаяКрасносельскаяКрасные ВоротаКрестьянская ЗаставаКропоткинскаяКрылатскоеКузнецкий МостКузьминкиКунцевскаяКурскаяКутузовскаяЛенинский ПроспектЛубянкаЛюблиноМарксистскаяМарьина РощаМарьиноМаяковскаяМедведковоМенделеевскаяМитиноМолодежнаяНагатинскаяНагорнаяНахимовский ПроспектНовогиреевоНовокузнецкаяНовопеределкиноНовослободскаяНовые ЧеремушкиОктябрьскаяОктябрьское ПолеОреховоОтрадноеОхотный РядПавелецкаяПарк КультурыПарк ПобедыПервомайскаяПеровоПетровско-РазумовскаяПечатникиПионерскаяПланернаяПлощадь ИльичаПлощадь РеволюцииПолежаевскаяПолянкаПражскаяПреображенская ПлощадьПролетарскаяПроспект ВернадскогоПроспект МираПрофсоюзнаяПушкинскаяРечной ВокзалРижскаяРимскаяРязанский ПроспектСавеловскаяСвибловоСевастопольскаяСеменовскаяСерпуховскаяСмоленскаяСоколСокольникиСпортивнаяСретенский БульварСтрогиноСтуденческаяСухаревскаяСходненскаяТаганскаяТверскаяТеатральнаяТекстильщикиТеплый СтанТимирязевскаяТретьяковскаяТрубнаяТульскаяТургеневскаяТушинскаяУлица 1905 ГодаУлица Академика ЯнгеляБульвар РокоссовскогоУниверситетФилевский ПаркФилиФрунзенскаяЦарицыноЦветной БульварЧеркизовскаяЧертановскаяЧеховскаяЧистые ПрудыЧкаловскаяШаболовскаяШоссе ЭнтузиастовЩелковскаяЩукинскаяЭлектрозаводскаяЮго-ЗападнаяЮжнаяЯсеневоБунинская АллеяУлица ГорчаковаБульвар Адмирала УшаковаУлица СкобелевскаяУлица СтарокачаловскаяМякининоУлица Сергея ЭйзенштейнаДостоевскаяМеждународнаяВыставочнаяСлавянский бульварБорисовоШипиловскаяЗябликовоПятницкое шоссеАлма-АтинскаяНовокосиноЖулебиноЛермонтовский ПроспектТропаревоБитцевский паркРумянцевоСаларьевоТехнопаркСпартакКотельникиБутырскаяОкружнаяВерхние ЛихоборыФонвизинскаяЛомоносовский проспектРаменкиВыставочный центрУлица Академика КоролёваУлица МилашенковаСелигерскаяМичуринский проспектОзёрнаяГоворовоСолнцевоБоровское шоссеРассказовкаПанфиловскаяЗоргеХовриноМинскаяШелепихаХорошёвскаяЦСКАПетровский паркЛесопарковаяТелецентрАндроновкаНижегородскаяНовохохловскаяУгрешскаяЗИЛВерхние КотлыПлощадь ГагаринаЛужникиХорошёвоСтрешневоКоптевоБалтийскаяРостокиноБелокаменнаяЛокомотивИзмайловоСоколиная гораКрымскаяБеломорскаяКосиноНекрасовкаЛухмановскаяУлица ДмитриевскогоЛихоборыКоммунаркаЛефортовоСтахановскаяОкскаяЮго-ВосточнаяФилатов ЛугПрокшиноОльховаяМнёвникиНародное Ополчение

Посмотрите стоматологии Москвы с услугой «Удаление кисты и гранулемы зуба»

Возле метроАвиамоторнаяАвтозаводскаяАкадемическаяАлександровский садАлексеевскаяАлтуфьевоАнниноАрбатскаяАэропортБабушкинскаяБагратионовскаяБаррикаднаяБауманскаяБеговаяБелорусскаяБеляевоБибиревоБиблиотека имени ЛенинаНовоясеневскаяБоровицкаяБотанический СадБратиславскаяБульвар Дмитрия ДонскогоВаршавскаяВДНХВладыкиноВодный СтадионВойковскаяВолгоградский ПроспектВолжскаяВолоколамскаяВоробьевы ГорыВыхиноДеловой ЦентрДинамоДмитровскаяДобрынинскаяДомодедовскаяДубровкаИзмайловскаяПартизанскаяКалужскаяКантемировскаяКаховскаяКаширскаяКиевскаяКитай-ГородКожуховскаяКоломенскаяКомсомольскаяКоньковоКрасногвардейскаяКраснопресненскаяКрасносельскаяКрасные ВоротаКрестьянская ЗаставаКропоткинскаяКрылатскоеКузнецкий МостКузьминкиКунцевскаяКурскаяКутузовскаяЛенинский ПроспектЛубянкаЛюблиноМарксистскаяМарьина РощаМарьиноМаяковскаяМедведковоМенделеевскаяМитиноМолодежнаяНагатинскаяНагорнаяНахимовский ПроспектНовогиреевоНовокузнецкаяНовопеределкиноНовослободскаяНовые ЧеремушкиОктябрьскаяОктябрьское ПолеОреховоОтрадноеОхотный РядПавелецкаяПарк КультурыПарк ПобедыПервомайскаяПеровоПетровско-РазумовскаяПечатникиПионерскаяПланернаяПлощадь ИльичаПлощадь РеволюцииПолежаевскаяПолянкаПражскаяПреображенская ПлощадьПролетарскаяПроспект ВернадскогоПроспект МираПрофсоюзнаяПушкинскаяРечной ВокзалРижскаяРимскаяРязанский ПроспектСавеловскаяСвибловоСевастопольскаяСеменовскаяСерпуховскаяСмоленскаяСоколСокольникиСпортивнаяСретенский БульварСтрогиноСтуденческаяСухаревскаяСходненскаяТаганскаяТверскаяТеатральнаяТекстильщикиТеплый СтанТимирязевскаяТретьяковскаяТрубнаяТульскаяТургеневскаяТушинскаяУлица 1905 ГодаУлица Академика ЯнгеляБульвар РокоссовскогоУниверситетФилевский ПаркФилиФрунзенскаяЦарицыноЦветной БульварЧеркизовскаяЧертановскаяЧеховскаяЧистые ПрудыЧкаловскаяШаболовскаяШоссе ЭнтузиастовЩелковскаяЩукинскаяЭлектрозаводскаяЮго-ЗападнаяЮжнаяЯсеневоБунинская АллеяУлица ГорчаковаБульвар Адмирала УшаковаУлица СкобелевскаяУлица СтарокачаловскаяМякининоУлица Сергея ЭйзенштейнаДостоевскаяМеждународнаяВыставочнаяСлавянский бульварБорисовоШипиловскаяЗябликовоПятницкое шоссеАлма-АтинскаяНовокосиноЖулебиноЛермонтовский ПроспектТропаревоБитцевский паркРумянцевоСаларьевоТехнопаркСпартакКотельникиБутырскаяОкружнаяВерхние ЛихоборыФонвизинскаяЛомоносовский проспектРаменкиВыставочный центрУлица Академика КоролёваУлица МилашенковаСелигерскаяМичуринский проспектОзёрнаяГоворовоСолнцевоБоровское шоссеРассказовкаПанфиловскаяЗоргеХовриноМинскаяШелепихаХорошёвскаяЦСКАПетровский паркЛесопарковаяТелецентрАндроновкаНижегородскаяНовохохловскаяУгрешскаяЗИЛВерхние КотлыПлощадь ГагаринаЛужникиХорошёвоСтрешневоКоптевоБалтийскаяРостокиноБелокаменнаяЛокомотивИзмайловоСоколиная гораКрымскаяБеломорскаяКосиноНекрасовкаЛухмановскаяУлица ДмитриевскогоЛихоборыКоммунаркаЛефортовоСтахановскаяОкскаяЮго-ВосточнаяФилатов ЛугПрокшиноОльховаяМнёвникиНародное Ополчение

цены в стоматологической клинике Доктор Мартин в Москве

Что за заболевание периодонтит

Развитие периодонтита происходит преимущественно вследствие отсутствия лечения при прогрессирующем кариеса. Однако, спровоцировать патологию так же может полученная травма зуба или врачебная ошибка, допущенная при лечении зуба.

Периодонтит возникает по причине воспаления или проникновения инфекции внутрь корневых каналов. Для периодонтита характерно локализованное поражение тканей периодонта, который удерживает зуб на его месте. При отсутствии своевременного терапевтического воздействия, в тканях начинает протекать гнойный процесс, переходящий в кистозную, фиброзную или другие формы. Достаточно часто периодонтит возникает на фоне пульпита при распространении воспаления на близко расположенные ткани.

Устранить патологию за одно посещение стоматолога удается не всегда. При периодонтите лечение может быть проведено консервативным или хирургическим путем, в зависимости от степени его распространения тканей.

При поражении зуба периодонтитом на лечение цена будет зависеть от объема работы специалиста, на что влияет степень прогрессивности патологического процесса.

Симптомы

Периодонтит опасен тем, что определить его симптоматику не всегда возможно, поскольку возникает он в большинстве случаев на фоне других стоматологических заболеваний. Признаки патологии возникают преимущественно в период обострения.

Симптоматика:

  • появление резких болевых ощущений в пораженном зубе при нажатии на него;

  • расшатывание в лунке зуба;

  • формирование гнойного свища;

  • отек и изменение цвета десны.

Каждая форма периодонтита имеет характерную симптоматику. Основной признак острого периодонтита — флюс, характеризующейся увеличением щеки из-за скопления в тканях большого количества гноя. Если вовремя не предпринимаются меры отек распространяется на все лицо, а гной может перейти в другие зоны. Не исключается гангренозное поражение кости челюсти и сепсис.

Многие пациенты затягивают визит к стоматологу даже при выраженных признаках глубокого кариеса, пульпита или воспалительного процесса в результате травмы. Несмотря на то, что на лечение периодонтита зуба цена достаточно высокая, промедление может быть опасным, а последующее лечение еще более дорогостоящим. Однако, если обращаться к стоматологу своевременно, то можно избежать затрат на лечение периодонтита благодаря принятым мерам по предупреждению его развития.

Классификация

Большую роль на характер развития периодонтита играет причина патологии и состояние иммунной системы пациента. При крепком иммунитете прогрессивность заболевания значительно замедляется.

Выделяют несколько форм периодонтита:

  • острая — отличается сильной болью и образованием флюса/свища;

  • хроническая — симптомы слабо выраженные, болевые ощущения периодические, отек отсутствует;

  • гранулезный — формирование свища с выделением из него серозной или гнойной жидкостью;

  • гранулематозный — инфекционно-воспалительный процесс, поражающий не только зуб, но и десна, а также кость челюсти, проявляется мучительной болью;

  • фиброзный — характеризуется образованием кистозной капсулы под зубным корнем с гнойным содержимым, боль постоянная и сильная.

Острая и хроническая формы могут сочетаться с другими видами заболевания. Наиболее сложными считаются гнойные формы, поэтому на такое лечение периодонтита стоимость будет выше.

Лечение

В зависимости от клинической картины, специалист определяет метод лечения и схему дальнейшего восстановления зуба, если это является возможным. При периодонтите применяют аппаратные методы диагностики, поскольку сведений полученных при визуальном осмотре недостаточно. Процесс воспаления протекает внутри зуба.

Клиника Доктор Мартин проводит лечение периодонтита в Москве терапевтическим и хирургическим путем. Каждый метод имеет свои особенности и различные техники устранения патологического процесса.

Стандартная схема лечения периодонтита

  1. Очищение зуба от пораженных тканей. Доступ к зоне воспаления специалист получает через каналы корней при хирургическом лечении, либо через десну при проведении консервативной терапии.

  2. Блокирование воспаления и устранение его причин. Обработка корневых каналов путем очищения и использования медикаментозных средств группы антибиотиков, кальциевых или антисептиков.

  3. Пломбирование. Очищенные корневые каналы требуют тщательной защиты от повторного проникновения инфекции, поэтому специалист выполняет пломбирование с помощью не только специального материала, но и дополнительных средств (штифт, гуттаперча).

  4. Реставрация. В зависимости от того, насколько пострадала зубная коронка, пациенту может быть установлена пломба или выполнено протезирование.

Специалисты рекомендуют на период лечения придерживаться всех советов лечащего врача, а также проходить дополнительное физиотерапевтическое лечение. Грамотный и ответственный подход к лечению периодонтита поможет ускорить выздоровление и предупредить рецидив заболевания.

Современная стоматология позволяет достигнуть успехов в устранении воспаления периодонта любых единиц. Но наиболее сложными и не всегда поддающимися остаются жевательные единицы и зубы мудрости. На лечение периодонтита 3 канального зуба цена может быть высокой, что объясняется труднодоступностью единиц и сложностью работы с их корневыми каналами.

Лечение периодонтита является сложной процедурой, требующей от стоматолога высокой квалификации и значительного опыта. Стоматологическая клиника Доктор Мартин оказывает услуги по профессиональному лечению периодонтита по доступной цене в Москве.

Дантист — Лечениепериодонтита

Периодонтитвоспаление корневой оболочки зуба, вызванное попаданием инфекции. Название «периодонтит» было образовано от термина «периодонт», которым обозначается целая система соединительных тканей, обеспечивающий фиксацию зуба в челюсти.

В процессе заболевания периодонт постепенно разрушается, и в верхней части корня развивается периапикальный абсцесс. В профессиональной терминологии используется название апикальный периодонтит, образованное от термина «аpex» (апекс), которым определяется верхняя часть корня. Для этой стадии характерно образование гнойного мешочка. Расположение очага воспаления объясняется тем, что попадание инфекции происходит через корневые каналы.

Симптоматика периодонтита

Периодонтит проявляет себя в зависимости от того, в какой форме он протекает. Различают хронический, острый периодонтит. Для хронической формы характерны периоды обострений.

Как проявляется острый периодонтит

Тупая боль, усиливающая при нажатии на больной зуб, — именно так определяет свое состояние большинство пациентов, обращающихся к врачу с периодонтитом. На этапе перехода воспаления в гнойную стадию тупая боль, характерная для воспаления, сменяется дергающей и очень резкой, безболевые периоды сокращаются. Причинный зуб становится подвижным, в его проекции может появиться флюс десны.

В целом ухудшается состояние всего организма. Пациент чувствует себя слабее, у него пропадает сон, повышается температура. Отказ от еды по причине сильной боли, отечность в области причинного зуба — это явления, которые характерны для острой формы заболевания.

Как проявляется хронический периодонтит

Зачастую подобная форма заболевания ничем не беспокоит пациента. Лишь иногда нажатие или постукивание по больному зубу вызывает реакцию. Однако в этом случае боль не резкая. При этом в области причинного зуба может появиться свищ, из которого будет сочиться гной.Хроническая форма заболевания опасна тем, что может привести к потере зуба, так как пациенты считают ненужным обращение к врачу до появления более серьезных симптомов и, как правило, доводят до развития необратимых последствий, таких как появление кисты на верхней части корня.

Как проявляется обострение хронического периодонтита

При продолжительном хроническом процессе часто случаются обострения, и тогда все проявления болезни аналогичны острой форме. Как только на десне образуется свищ, из канала которого начнет выделяться гной, процесс будет затухать и вновь примет хроническую форму.

Определение периодонтита по рентгеновскому снимку

Посмотрев на рентгеновский снимок пациента, у которого диагностируется периодонтит, можно увидеть, что в области верхней части корня присутствует сильное затемнение, это так называемый гнойный мешочек, характерный для периодонтального абсцесса.

Почему развивается периодонтит?

По характеру возникновения различают неинфекционные и инфекционные периодонтиты. Первые становятся последствием травм, во втором случае воспаление корневой оболочки происходит из-за попадания в нее инфекции.

 

Периодонтит: современные методы лечения

Для того чтобы определить, какой метод лечения подойдет, необходимо выявить форму воспаления.

Периодонтит характеризуется воспалением верхнего корня зуба и имеет две основные формы:

Острая форма заболевания протекает болезненно с ярко выраженной припухлостью десны, острой болью, отечностью. В этом случае следы разрушения костной ткани верхушки корня отсутствуют.

Хроническая форма проходит бессимптомно (человек не ощущает боли) либо с незначительными симптомами в виде легких болезненных ощущений при надкусывании. Вследствие понижения иммунитета хронический периодонтит может обостриться, тогда симптоматика будет схожей с острой формой.

Хронический периодонтит и его лечение

Курс лечения хронической формы периодонтита подбирается в зависимости от степени хронического воспаления. Всего существует три формы течения хронического заболевания периодонтитом: гранулирующая, фиброзная и гранулематозная (с возникновением кист и гранулем у верхнего корня зуба).

Наиболее простым и быстрым является лечение фиброзного периодонтита, которое проводится всего за несколько посещений. Эта форма заболевания не предполагает значительного воспаления верхушки корня зуба, поэтому пломбировка канала на втором приеме у стоматолога полностью решает проблему.

Две другие формы хронического периодонтита предполагают двух-трехнедельный курс лечения. Поскольку гранулематозный и гранулезный периодонтит — наиболее часто встречающиеся формы заболевания.

 

Курс лечения: первое посещение стоматолога

 

  • Диагностика с рентгеновским снимком.
  • Анестезия.
  • Устранение всех пораженных кариесом участков и обеспечение доступа к корневым каналам зубов..
  • Измеряется длина корневых каналов.
  • Обработка корневых каналов предполагает их расширение для качественной пломбировки и обработку антисептиком путем струйного промывания каналов.
  • Далее проводится завершающая процедура — закладывание в корневой канал сильнодействующего антисептика, который находится внутри до следующего посещения врача.
  • Наложение пломбы временного характера.
  • Для лечения периодонтита могут быть назначены антибиотики широкого спектра в сочетании с антигистаминными, нестероидными и противовоспалительными средствами. Выбор препаратов осуществляется в зависимости от выявленных симптомов. 

Второе посещение

Повторный приход к врачу, как правило, назначается через 2-3 дня.

Если пациент после первого этапа курса лечения перестал жаловаться на боли, а припухлость и отечность исчезли, далее следуют следующие мероприятия:

  1. Устранение временной пломбы и антисептика из корневых каналов.
  2. Повторная промывка каналов гидрохлоридом натрия или хлоргексидином.
  3. Временное пломбирование каналов с использование восстанавливающих костную ткань в очаге воспаления препаратов. Временная пломбировка каналов делается на срок от двух до трех месяцев.

Третье посещение

  1. Рентгеновский снимок для контрольной диагностики.
  2. Удаление пломбировочного материала из каналов с их преследующей обработкой антисептиком.
  3. Пломбировка каналов гуттаперчей (постоянная). До верхушки корня зуба корневые каналы пломбируются гуттаперчей.
  4. Заключительный рентгеновский снимок делается для того, чтобы понять, что каждый из каналов был запломбирован до верхушки корня зуба. 

Кисты и гранулемы: лечение

Хронический гранулематозный периодонтит характеризуется появление кист и гранулем. Эти образования отличаются друг от друга только размерами. Гранулема — гнойный мешочек у верхушки корня зуба, размер которого составляет меньше 0,5 см в диаметре. Кистгранулема — образование имеет 1 см в диаметре. Киста — свыше 1-го см в диаметре.

При лечении кист используются не только консервативно-терапевтические процедуры, но и хирургическое вмешательство. В некоторых случаях курс лечения может быть комбинированным.

 

 

Острый периодонтит и его лечение

Как говорилось выше, острый периодонтит сопровождается сильной болью, воспалением и отечностью десны. Чаще всего эта форма заболевания возникает на фоне невылеченного или некачественно устраненного пульпита.

Курс лечения: посещение первое

  1. Рентгеновский снимок.
  2. Введение анестетика.
  3. Высверливание пораженных кариесом участков.
  4. Удаление некротической пульпы.
  5. Измерение длины каналов.
  6. Прочистка и обработка корневых каналов (этот процесс описан выше). Временные пломбы в процессе лечения не накладываются, потому что зуб должен оставаться открытым. Чтобы каналы не забивались во время приема пищи, рассверленную полость необходимо закрывать ватным тампоном. При образовании флюса требуется осуществление разреза десны.
  7. Для лечения гнойного воспаления также назначаются антибиотики, антигистаминные и нестероидные средства.

Курс лечения: второе посещение

Второй визит к врачу необходим через два-три дня. На этот раз проводится повторная промывка каналов антисептиком, после которой в каналы закладывает лекарственный препарат длительного воздействия. Завершающим этапом становится наложение временной пломбы.

Курс лечения: третье посещение

Если боли отсутствуют, нет гнойных образований, то корневые каналы снова промываются и пломбируются гуттаперчей. После этого снова делается контрольный снимок.

Если необходимо поставить коронку, то это всегда осуществляется на четвертом посещении, поскольку никогда нельзя ставить коронки сразу после пломбировки корневых каналов.

Цифровая объемная томография в дифференциальной диагностике хронического одонтогенного полипозного риносинусита

А. А. Зубарева
д. м. н., ассистент кафедры оториноларингологии СПбГМУ им. академика И. П. Павлова

М. А. Шавгулидзе
к. м. н., ассистент кафедры оториноларингологии СПбГМУ им. академика И. П. Павлова

М. А. Чибисова
д. м. н., профессор, заведующая кафедрой рентгенологии в стоматологии СпбИНСТОМ

А. Л. Дударев
д. м. н., профессор кафедры рентгенологии в стоматологии СПбИНСТОМ

Введение

Диагностика и лечение хронического полипозного риносинусита остается сложной клинической проблемой. Полипозные риносинуситы являются одними из наиболее распространенных хронических заболеваний полости носа и околоносовых пазух и составляют до 32 % в общей структуре лор-заболеваемости. В общей популяции распространенность полипов полости носа составляет 4 %. По данным Пискунова Г. З., Пискунова С. З. (2006), в 68 % случаев верхушки корней зубов располагаются в непосредственной близости к дну верхнечелюстной пазухи. Высокий процент случаев интимной анатомической связи зубов с верхнечелюстной пазухой обусловливает довольно частый переход воспалительного процесса с корней зубов на слизистую оболочку верхнечелюстной пазухи. Остается неразработанной лучевая симптоматика (качественный и количественный денситометрический анализ) одонтогенной формы хронического полипозного риносинусита [2].

Цель исследования

Уточнить и систематизировать клинико-лучевую симптоматику хронического одонтогенного полипозного риносинусита как одной из клинических форм гиперпластических дегенераций параназальных синусов.

Материалы и методы исследования

За период 2007—2012 годов на кафедре оториноларингологии с клиникой обследовано и проведено лечение 95 больных (мужчин — 44, женщин — 51; в возрастном интервале от 24 до 58 лет) с хроническим одонтогенным полипозным риносинуситом. При этом наряду с клинико-инструментальными исследованиями (эндоскопия полости носа с применением 0° и 30° эндоскопов, исследование функции носового дыхания, стоматологическое обследование, клинический анализ крови, гистологическое исследование операционного материала) всем 95 пациентам была выполнена трехмерная компьютерная томография околоносовых пазух (3ДКТ ОНП) на обьемном томографе Galileos с программным обеспечением Galaxis («Сирона», Германия) с цифровой обработкой изображения и локальной денситометрией.

Результаты

В корреляции с клинико-инструментальными данными, результатами цифровой объемной томографии разработаны дифференциально-диагностические критерии, позволившие выделить форму хронического полипозного риносинусита одонтогенного генеза.

У всех пациентов определялся очаг воспалительной одонтогенной природы (периодонтит — 24, остеомиелит верхней челюсти — 7, одонтогенные кисты — 15, ретинированные зубы — 3, травма дна верхнечелюстной пазухи — 17, инородные тела — 29, среди которых у 13 пациентов в качестве инородного тела обнаружен пломбировочный материал, у 12 — фрагменты корней зубов в просвете верхнечелюстных синусов, у 3 — фрагменты эндодонтических инструментов, у 1 — титановый имплантат).

В результате данного стоматологического процесса преимущественным образом страдали верхнечелюстные синусы, на втором месте — клетки решетчатого лабиринта и значительно реже — лобный синус и клиновидная пазуха. Анамнестически у всех пациентов отмечено неадекватное эндодонтическое лечение премоляров и моляров верхней челюсти, проникновение одонтогенного инородного тела в просвет пазухи, экстракция зубов с повреждением замыкательной пластинки дна верхнечелюстной пазухи.

Данные причины возникновения патологического процесса могут быть как на фоне аллергического статуса больного, так и без него, что актуально отметить исходя из понимания развития полипозного процесса в синусах в целом. Исходно патологический полипозный процесс имел односторонний характер, ограниченный в проекции дна верхнечелюстной пазухи. При отсутствии аллергического дополнительного компонента заболевание вначале протекало малосимптомно. При наличии аллергического компонента к симптомам одонтогенного верхнечелюстного синусита присоединялась клиника сезонного или круглогодичного ринита.

Жалобы больных заключались в дискомфорте и/или болевом синдроме в проекции заинтересованного зуба либо в постоперационной области после экстракции зуба и альвеолярной бухты пазухи, отмечены болевые ощущения в проекции заинтересованного синуса, субфебрилитет, головные боли, выделения из полости носа с кариозным запахом, затруднение носового дыхания, снижение остроты обоняния 1—2-й степени.

Данные лор-обследования позволили выявить болезненность при пальпации и перкуссии в проекции пораженной пазухи, изменения эндоскопической картины полости носа на стороне поражения: застойная гиперемия и отек слизистой оболочки полости носа — 100 % (95), увеличение в размерах носовых раковин — 86,3 % (82), слизисто-гнойное отделяемое в среднем носовом ходе — 44,2 % (42), полипозные изменения в области средних носовых раковин — 48,4 % (46) и зоны хоан — 11,6 %
(11), которые характеризовались формированием солитарных полипов.

Обострение хронического процесса в синусе происходило на фоне переохлаждения, снижения иммунорезистентности, ОРВИ и носило характер острого гнойного верхнечелюстного синусита с наличием ороантрального сообщения (ОАС) — открытая форма в 17,9 % случаев (17 пациентов).

В клиническом анализе крови у данной категории пациентов было отмечено увеличение СОЭ, увеличение уровня эозинофилов определялось степенью выраженности аллергической настроенности организма. Увеличение числа лейкоцитов со сдвигом лейкоцитарной формулы влево наблюдалось при обострении хронического процесса в синусе.

По данным 3ДКТ ОНП — Sirona выявлено снижение пневматизации верхнечелюстного синуса в виде: ограниченного пристеночного в 28,4 % случаев (27 человек), кистоподобного в 15,8 % случаев (15), полиповидного утолщения слизистой оболочки дна верхнечелюстной пазухи в 38,9 % случаев (37) на уровне верхушек корней пораженных зубов. Субтотальное, тотальное затемнения верхнечелюстной пазухи на стороне одонтогенного очага инфекции — 36,8 % (35), наличие горизонтального уровня экссудата — 61 % (58), дефекта замыкательной костной пластинки дна верхнечелюстной пазухи — 27,4 % (26), наличие ороантрального сообщения — 17,9 % (17), частичного затемнения передних и средних клеток решетчатого лабиринта — 13,7 % (13). (Рис. 1, а — в) Больной Д., 56 лет; д — з: хронический одонтогенный полипозный правосторонний гаймороэтмоидит, полипоз полости носа справа, инородное тело правой верхнечелюстной пазухи (пломбировочный материал). Цифровая объемная томография: в режиме трехмерной «рентгенографии» — тотальное затемнение правой верхнечелюстной пазухи (полипозные разрастания), в средней трети синуса определяется рентгенопозитивное инородное тело (локальная денситометрия 3060), частично затемнены передние и средние клетки решетчатого лабиринта; в режиме «панорамная зонография». (Рис. 1г.) Хронический гранулезный периодонтит 1.4, 1.5 зубов, нарушение целостности замыкательной пластинки дна правой верхнечелюстной пазухи в области 1.5 зуба.)

Рис. 1а. Цифровая объемная томография: в режиме трехмерной «рентгенографии»

 

Рис. 1б. Цифровая объемная томография: в режиме трехмерной «рентгенографии»

 

Рис. 1в. Цифровая объемная томография: в режиме трехмерной «рентгенографии»

 

Рис. 1г. Хронический гранулезный периодонтит 1.4, 1.5 зубов, нарушение целостности

Результаты гистологического исследования операционного материала — отечные полипы, фиброзно-отечные полипы с лейкоцитарной (нейтрофильной) инфильтрацией. В ряде гистологических исследований отмечено на фоне полипозной дегенерации синуса наличие грибкового тела, представленного чаще грибами рода Aspergillus spp, реже Candida spp, Penicillium spp и Alternaria spp.

Оценивая частоту рецидивов хронического полипозного процесса в синусах одонтогенного генеза, можно отметить, что частота рецидива зависит от степени адекватности и своевременности лечения одонтогенного очага инфекционно-воспалительного процесса.

Заключение

Комплексное клинико-лучевое обследование 95 больных с хроническим одонтогенным полипозным риносинуситом позволило выделить данную форму в самостоятельную нозологическую единицу и подтвердить наличие полипозного процесса не только в верхнечелюстных синусах, но и в других околоносовых пазухах, а также в полости носа.

Доказана высокая эффективность трехмерной компьютерной томографии с локальной денситометрией в диагностике различных клинических форм хронического полипозного риносинусита и оценке эффективности его консервативного и хирургического лечения.

Литература
  1. Пискунов Г. З., Пискунов С. З. Клиническая ринология. Руководство для врачей. 2-е издание, исправленное и дополненное. — М.: МИА, 2006. — 548 с.
  2. Чибисова М. А., Зубарева А. А. Цифровая объемная томография (3D GALILEOS/GALAXIS, «SIRONA») — стандарт качества диагностики и лечения в стоматологии, челюстно-лицевой хирургии и оториноларингологии. — СПб.: СПбИНСТОМ, 2010. — 128 с.

Хронический ларингит — как распознать и успешно вылечить заболевание?

Цветной бульвар

Москва, Самотечная, 5

круглосуточно

Преображенская площадь

Москва, Б. Черкизовская, 5

Ежедневно

c 09:00 до 21:00

Бульвар Дмитрия Донского

Москва, Грина, 28 корпус 1

Ежедневно

c 09:00 до 21:00

Мичуринский проспект

Москва, Большая Очаковская, 3

Ежедневно

c 09:00 до 21:00

Capnocytophaga granulosa и Capnocytophaga haemolytica: новые виды в поддесневом налете

Задний план: В полости рта обитает одна из самых разнообразных микрофлор ​​в организме человека. Знание этой микрофлоры и, в частности, микрофлоры пародонта имеет решающее значение для понимания взаимодействия бактерий с хозяином, которое приводит к развитию инфекционно-воспалительных заболеваний пародонта.Виды Capnocytophaga считаются предполагаемыми пародонтальными патогенами. На сегодняшний день только 3 представителя этого рода (C. gingivalis, C. ochracea и C. sputigena) были выделены из поддесневого налета.

Цель: В этом сообщении сообщается о выделении двух недавно выделенных штаммов, а именно C. granulosa и C. haemolytica, из поддесневого налета, взятого у взрослых пациентов с пародонтитом.

Материал и методы: Поддесневой налет был собран у 29 пациентов с хроническим пародонтитом взрослых. Образцы бляшек инокулировали на требовательный анаэробный агар и инкубировали в анаэробных условиях в течение 5 дней. Обычная идентификация клинических изолятов проводилась с помощью ПЦР-ПДРФ анализа 16S рРНК с использованием Cfo I в качестве фермента рестрикции и подтверждалась секвенированием гена 16S рРНК.

Результаты: 16 из 29 пациентов (55%) дали положительный результат либо на C. granulosa, либо на C. haemolytica. Всего из поддесневого налета было культивировано 70 изолятов (63 C. granulosa и 7 C. haemolytica). 15 (51%) пациентов дали положительный результат на C. granulosa, и 3 (10%) пациента дали положительный результат на C. haemolytica.

Заключение: Это первый отчет, в котором рассказывается о присутствии C.granulosa и C. haemolytica в поддесневом налете. Необходимы дальнейшие исследования, чтобы установить относительные пропорции этих видов в поддесневой области в норме и при заболевании.

Микробиом полости рта в пародонтальном здоровье

Неправильная классификация образцов

Взвешенный анализ сходства Жаккара (), а также анализ PCA (), как и ожидалось, позволил отличить компактное скопление образцов AP от более крупного и рассеянного скопления образцов здоровых лица.Аналогичная тенденция наблюдалась ранее (Kirst et al., 2015) и объяснялась микробной сукцессией в дебюте пародонтоза. Кирст и др. выявили, что неглубокие участки взятия проб у пациентов с хроническим пародонтитом демонстрировали наибольшее видовое богатство и разнообразие (содержащие как таксоны, связанные со здоровьем, так и таксоны, типичные для пародонтита), в то время как глубокие пародонтальные карманы содержали лишь ограниченное количество видов, которые были обнаружены. , причем достаточно однородным среди испытуемых.Здоровые участки также были менее разнообразны, но индивидуумы различались больше, что могло быть следствием неоднозначного диагноза некоторых здоровых пробандов, у которых ранние стадии дисбактериоза могут протекать без каких-либо клинических признаков. В наше исследование, чтобы охарактеризовать пародонтально здоровый микробиом полости рта, мы включили группу HY, специально отобранную из молодых людей с тщательной гигиеной полости рта, т.е. с очень низкой вероятностью дисбиоза, что в противном случае могло бы исказить результаты. В отличие от первой, мы также включили группу пациентов с тяжелым пародонтитом (АП), которые обычно характеризуются однозначным диагнозом, глубокими пародонтальными карманами и быстрым прогрессированием заболевания.Тем не менее, даже с таким хорошо различимым набором особей, все же несколько выборок HY группируются близко к группе AP. Из группы ГО, в которой уже можно было ожидать предшествующего развитию пародонтита дисбиоза, четыре образца кластеризуются непосредственно в группе ОП (), а несколько образцов ОП, напротив, группируются вместе со здоровыми. Анализ PCA показывает еще большее совпадение ().

Подобное несоответствие между микробным профилем и клиническим статусом в некотором проценте образцов уже было показано ранее (Kirst et al., 2015; Парк и др., 2015 г.; Шафрански и др., 2015). Анализ PCA или PCoA часто выявлял компактное скопление образцов от пациентов с пародонтитом, большее и более рассеянное скопление образцов от пародонтологически здоровых людей, а также несколько выбросов или образцов, отнесенных к неправильной группе. В нашем исследовании ~18% образцов не принадлежали ни к одному из выявленных АТ или здоровому кластеру, но образовывали связь между ними (). Мы предполагаем, что эти образцы представляют переходное состояние. Клинически здоровые субъекты (HY и HO) из переходной области и четыре образца HO, сгруппированные с AP, таким образом, вероятно, будут иметь дисбиоз и, следовательно, будут иметь более высокий риск развития пародонтита, в то время как образцы AP из переходной области могут соответствовать более легкое течение болезни или пациенты с лучшим прогнозом.Тем не менее, мы должны учитывать также возможность измененной функциональной активности ОМ, как обсуждалось, например, Дюран-Пинедо (Duran-Pinedo and Frias-Lopez, 2015) и/или необычный иммунный ответ хозяина, более толерогенный в случае здоровых субъектов. с нездоровым СО и более провоспалительным у субъектов ОП с транзиторным СО (Sultan et al., 2018).

Четыре образца AP из нашего набора были классифицированы неправильно: один выброс (AP30) и три образца, локализованные в кластере, связанном со здоровьем, в (AP26, AP35 и AP44).Выброс AP30 показал очень высокую относительную численность (44%) CT98 Propionibacterium propionicum ( Дополнительная таблица 5 ; список АП). Высокое относительное содержание P. propionicum некоторыми авторами коррелирует с апикальным периодонтитом и эндодонтальными поражениями, однако это открытие не было подтверждено другими, и нет единого мнения относительно роли P. propionicum в патогенезе пародонтоза (Dioguardi et al., 2020). Три оставшихся образца представляли собой типичные СО, ассоциированные со здоровьем, и, как и AP30, не содержали ни одного из упомянутых выше «истинных периопатогенов». Некоторые авторы объясняют это явление другими причинами образования пародонтальных карманов, помимо пародонтита, например, анатомическими аномалиями уздечки губ (Monnet-Corti et al., 2018). Однако это не относится к нашим пациентам. У двух из них (АР26 и АР35) локализованная форма заболевания с 5 пораженными зубами, а у двух других (АР30 и АР44) генерализованная форма АР с наличием даже 25 и 20 пародонтальных карманов соответственно.Такая степень заболевания не может быть вызвана аномалиями уздечек губ. Таким образом, тяжелый периодонтит у этих людей, вероятно, возник из-за необычного взаимодействия между их ОМ и иммунной системой. Важно отметить, что таксономическая характеристика ОМ, основанная на секвенировании 16S рДНК, дает ценную, но все еще неполную картину экосистемы полости рта. Бактерии являются основными и очень важными членами ОВ, но грибы и виды архей также могут играть свою роль, и, кроме того, метаболическая активность отдельных видов может различаться в зависимости от взаимодействия с окружающей средой (Sultan et al., 2018). Следовательно, для выявления причины воспаления и развития пародонтита в этих нестандартных случаях потребуются более сложные диагностические инструменты, включая протеомные или метаболомные исследования.

Наиболее распространенные и распространенные таксоны в кластере, связанном со здоровьем и пародонтитом, согласуются с ранее опубликованными данными (Griffen et al., 2012; Abusleme et al., 2013; Pérez-Chaparro et al., 2014; Kirst et al., 2015). Несколько удивительным может быть очень низкая распространенность Aggregatibacter actinomycetemcomitans в нашей группе AP (таксон был идентифицирован только в трех образцах; 0.11% в АР24, 3,6% в АР12 и 15,8% в АР37), так как долгое время этот таксон обычно ассоциировался с пародонтитом, преимущественно с его тяжелой (агрессивной, по прежней классификации) формой (Schacher et al. , 2007; Хендерсон и др., 2010). Тем не менее, Хендерсон и соавт. также документально подтверждают, что доля населения, в котором содержится A. actinomycetemcomitans , резко различается в зависимости от географических районов и различных клинических проявлений пародонтита.Например, в Европе 23% голландских субъектов содержали A. actinomycetemcomitans по сравнению только с 3% испанских субъектов, с другой стороны, в Азии он был обнаружен у 78% здоровых вьетнамцев. Общего исследования распространенности A. actinomycetemcomitans у пациентов с пародонтитом в Чешской Республике не проводилось, однако, учитывая опубликованную географическую и этническую изменчивость, низкая распространенность A. actinomycetemcomitans в нашей когорте не ставит наш диагноз. рассматриваемого тяжелого (агрессивного) пародонтита.

ОВ особей переходного ареала характеризуется пониженной относительной численностью типичных таксонов, связанных со здоровьем, и повышенной относительной численностью анаэробных или факультативно-анаэробных таксонов (роды Fusobacterium, Porphyromonas или Capnocytophaga ), которые предположительно действуют как более поздние колонизаторы, способствуя дальнейшей колонизации «настоящими периопатогенами» красного комплекса (Socransky et al., 1998) и/или видами связанных с периодонтитом родов, таких как Treponema , Fretibacterium или Filifactor .Роль F. nucleatum в формировании поддесневой биопленки, вероятно, заключается в образовании мостиков между микроорганизмами, позволяющих прикреплять специфические для периодонтита бактерии (Kolenbrander et al., 2006; Kolenbrander et al., 2010). Присутствие F. nucleatum само по себе не вызывает заболевания пародонта, однако его повышенное обилие, несомненно, связано с заболеванием (He et al., 2012; Yang et al., 2014). Вторыми по численности бактериями в образцах из транзитной зоны являются CT8 Porphyromonas pasteri / catoniae (13.05%). Род Porphyromonas весьма уникален, поскольку некоторые вид Porphyromonas часто связаны со здоровьем полости рта (De Lillo et al., 2004; Camelo-Castillo et al., 2015; Takeshita et al., 2016; Yasunaga et al., 2017; Rusthen et al., 2019), в то время как другой представитель рода, Porphyromonas gingivalis , принадлежит к красному комплексу и однозначно связан с заболеванием. Наши результаты показывают, что представители CT8 P. pasteri и/или P.catoniae не формируют основной микробиом полости рта, а скорее указывают на переходное состояние с повышенным риском развития пародонтита. Род Capnocytophaga представлен в пробах из переходного состояния тремя видами: HMT 775 Capnocytophaga sputigena (2,63%), HMT329 Capnocytophaga leadbetteri (1,91%) и CT51 Capnocytophaga granulosa (1,91% 2). Это не очень многочисленный род, но его относительная численность в здоровых образцах значительно ниже, а при пародонтите он почти исчезает.Этот вывод хорошо согласуется с Pudakalkatti et al., которые описали вид Capnocytophaga как наиболее распространенные при гингивите (преходящее состояние с клинической точки зрения), а не при здоровом пародонте и пародонтите (Pudakalkatti et al., 2016). ). Они также утверждали, что Capnocytophaga потенциально может вызывать заболевание пародонта, но поскольку он менее конкурентоспособен в пародонтальном кармане, он обычно обрастает другими быстрорастущими бактериями. Роль Capnocytophaga также подтверждается экспериментами, опубликованными Okuda et al., которые доказали, что образование биопленки F. nucleatum усиливается растворимым фактором, продуцируемым клетками Capnocytophaga (Okuda et al., 2012). Другим таксоном, демонстрирующим самую высокую среднюю относительную численность и распространенность в транзиторной группе, является HMT311 Prevotella oris (1,20%), таксон, который, как ранее было доказано, объединяется с P. gingivalis и, таким образом, способствует колонизации десны . P. gingivalis на ранней стадии формирования биопленки (Sato and Nakazawa, 2014).Наконец, CT53 Tannerella sp. и HMT623 Campylobacter gracilis также были связаны с транзиторным состоянием. CT53 состоит из трех видов Tannerella , два из которых (HMT808 и HMT916) связаны с пародонтитом (Griffen et al., 2012; Beall et al., 2018), а HMT286 имеет отношение к здоровью полости рта (Leys et al. ., 2002). Область 16S рДНК, секвенированная в этом исследовании, не позволяет нам дифференцировать эти три вида, тем самым препятствуя осмысленному обсуждению их роли в развитии периодонтита.Средняя относительная распространенность HMT623 C. gracilis при заболеваниях пародонта и пародонтите сравнима и почти незначительна (<0,4%). В транзиторном состоянии он увеличился выше 1%, а распространенность была значительно выше (89% по сравнению с 43% и 64% в обоих пограничных штатах). Это открытие хорошо согласуется с предыдущей ассоциацией C. gracilis с неглубокими пародонтальными карманами, а не с более глубокими (Macuch and Tanner, 2000). Как микроаэрофильный организм, которому требуется среда с пониженной концентрацией кислорода (Guillermo et al., 1996), C. gracilis вместе с упомянутыми выше преходящими таксонами, ассоциированными с состоянием, могут быть еще одним подтверждающим индикатором инициирующего дисбиоза и повышенного риска развития пародонтита.

Изменения ОВ при старении

Белибасакис в своем недавнем обзоре обобщил знания об изменениях состава ОВ в связи со старением (Belibasakis, 2018), показав, что относительно простое ОВ в раннем детстве обогащается за счет приобретения новых таксонов в раннем возрасте. в период предшествующего импринтинга и позднее во время прорезывания молочных зубов.В течение взрослой жизни состав ОМ здоровых людей имеет тенденцию сохранять динамически сбалансированное состояние, называемое «микробным гомеостазом», включающее как естественную, так и повторную колонизацию полости рта новыми таксонами без заметного влияния на здоровье полости рта. Однако старение приводит к изменениям в иммунной системе хозяина, что, в свою очередь, изменяет толерантность к микробным обитателям полости рта и, следовательно, может вызывать дисбиоз и заболевания пародонта. Помимо растущей распространенности Actinomyces spp.в образцах от пожилых людей (несмотря на увеличение распространенности обнаженных корневых поверхностей в более старшем возрасте) не было отмечено существенных различий в составе ОВ в отношении кариеса или периодонтита между более молодыми и пожилыми здоровыми популяциями (Belibasakis, 2018).

Наш анализ, тем не менее, выявил несколько оральных таксонов, явно более распространенных и/или преобладающих в группе НО по сравнению с HY и наоборот, хотя разница в возрасте между обеими группами здоровых людей невелика (40-53 года при среднем 46 в группе HO vs. 19-39 лет, в среднем 23 года в HY). В целом, эти изменения можно резюмировать как связанное со старением постепенное уменьшение относительной численности таксонов, связанных со здоровьем, и увеличение таксонов, связанных с переходным состоянием. Наиболее примечательным является увеличение относительной численности видов CT3 F. nucleatum и Capnocytophaga и снижение относительной численности связанных со здоровьем видов Neisseria , Lautropia mirabilis , Prevotella histicola 2 (2embillo Grummorella 2 или ).Весьма специфичен случай CT8 P. pasteri / P. catoniae , средняя относительная численность которого с возрастом явно снижается (5,19 % у HY против 1,59 % у HO), но по типичный таксон для транзиторного состояния (2,15% в норме против 13,05% в транзиторном состоянии и только 0,37% при пародонтите). При рассмотрении только группы HY среднее относительное содержание CT8 в 19 транзиентных образцах составляет 15,9%, а в 72 оставшихся образцах — всего 2.35%. Точно так же в 6 образцах AP в переходной области среднее относительное содержание CT8 составляет 6,49%, в то время как в остальных 39 образцах AP оно составляет всего 0,37%. Представители CT8 P. pasteri / P. catoniae принадлежат к так называемой группе микроорганизмов POTG ( Porphyromonas , кроме gingivalis ) (Guilloux et al., 2020). Как правило, они колонизируют легкие и нижние дыхательные пути, а при некоторых заболеваниях, таких как кистозный фиброз, относительное количество P. catoniae может служить маркером для различения различных состояний здоровья (Cuthbertson et al., 2016). Таксоны POTG и в основном CT8 также часто выявлялись в полости рта, но, в отличие от P. gingivalis , они были связаны со здоровьем пародонта (Abusleme et al., 2013; Camelo-Castillo et al., 2015). Наши данные, однако, показывают, что повышенное относительное содержание СТ8 является скорее маркером переходного состояния, приводящего к пародонтиту (см. небольшую панель на рис. 1).

Повышенное среднее относительное количество таксонов, связанных с пародонтитом, в образцах HO хорошо соответствует часто сообщаемым более высоким показателям распространенности и тяжести заболеваний пародонта среди пожилых людей (Eke et al., 2012; Баэлум и Лопес, 2013 г.; Эке и др., 2015 г.; Ферес и др., 2016; Эберсоул и др., 2018). Как правило, старение сопряжено с такими факторами риска, как повышенная предрасположенность к другим системным заболеваниям, которые могут косвенно влиять на состояние пародонта (Persson, 2018), чрезмерный иммунный ответ хозяина на микробиоту полости рта (Ebersole et al., 2016), приводящий к старению. — связанная с этим умеренная потеря пародонтального прикрепления и альвеолярной кости (Burt, 1994) или более частое обнажение корневых поверхностей, способствующее избыточному росту оппортунистических патогенов.Было описано, что возраст является важным фактором, влияющим на динамику состава органического вещества (Belibasakis, 2018; Deshpande et al., 2018), однако причинно-следственная связь до сих пор остается неясной (Feres et al., 2016; LaMonte et al., 2019).

Стоматотипы в пародонтальном здоровье и микробной сукцессии

Паттерны состава ОВ, представляющие различные глобальные оптимальные равновесия микробного сообщества, недавно стали называть «стоматотипами» (Willis et al., 2018; Willis and Gabaldón, 2020).Все еще идентифицированные стоматотипы у систематически здоровых людей (De Filippis et al., 2014; Takeshita et al., 2016; Zaura et al., 2017; Willis et al., 2018) суммированы вместе со стоматотипами, выявленными в этом исследовании.

Таблица 3

Стоматотипы ОМ в пародонтальном здоровье.

168
Авторы Автор Возраст субъектов Количество субъектов Страна Промездия Тип образца Medical / Стоматологический экзамен Обозначение стоматотипа Определение Takes Метод
Текущее исследование 19-53 108 Чехия Зубной налет из десневой борозды Все пробанды, осмотренные пародонтологом: отсутствие пародонтального кармана > 3 мм Кластер 1 CT2 Streptococcus mitis/oralis
HMT718, CT23 и CT24 Haemophilus spp.
Illumina MiSeq
Кластер 2 CT6 Veillonella rogosae/dispar
CT25, CT27 Нейссерия
CT37 Gemella morbillorum
Кластер 3а CT43 Streptococcus gordonii
CT48 Ротиа воздушная
Кластер 3b HMT14, CT27 Neisseria spp.
CT33 Класс Bacilli
Уиллис и др. (2018) 13-15 1319 Пиренейский полуостров и Балеарские острова Жидкость для полоскания рта Без стоматологических и медицинских критериев исключения стоматотип 1 Нейссерия, Haemophilus Illumina MiSeq
стоматотип 2 Вейонелла, Превотелла , Стрептококк ,
Заура и соавт.(2017) 18-32 268 Нидерланды Нестимулированная слюна Системно здоровые лица, забор образцов во время планового осмотра у стоматолога. MIC3 Veillonella atypica/Veillonella dispar и Prevotella Illumina MiSeq
MIC2 Группа Streptococcus mitis Streptococcus gordonii
Ротия слизистая
МИК1.3 Neisseria flavescens Neisseria subflava и Haemophilus parainfluenzae
MIC1.2 Streptococcus salivarius, Streptococcus vestibularis, Streptococcus australis Streptococcus parasanguinis и Granulicatella adiacens
MIC1.1 Превотелла сп. HMT313 и Paraprevotella/Alloprevotella sp. HMT308
Де Филиппис и соавт.(2014) 18–55 161 Италия Нестимулированная слюна Системно здоровые лица. Нет информации о стоматологическом осмотре. группа I Neisseria, Fusobacterium, Porphyromonas 454
кластер II Превотелла
группа III Streptococcus, Gemella, Porphyromonas
Такешита и соавт.(2016) > 40 2343 Япония Стимулированная слюна Стоматологическое и медицинское обследование проведено 68,2% лиц тип I Veillonella, Prevotella, Actinomyces, Rothia, S. salivarius и S. parasanguinis Ион PGM
тип II Streptococcus mitis, Haemophilus, Porphyromonas, Gemella и Neisseiria

Сопоставимость данных несколько ограничена непоследовательной или даже отсутствующей характеристикой субъектов и исследованием состояния пародонта перед взятием проб.Кроме того, все остальные образцы ОВ были выделены из слюны, которая по микробному составу отличается от поддесневого налета. Определенная изменчивость в таксономическом составе выявленных стоматотипов также может быть обусловлена ​​демографическими различиями, такими как источник питьевой воды (Willis et al., 2018) или преобладающий рацион (Lassalle et al., 2018). Тем не менее, отдельные кластеры ОВ на основе Streptococcus и Veillonella обычно наблюдались и в других исследованиях (Takeshita et al., 2016; Заура и др., 2017).

Принимая во внимание современные знания о микробной сукцессии в полости рта в начале заболевания пародонта и характеристики идентифицированных родов, мы можем предположить, что только Streptococcus на основе Кластера 1 представляет здоровый ОМ, в то время как Кластер 2 может уже представлять исходное дисбиотическое состояние. Стоматотип кластера 1, а также выбросы кластера 3a и кластера 3b характеризуются преобладающим присутствием ранних колонизаторов, таких как Streptococcus , Neisseria (Mahajan et al., 2013), Haemophilus (Kolenbrander et al., 1993) и Rothia (Sulyanto et al., 2019), участвующие в начальном образовании бляшек. Образцы стоматотипа кластера 2 также содержат ранних колонизаторов родов Neisseria и Gemella (Mahajan et al., 2013), но, что особенно примечательно, они исключительно богаты видом Veillonella . Род Veillonella также считается пионером-колонизатором (Sulyanto et al., 2019), но, среди прочего, это единственный широко распространенный анаэробный таксон, которому обычно приписывают здоровье пародонта. Виды Veillonella обладают двумя характеристиками, которые делают их одними из наиболее важных промежуточных таксонов в оральном биопленочном сообществе. Они могут использовать лактат, вырабатываемый главным образом стрептококками, в качестве основного источника энергии и углерода, и они продуцируют каталазу, защищающую F. nucleatum и другие более требовательные анаэробы от перекиси водорода (Rogosa and Bishop, 1964). Veillonella также производит питательные вещества для выживания и роста пародонтальных патогенов (Zhou et al., 2017). Поэтому мы предполагаем, что стоматотип Кластера 2 по-прежнему представляет собой клинически здоровых лиц, но уже с повышенным риском развития пародонтита. Дальнейшая стадия начала и прогрессирования заболевания может быть представлена ​​Кластером 4 (переходное состояние) с повышенным относительным обилием анаэробных СТ3 F. nucleatum и СТ8 Porphyromonas pasteri/catoniae , но все еще нет или незначительное количество истинных периопатогенов и чаще всего без клинических признаков заболевания. F. nucleatum образует коагрегационный мостик между ранними аэробными колонизаторами и другими бактериями, включая анаэробных представителей красного комплекса ( P. gingivalis , T. forsythia и T. denticola ) (Bradshaw et al., 1998). ; Махаджан и др., 2013). Эта способность F. nucleatum коагрегировать с широким спектром партнерских штаммов весьма необычна (Коленбрандер и др., 2002; Коленбрандер и др., 2006). Было показано, что фузобактерии играют роль в защите от атмосферного кислорода и перекиси водорода в биопленке полости рта и даже поддерживают рост анаэробов, таких как Porphyromonas gingivalis , в аэрируемых условиях (Diaz et al., 2002). Присутствие F. nucleatum в большем количестве, таким образом, позволит бактериям, связанным с периодонтитом, разрастаться первыми колонизаторами.

Тем не менее, не только таксономический состав ОВ, но и общая метаболическая активность в полости рта, включая реакцию хозяина на продукцию микробов, являются решающими факторами, отличающими здоровье полости рта от дисбактериоза, приводящего к любому типу орального патогенеза. В большинстве (~90%) проб таксономический состав ОВ хорошо соответствует состоянию здоровья и может служить экспресс-диагностическим инструментом, однако все же встречаются особи с атипичным таксономическим составом ОВ, атипичной метаболической активностью типичных СО или необычная иммунная реакция на обычное СО — во всех этих случаях оценка протеома и/или метаболома может дать более точную картину.

Деметилаза мРНК m6A FTO в клетках гранулезы замедляет ФОС-зависимое старение яичников. С информированного согласия пациентов образцы GC после экстракорпорального оплодотворения (ЭКО) или интрацитоплазматической инъекции сперматозоида (ИКСИ) (ЭКО-ИКСИ) были собраны у пациентов после контролируемой гиперстимуляции яичников в центре репродуктивной медицины больницы Чанчжэн, связанной с Военно-морским флотом. Медицинский университет, в то время как подготовка образцов GC в лаборатории следовала нашей процедуре, описанной ранее [58].Из-за метода сбора образцов большинство клеток в образцах GC от пациентов на самом деле представляют собой кумулюсные клетки. Критерии приемлемости и исключения случаев старения яичников были основаны на Болонских критериях плохой реакции яичников, опубликованных Европейским обществом репродукции человека и эмбриологии (ESHRE) в 2011 г., со ссылкой на клинические рекомендации POI, опубликованные ESHRE в 2016 г., и на несколько точек зрения. по определению старения яичников. Более двух репродуктологов определяли, были ли пациенты включены в исследование в соответствии с этими критериями (дополнительная таблица 2).Основные клинические эндокринные параметры и антропометрические параметры включенных субъектов представлены в дополнительной таблице 3.

Клеточные культуры

Линии клеток гранулезы яичников человека KGN и COV434 с идентификацией STR (короткий тандемный повтор) культивировали в DMEM (HyClone, Logan , Юта, США), содержащую 10% фетальной телячьей сыворотки (FBS) (Gibco, Детройт, Мичиган, США) и 100 МЕ/мл пенициллина-стрептомицина во влажной атмосфере 5% CO2 и 95% воздуха при 37 °C. Сайты STR двух типов клеток показаны в дополнительной таблице 4.

Количественное определение РНК m6A

Этот эксперимент был проведен с использованием набора для анализа метилирования РНК m6A (Colorimetric; Abcam, Кембридж, США). Тотальную РНК, экстрагированную с помощью RNAiso Plus (TAKARA, Пекин, Китай), обрабатывали ДНКазой I (Promega) и затем определяли с помощью спектрофотометра NanoDrop 2000. Образцы разбавляли до необходимой концентрации водой, не содержащей РНКаз. Все остальные этапы выполняли в соответствии с инструкциями набора, и m6A количественно определяли, измеряя поглощение при длине волны 450 нм для каждой лунки с помощью многофункционального ридера для микропланшетов и рассчитывая на основе стандартной кривой.

Последовательность РНК

Тотальную РНК экстрагировали с помощью RNAiso Plus (TAKARA, Пекин, Китай) из стабильных клеток shFTO COV434 и контролей, которую использовали для удаления рРНК с помощью наборов для удаления рРНК Ribo-Zero (Illumina, San Diego, Калифорния, США) в соответствии с инструкциями производителя. Библиотеки РНК конструировали с использованием РНК, обедненных рРНК, с набором для подготовки библиотеки полных РНК TruSeq Stranded Total RNA Library Prep Kit (Illumina, Сан-Диего, Калифорния, США) в соответствии с инструкциями производителя. Библиотеки контролировали на качество и количественно определяли с помощью системы BioAnalyzer 2100 (Agilent Technologies, Inc., США). Десять пикометрических библиотек были денатурированы в виде одноцепочечных молекул ДНК, захвачены проточными ячейками Illumina, амплифицированы in situ в виде кластеров и, наконец, секвенированы в течение 150 циклов на секвенаторе Illumina HiSeq в соответствии с инструкциями производителя. Подготовка библиотеки и высокопроизводительное секвенирование были предоставлены CloudSeq Biotech (Шанхай, Китай).

MeRIP-seq

Подготовка последовательности РНК m6A была такой же, как и для последовательности РНК. Для последующей процедуры иммунопреципитацию m6A РНК проводили с помощью набора GenSeqTM m6A RNA IP Kit (GenSeq Inc., Китай), следуя инструкциям производителя. Как исходный образец без иммунопреципитации, так и образцы m6A IP использовали для создания библиотеки секвенирования РНК с помощью библиотеки направленной РНК NEBNext ® Ultra II.

Выделение РНК и полимеразная цепная реакция в реальном времени (RT-PCR)

Тотальную РНК из GC экстрагировали с помощью RNAiso Plus (TAKARA, Пекин, Китай) и подвергали обратной транскрипции в кДНК с использованием High-Capacity RNA-to-cDNA Kit (TAKARA, Пекин, Китай) со случайными гексамерными праймерами, а систему ABI StepOne Plus использовали для проведения ОТ-ПЦР для измерения образования дуплексной ДНК с помощью SYBR Premix Ex Taq II (TAKARA, Пекин, Китай).Последовательности используемых праймеров перечислены в дополнительной таблице 5, и результаты были нормализованы по уровням GAPDH.

Вестерн-блот-анализ

Клетки лизировали в охлаждаемом льдом лизирующем буфере для радиоиммунопреципитации (RIPA) (Beyotime, Шанхай, Китай) с коктейлем ингибиторов протеазы/фосфатазы (Epizyme, Шанхай, Китай). Равные количества и объемы белка разделяли электрофорезом в 12,5% SDS-полиакриламидном геле и переносили на поливинилиденфторидные мембраны (Millipore, США).Мембраны инкубировали в течение ночи при 4 °C с разбавленными первичными антителами (дополнительная таблица 6) после блокирования 5% обезжиренным молоком в течение 1 часа, а затем инкубировали с конъюгированным с IRdye 700 козьим анти-кроличьим IgG и/или с IRdye 800-конъюгированным козьим анти-кроличьим IgG. -мышиный IgG. Инфракрасный сканер Odyssey (Li-COR Biosciences, Небраска, США) использовали для обнаружения пятен, которые были нормализованы по уровням β-актина.

Дот-блоттинг РНК m6A

Для проведения дот-блоттинга m6A указанное количество тотальной РНК денатурировали при 65 °C в течение 5 мин с последующим охлаждением на льду.Пять микролитров РНК (800 нг) дважды разбавляли и наносили на мембрану Amersham Hybond-N+ (GE Healthcare, Piscataway, NJ) для каждой точки. После трехкратного УФ-сшивания мембрану промывали PBS, а затем блокировали буфером для блокирования нуклеиновых кислот (Thermo Fisher, США) в течение 1 ч, затем инкубировали с антителом против m6A (1:1000; Synaptic Systems, Геттинген, Германия). ) в течение ночи при 4 ° C или окрашивали 0,02% метиленовым синим (MB) в PBS в течение 3 часов и промывали водой без рибонуклеазы в течение 1 часа в качестве эталона для нормализации.После инкубации с HRP-конъюгированным вторичным антителом против кроличьего IgG (Invitrogen) окрашивание визуализировали с использованием набора субстратов пероксидазы DAB (Yeason, Китай).

Получение лентивирусов и трансдукция генов

Лентивирусы были получены путем котрансфекции отдельных кшРНК для подавления экспрессии FTO с использованием лентивирусных частиц кшРНК (OBIO Technology, Шанхай, Китай), в то время как неэффективные скремблированные последовательности кшРНК (отрицательный контроль, shNC) использовались в качестве контрольной группы , с упаковочными векторами (pLV-U6-[shRNA/shNC] CMV-EGFP-T2A-пуромицин).Для сверхэкспрессии FTO в клетках лентивирусы получали с векторами (pLV-CMV-[FTO] PGK-EGFP-T2A-пуромицин). Клетки инфицировали в соответствии с инструкциями производителя, а затем инкубировали с 2 мкг/мл пуромицина в течение 72 часов для отбора стабильных трансфектантов. Последовательности миРНК FOS и неэффективной скремблированной миРНК (отрицательный контроль, siNC) были приобретены у GenePharma Co., Ltd. (Шанхай, Китай) и трансфецированы в клетки липофектамином 3000 (Invitrogen) в соответствии с инструкциями производителя.Эффективность подавления FTO или FOS в клетках была подтверждена ОТ-ПЦР и вестерн-блоттингом.

Иммунофлуоресцентное окрашивание и микроскопия

Клетки культивировали на круглых покровных стеклах диаметром 13 мм (NEST, Китай). После необходимой обработки клетки промывали холодным PBS, фиксировали в течение 20 мин в 4% параформальдегиде, пермеабилизировали и блокировали еще на 30 мин буфером для блокировки окрашивания Immunol (Beyotime, Китай). Затем клетки инкубировали в течение ночи при 4 °C с антителом против FTO (1:200; Abcam, Кембридж, США), антителом против c-FOS (1:200; Affinity Biosciences, Китай) или против γHA.X (1:200; Thermo Fisher Scientific) и инкубировали в течение 1 ч с козьим антикроличим IgG H&L (Abcam, Кембридж, США) или козьим антимышиным IgG H&L (Abcam, Кембридж, США). После пятикратной промывки в PBS и окрашивания DAPI (Beyotime, Китай) в течение 5 мин покровные стекла анализировали с помощью лазерного конфокального сканирующего микроскопа LSM 510 Zeiss (Carl Zeiss, Оберкохен, Германия).

Окрашивание β-галактозидазой и микроскопия

После промывки и фиксации клетки окрашивали с помощью набора для окрашивания β-галактозидазой (Beyotime, Китай; код №c0602) согласно инструкции. Для герметизации использовали антифлуоресцентный агент (Beyotime, Китай; код p0126), а для фотографирования использовали лазерный конфокальный сканирующий микроскоп LSM 510 Zeiss (Carl Zeiss, Оберкохен, Германия).

Анализ стабильности РНК на время жизни мРНК

Анализ стабильности РНК проводили, как описано ранее [28] со следующими модификациями. Клетки со стабильно экспрессируемой кшРНК против FTO или shNC высевали в чашки диаметром 60 мм для получения ~ 70% слияния и обрабатывали 5 мкг / мл актиномицина D через 24 часа позже для ингибирования синтеза РНК.Затем клетки собирали в указанные моменты времени для выделения общей РНК и анализировали с помощью ОТ-ПЦР, как описано выше. Время полужизни и скорость оборота мРНК ФОС оценивали в соответствии с ранее опубликованной статьей [59] и нашим предварительным экспериментом.

Репортерные анализы люциферазы и анализы мутагенеза

Три предполагаемых сайта узнавания m6A 3’UTR FOS были идентифицированы в 3’UTR с помощью SRAMP [29]. Мутагенез от А до С был произведен с помощью набора для направленного мутагенеза QuikChange II (200, 523, Agilent, США) в соответствии с инструкциями производителя.3’UTR FOS амплифицировали с помощью ПЦР, который клонировали в сайты рестрикции MCS pmiGLO (E133A, Promega, США) для получения синтетических плазмид WT или MUT, а затем плазмиды трансфицировали в клетки с использованием липофектамина 3000 (Invitrogen ). Через 48 ч активность люциферазы измеряли с помощью набора для анализа гена репортера Dual-Luciferase (Yeason, Китай) с многофункциональным устройством для считывания микропланшетов. Значения активности люциферазы Renilla нормализовали относительно значений активности люциферазы светлячка, которые отражают эффективность экспрессии.

Статистический анализ

Для секвенирования РНК и MeRIP-seq

Вкратце, парные чтения были собраны с секвенатора Illumina HiSeq 4000, а качество контролировалось Q30. После обрезки 3′-адаптера и удаления некачественных считываний использовали программу cutadapt (v1.9.3). Во-первых, чистые чтения всех библиотек были сопоставлены с эталонным геномом (UCSC HG19) с помощью программного обеспечения Hisat2 (v2.0.4). Для последовательности РНК m6A метилированные сайты на РНК (пики) идентифицировали с помощью программного обеспечения MACS.Дифференциально метилированные сайты идентифицировали с помощью diffReps. Эти пики, идентифицированные обоими программными пакетами, которые перекрываются с экзонами мРНК, были определены и выбраны с помощью самодельных скриптов. Анализы обогащения GO и путей были выполнены для дифференциально экспрессируемых и дифференциально метилированных генов, кодирующих белок.

Другие анализы

Все статистические анализы в этом исследовании проводились с помощью GraphPad Prism 7.04, а количественный анализ изображений выполнялся с помощью ImageJ 1.52а. Для сравнения значимых различий между указанными группами использовали двусторонний критерий Стьюдента t , а для анализа корреляций — корреляционный анализ Пирсона. Значение p <0,05 считалось значимым.

(PDF) Идентификация видов Capnocytophaga из ротовой полости здоровых людей и больных хроническим пародонтитом с помощью фенотипических тестов

Idate, et al. Фенотипическая идентификация видов Capnocytophaga в норме и при патологии

174 Journal of Advanced Clinical & Research Insights ● Vol.5:6 ● ноябрь-декабрь 2018

Для идентификации и

дифференциации видов применялась батарея фенотипических тестов.

Материалы и методы

Настоящее исследование проводилось на кафедре микробиологии

Стоматологического колледжа Марата Мандал, Белагава,

Карнатака� Исследование было начато после получения одобрения

этического комитета учреждения� Всего из 150 взрослых

субъектов в возрасте от 20 до 55 лет, принадлежащих к

обоих полов, были включены после получения информированного согласия

от каждого человека� Они были разделены на три группы�

Из них 50 были внешне здоровыми (группа I),

50 с гингивитом (группа II) и 50 с пародонтитом

(группа III)�

глубина зондирования

≤3 мм, потери клинического прикрепления нет.Критерием включения

пациентов с гингивитом было генерализованное наличие клинических

признаков воспаления десен, глубина зондирования ≤3 мм и отсутствие

клинической потери прикрепления. признаки

воспаления десен, генерализованная глубина зондирования ≥5 мм и

генерализованная потеря клинического прикрепления ≥3 мм. Критериями исключения

для всех трех групп были пациенты с любым системным заболеванием,

курильщики, беременные или кормящие женщины, пришеечный или поддесневой кариес

кариес или реставрации, а также пародонтальная или антимикробная терапия

в течение 3 месяцев до взятия проб�

Из каждой индивидуальный поддесневой налет был собран

с помощью кюретки после удаления наддесневого налета� Материал

был немедленно перенесен в редуцированную транспортную жидкость

(RTF) и доставлен в лабораторию для обработки� Полученный RTF

был встряхнут для разрушения образцов зубного налета и высвобождения микроорганизмов

в бульоне� Затем их культивировали на кровяном агаре, среде Dentaid

и триптиказо-соевом агаре с бацитрацином и полимиксином

(TBBP), который является селективной средой для Capnocytophaga�

Планшеты были приготовлены в соответствии с рекомендациями авторов оригинала

�[9,10 ] Затем планшеты инкубировали в сосуде с 5–10%

CO2 в течение 72 ч� Затем планшеты извлекали из сосуда и исследовали на наличие признаков колоний, типичных для Capnocytophaga�

Характерная скользящая подвижность на кровяном агаре с или без

гемолиза и/или желто-оранжевых или бежевых тонких

колоний на селективных средах использовали для предварительной идентификации

вида Capnocytophaga.Окрашивание по Граму подозрительной колонии

было выполнено для обнаружения грамотрицательных

веретенообразных бацилл; одновременно также были проведены тесты на каталазу и оксидазу

[Рисунки 1-3]. Предварительно идентифицированные

колонии Capnocytophaga были дополнительно подвергнуты фенотипической идентификации

путем проведения биохимических тестов, включающих

ферментацию глюкозы, лактозы, сахарозы, мальтозы, маннозы,

фруктозы, амигдалина, целлобиозы, сорбит,

мелибиоза, инулин и рафиноза.Кроме того, были проведены тест восстановления нитратов

и гидролиз эскулина, мочевины, крахмала и желатина

� Для проведения биохимических реакций использовались процедуры, использованные более ранними исследователями

�[11,12]

Di Разрешение среди семи видов была проведена путем принятия

критериев, используемых Frandsen et al� [12], видами, исследуемыми

, включают CapnoCytophaga Ochraacea, CapnoCytophaga Granulosa,

CapnoCytophaga HaemoLytica, CapnoCytophaga Gingivitis,

CapnoCytophagaga, CapnoCytophaga Leadbetteri, и

род Capnocytophaga AHN 8471.

Результаты

Образцы поддесневого зубного налета от 150 человек с равным

распределением здоровых групп, пациентов с гингивитом и пародонтитом

были проанализированы культуральным методом для выявления присутствия различных

видов Capnocytophaga� Среди участников 65 (43� 3%)

были самцами и 85 (56,6%) были самками� Всего в 28 (18,67%)

образцах были обнаружены виды Capnocytophaga� Из семи видов можно было обнаружить только

пять и C.sputigena и C. haemolytica были

не обнаружены ни у одного из субъектов из всех трех групп [Таблица 1]�

Анализ данных показал, что распространенность

Capnocytophaga gingivalis, C. ochracea и C. granulosa была более

у здоровых людей, чем при гингивите и пародонтите� Они

также встречались гораздо чаще у всех испытуемых

, чем два других обнаруженных вида� Среди них межгрупповые

различия были значительными для С.ochracea и C. gingivalis

[Рисунок 4]� С другой стороны, C. leadbetteri и C.genospecies

AHN 8471 были обнаружены только у пациентов с гингивитом [Рисунок 4]�

При преобладании видов Capnocytophaga среди di Было изучено несколько

групп, можно было видеть, что эти микроорганизмы

присутствовали у 30% здоровых людей, в отличие от 14% пациентов

Таблица 1: Описательная статистика с частотами и средними значениями (n=150)

добровольцев исследования

Частота Частота(%)

Группа

Здоровые 50(33.33)

Гингивит 50 (33.33)

хронический периодонтит 50 (33.33)

гендер

мужчины 65 (43.33)

женский 85 (56.66)

Распространенность микроорганизмов

C.gengivalis 8 (5.33)

C.ochracea 10(6,66)

C.granulosa 7(4,66)

C.sputigena 0(0)

C.haemolytica 05 0900 C.геновиды(AHN8471) 1(0,66)

C.leadbetteri(AHN8855) 2(1,33)

C.gingivalis: Capnocytophaga gingivalis, C.OCHRACEA: CAPNOCYTOPHAGA

OCHRACEA, C.GRANULOSA: CapnoCytophaga Granulosa,

C.sputigena: CapnoCytophaga Sputigena, C.haemolytica: CapnoCytophaga

Haemolytica, C.genospecies: CapnoCytophaga Gonospecies,

C. leadbetteri:Capnocytophaga leadbetteri

МикроРНК-664a-3p ингибирует пролиферацию клеток гранулезы яичников при синдроме поликистозных яичников и способствует апоптозу путем нацеливания на BCL2A1-He

Введение

Синдром поликистозных яичников (СПКЯ) является с распространенностью 4–18% у женщин детородного возраста (1).СПКЯ характеризуется гиперандрогенемией, резистентностью к инсулину, редкой или ановуляторной овуляцией и поликистозными изменениями яичников. Он также сопровождается клиническими симптомами повышенного уровня андрогенов, такими как гирсутизм и акне (2). Предыдущие исследования показали, что СПКЯ связан с бесплодием. Кроме того, это повысит риск нарушения обмена веществ, будет способствовать возникновению и развитию сахарного диабета, ожирения, дислипидемии и сердечно-сосудистых заболеваний (3), что серьезно сказывается на физическом и психическом здоровье женщин.СПКЯ является первичным фолликулярным заболеванием. Этиология еще не ясна, и большая часть текущих исследований сосредоточена на генетике, окружающей среде, химиотерапевтических препаратах и ​​т. д. (4). В последние годы исследования показали, что существуют различия в экспрессии микроРНК между пациентами с СПКЯ и здоровыми женщинами, что позволяет предположить, что микроРНК могут играть важную роль в возникновении и развитии СПКЯ (4). Пролиферация и апоптоз клеток гранулезы являются основными причинами аномальной фолликулярной функции (5).Таким образом, изучение механизмов пролиферации и апоптоза гранулезных клеток яичников имеет решающее значение для клинической диагностики и лечения СПКЯ.

Микрорибонуклеиновые кислоты (миРНК) представляют собой небольшие некодирующие РНК, которые в основном участвуют в посттранскрипционной регуляции организмов. Они связываются с 3′-UTR целевой матричной РНК (мРНК) и негативно регулируют экспрессию генов на посттранскрипционном уровне, что в конечном итоге может привести к деградации клеточной функции или связанному с этим ингибированию трансляции генов (6).Исследования показали, что различные микроРНК участвуют в регуляции пролиферации и апоптоза гранулезных клеток яичников (7), а также играют важную регулирующую роль в репродукции яичников и эндокринных функциях. Аномальная экспрессия или дисфункция микроРНК яичников может повлиять на развитие фолликулов и атрезию, а также на синтез и метаболизм гормонов и в конечном итоге привести к возникновению и развитию заболеваний яичников, таких как СПКЯ (7). Микро (миР)-664a-3p расположена в интроне RAB3GAP2 и, как сообщается, аномально экспрессируется в различных злокачественных опухолях, включая рак шейки матки, остеосаркому, рак молочной железы и Т-клеточный острый лимфобластный лейкоз (8,9).Однако точная роль и механизм MiR-664a-3p в СПКЯ еще не выяснены.

Белок A1, родственный B-клеточной лимфоме 2 (BCL2A1), является членом семейства антиапоптотических белков BCL-2 и связан с устойчивостью к химиотерапии и таргетным препаратам (10). Исследования показали, что BCL2A1 играет роль специфических онкогенов, блокируя гибель клеток (11,12). Согласно соответствующей отечественной и зарубежной литературе, в редких исследованиях изучалась корреляция между СПКЯ и BCL2A1 или miR-664a-3p.Таким образом, это исследование направлено на изучение корреляции между СПКЯ, миР-664a-3p и BCL2A1, а также на наблюдение эффектов миР-664a-3p и BCL2A1 на клетки гранулезы яичников. Изучая механизм miR-664a-3p и BCL2A1 в возникновении и развитии СПКЯ, результаты этого исследования помогут предоставить новые идеи для клинической диагностики и таргетной терапии СПКЯ. Мы представляем следующую статью в соответствии с контрольным списком отчетности MDAR (доступен на http://dx.doi.org/10.21037/атм-21-1614).


Методы

Клинические образцы

В исследование были включены 150 субъектов (80 пациентов с СПКЯ и 70 контрольных пациентов), которые получили интрацитоплазматическую инъекцию сперматозоидов или экстракорпоральное оплодотворение в нашей больнице с апреля 2018 года по апрель 2020 года. СПКЯ диагностировали в соответствии с пересмотренным Роттердамским консенсусом, а женщин с нормальной менструацией и функцией яичников использовали в качестве контрольной группы (13). Конкретная клиническая и эндокринная информация о СПКЯ и контрольных пациентах представлена ​​в Таблице 1 .У каждого участника брали ткани и хранили при температуре -80°C для последующего исследования. Все процедуры, проведенные в этом исследовании с участием людей, соответствовали Хельсинкской декларации (пересмотренной в 2013 г.). Исследование было одобрено Комитетом по этике Второй дочерней больницы Университета Чжэнчжоу (№: 2017663), и у всех пациентов было получено информированное согласие.

Культивирование клеток Клетки

IOSE80 (Shanghai Fuheng Cell Center, Шанхай, Китай) культивировали в модифицированной среде Игла Дульбекко (DMEM; Gibco, США).Клетки гранулезоклеточной опухоли яичников человека (клетки KGN) (Shanghai Fuheng Biotechnology Co., Ltd., Китай) культивировали в среде DMEM/F-12 (Gibco, США) с добавлением 10% эмбриональной телячьей сыворотки (Gibco, США) и 1% пенициллин-стрептомицин (Gibco, США) и инкубировали в инкубаторе 5% CO 2 при 37 °С. При пассировании клетки сначала обрабатывали 0,25% трипсином (содержащим этилендиаминтетрауксусную кислоту, Gibco, США). Затем клеточную суспензию равномерно распределяли по 25 см 2 культуральным флаконам и добавляли в каждый флакон по 6 мл культуральной среды.

Трансфекция клеток

Хорошо выращенные клетки 2×10 5 высевали на шестилуночный планшет. Когда скорость слияния клеток достигала 80%, выполняли инструкции Lipofectamine TM 2000 (Invitrogen, США) для выполнения миметика miR-664a-3p (миметик), ингибитора miR-664a-3p (ингибитор), отрицательного контроля (отрицательный контроль, NC), плазмида сверхэкспрессии BCL2A1 (pc-BCL2A1) и трансфекция клеток пустой плазмидой (вектор). Все вышеуказанные векторные плазмиды были сконструированы компанией Sangon Biotech (Шанхай, Китай) Co., Ltd. Через 6–8 ч после трансфекции среду меняли. Через 48 ч трансфекция становилась стабильной, и проводились последующие исследования.

Определение клеточной пролиферации с использованием набора для подсчета клеток-8 (CCK-8)

После трансфекции клетки в логарифмической фазе обрабатывали трипсином и ресуспендировали в полной среде. 100 мкл (10 4 клеток) клеточной суспензии добавляли в каждую лунку 96-луночного культурального планшета. После культивирования в течение 0, 24, 48, 72 и 96 ч в каждую лунку добавляли по 10 мкл реагента CCK-8 (Dojindo, Япония), затем помещали обратно в инкубатор и инкубировали в течение 2 ч.Затем использовали спектрофотометр (Huawei Delang Instruments Co., Ltd., Уси, Китай) для определения поглощения при 450 нм.

Определение клеточного цикла с помощью проточной цитометрии

Через 48 часов после трансфекции клетки KGN собирали, промывали предварительно охлажденным фосфатно-солевым буфером (PBS) и трипсинизировали. Затем осадок клеток собирали центрифугированием при 1000 g в течение 5 мин при комнатной температуре и отбрасывали надосадочную жидкость. После двукратной промывки PBS отбрасывали PBS и добавляли 70% этанол для фиксации, который впоследствии помещали в холодильник при -20 °C на 48 часов.После рутинного окрашивания йодидом пропидия (PI) (Invitrogen, США) содержание дезоксирибонуклеиновой кислоты (ДНК) в клетках измеряли с помощью проточной цитометрии, а затем анализировали процент каждой фазы клеточного цикла с использованием программного обеспечения Flowjo (Treestar, Inc.). ., США).

Выявление апоптоза методом проточной цитометрии

Для выявления апоптоза клеток использовали набор Annexin V-FITC/PI Apoptosis Detection (Invitrogen, США). Сбор и промывание клеток осуществляли с использованием той же процедуры, что и для обнаружения клеточного цикла.Затем добавляли связывающий буфер, содержащий аннексин V-FITC/PI, для ресуспендирования клеток, которые затем инкубировали при комнатной температуре и защищали от света в течение 15 мин. После этого для немедленного выявления использовали проточный цитометр (CytoFlex S, Beckman Coulter, CA, USA), а скорость апоптоза анализировали с помощью программного обеспечения Flowjo.

Определение экспрессии клеточного белка с помощью вестерн-блоттинга

По завершении обработки среду для культивирования клеток удаляли, дважды добавляли предварительно охлажденный PBS для промывания клеток, а затем добавляли 200 мкл белкового лизата (содержащего 2 мкл ингибитора протеазы и 2 мкл ингибитора фосфатазы, оба приобретены у Shanghai Sheng Industrial Biology Co., ООО). После раскалывания льда в течение 30 минут добавляли белковый буфер, содержащий β-меркаптоэтанол (Shanghai Shenggong Biological Co., Ltd., Китай), хорошо перемешивали, кипятили в течение 15 минут и хранили при -20 °C для последующего использования. Образцы экстрагированного белка разделяли с помощью 10% полиакриламидного геля и переносили на поливинилиденфторидную (ПВДФ) мембрану (Millipore, США). После блокирования мембраны 5% бычьим сывороточным альбумином (Shanghai Shenggong Biological Co., Ltd., Китай) в течение 2 ч при комнатной температуре ее инкубировали с первичными антителами в течение ночи.Затем его инкубировали с соответствующим вторичным антителом в течение 1 часа на следующий день. Наконец, для экспонирования и проявления использовали метод усиленной хемилюминесценции (ECL; Shanghai Shenggong Biological Co., Ltd., Китай). Используемые первичные антитела, включая CDK2 (1:1000, ab32147), CCNB1 (1:1000, ab181593), BCL2A1 (1:1000, ab45413), BCL2 (1:1000, ab182858), Bax (1:1000, ab32503) и β-актин (1:2000, ab8226) были приобретены у Abcam, США.

Проверка мишени с помощью эксперимента с репортерным геном люциферазы

Веб-сайт TargetScan использовали для предсказания связывающего фрагмента miR-664a-3p и BCL2A1.Амплифицированную последовательность BCL2A1-3′-UTR встраивали в плазмиду микроРНК-репортерной люциферазы для конструирования репортерной люциферазы BCL2A1-3′-UTR (дикого типа, дикого типа), вектора дикого типа BCL2A1-Wt и мутантного (мутантного типа, mut) вектора BCL2A1. -Мут. Репортерный вектор люциферазы и мутантный вектор котрансфицировали микроРНК-отрицательным контролем (NC) или микроРНК-664a-3p в клетки HEK293T, и активность люциферазы определяли в строгом соответствии с инструкциями набора репортерного набора с двойной люциферазой (Promega , США).

Экстракция РНК и детекция методом флуоресцентной количественной ПЦР в реальном времени (qRT-PCR)

Тотальную РНК экстрагировали с помощью TRIzol (Invitrogen, США) и подвергали обратной транскрипции в комплементарную ДНК (кДНК) (Takara, Япония). Затем для количественного определения флуоресценции использовали Power-SYBR-Green (Takara, Япония). В качестве внутреннего эталонного гена использовали β-актин. Набор TaqMan Human MiRNA Detection Kit (Invitrogen, Япония) использовали для амплификации и детекции miR-664a-3p, а U6 использовали в качестве внутреннего контроля.Метод 2 -ΔΔCt использовали для расчета относительного уровня экспрессии генов.

Статистический анализ

Все эксперименты в этом исследовании были независимо повторены три раза. Для анализа использовали программу статистического анализа SPSS 20.0 (IBM, США). Критерий Стьюдента t использовали для сравнения двух групп, и считалось, что P<0,05 указывает на статистическую значимость.


Результаты

Клинические и эндокринные показатели пациентов с СПКЯ и контрольной группы

Клинические и эндокринные показатели пациентов с СПКЯ и контрольной группы показаны в Таблице 2 .По сравнению с контрольной группой уровни индекса массы тела (ИМТ), пролактина, лютеинизирующего гормона, эстрогенов, андрогенов, тестостерона и инсулина у больных СПКЯ были достоверно повышены, а фолликулостимулирующий гормон заметно снижен (р<0,05). Между двумя группами не было существенной разницы в возрасте (P>0,05).

Таблица 2 Клинические характеристики пациентов с синдромом поликистозных яичников (СПКЯ) и контрольной группы здоровых людей
Полная таблица

Экспрессия miR-664a-3p в гранулезных клетках и клетках KGN у пациентов с СПКЯ гранулезные клетки (а также клетки KGN и IOSE80) у 80 пациентов с СПКЯ и 70 здоровых контролей.Как показано на рис. 1A

и 1B , уровень miR-664a-3p в клетках гранулезы у пациентов с СПКЯ был значительно ниже, чем в контрольной группе (P<0,05). Кроме того, дальнейший анализ взаимодействия между miR-664a-3p и СПКЯ показал, что экспрессия miR-664a-3p в клетках KGN также была значительно снижена (P<0,05, , рис. 1B ).

Рисунок 1. MiR-664a-3p имел низкий уровень СПКЯ. (A) Экспрессия миР-664a-3p в гранулезных клетках пациентов с СПКЯ и здоровых людей; (B) экспрессия miR-664a-3p в клетках KGN и IOSE80.По сравнению со здоровым контролем (нормальным)/группой IOSE80, **P<0,01, ***P<0,001.

miR-664a-3p ингибирует пролиферацию клеток гранулезы

Чтобы проверить гипотезу о том, что miR-664a-3p может быть вовлечена в пролиферацию гранулезных клеток, мы временно трансфицировали клетки KGN с помощью миметика miR-664a-3p, ингибитора и NC. На рис. 2A показана проверка экспрессии miR-664a-3p с использованием миметика и ингибитора. Как показано на рисунке 2B , обнаружение CCK-8 показало, что сверхэкспрессия miR-664a-3p ингибирует пролиферацию клеток KGN зависимым от времени образом (все P<0.05), тогда как вмешательство в его экспрессию имело противоположный эффект (все P<0,05). Результаты клеточного цикла ( Рисунок 2C ) показывают, что сверхэкспрессия миР-664a-3p увеличивает количество клеток в фазе G0/G1 и уменьшает количество клеток в фазе S (P<0,05), указывая на то, что клеточный цикл был заторможен. Кроме того, по сравнению с группой NC экспрессия связанных с циклином белков CDK2 и CCNB1 в клетках, трансфицированных miR-664a-3p, была значительно снижена (как P<0,05, рис. 2D , так и E ).Приведенные выше результаты позволяют предположить, что уровень экспрессии микроРНК-664a-3p связан с возникновением СПКЯ.

Рисунок 2 Влияние miR-664a-3p на пролиферацию клеток гранулезы. (A) Эффективность трансфекции миметика miRNA-664a-3p в клетках KGN. (B) Влияние микроРНК-664a-3p на пролиферацию клеток KGN. (C) Влияние miRNA-664a-3p на клеточный цикл KGN. (D, E) Влияние микроРНК-664a-3p на экспрессию CDK2 и CCNB1 в клетках KGN. По сравнению с группой NC *P<0.05, **Р<0,01, ***Р<0,001.

miR-664a-3p индуцирует апоптоз клеток гранулезы

Для дальнейшего изучения функции miR-664a-3p в клетках гранулезы в этом исследовании использовали проточную цитометрию для анализа апоптоза клеток KGN после трансфекции miR-664a-3p мимик или ингибитор. Более того, с помощью Вестерн-блоттинга были обнаружены изменения экспрессии белков, связанных с апоптозом, BCL2 и Bax. Фигура 3A показывают, что миР-664a-3p значительно увеличивает скорость апоптоза клеток KGN (P<0.05), в то время как ингибитор miR-664a-3p снижал апоптоз клеток KGN (P<0,05). На рис. 3B показано, что сверхэкспрессия miR-664a-3p заметно снижала BCL2 и увеличивала экспрессию белка Bax (все P<0,05). Однако противоположный эффект наблюдался при снижении экспрессии miR-664a-3p (все P<0,05).

Рисунок 3 Влияние miR-664a-3p на апоптоз клеток гранулезы. (A) Проточная цитометрия использовалась для обнаружения влияния miRNA-664a-3p на апоптоз клеток KGN.(B) Вестерн-блоттинг использовали для определения влияния miRNA-664a-3p на регуляцию белков, связанных с апоптозом (BCL2 и Bax). По сравнению с группой NC **P<0,01, ***P<0,001.

BCL2A1 является прямой мишенью miRNA-664a-3p

Чтобы изучить механизм miR-664a-3p в гранулезных клетках, мы использовали веб-сайт TargetScan для предсказания возможной мишени гена. Как показано на Фигуре 4A , существуют сайты связывания между miRNA-664a-3p и BCL2A1.Для проверки предсказания TargetScan в этом исследовании был сконструирован репортерный вектор люциферазы, содержащий предсказанный сайт связывания 3’UTR BCL2A1. Как показано на Фигуре 4B , , после совместной трансфекции с BCL2A1-Wt 3’UTR сверхэкспрессия miR-664a-3p приводила к значительному снижению активности люциферазы (P<0,05). Между тем, после котрансфекции с BCL2A1-Mut 3'UTR заметных изменений не наблюдалось (P>0,05). Дальнейшее изучение регуляторного эффекта miR-664a-3p на BCL2A1 показало, что экспрессия мРНК и белка BCL2A1 была значительно снижена, когда клетки KGN сверхэкспрессировали miR-664a-3p (оба P<0,0.05, Рисунок 4C,D,E ).

Рисунок 4 BCL2A1 является потенциальным геном-мишенью для проверки микроРНК-664a-3p. (A) Потенциальный сайт связывания miR-664a-3p и BCL2A1. (B) Репортерный ген люциферазы использовали для проверки взаимосвязи между ними. (C, D, E) Экспрессия BCL2A1, когда клетки KGN сверхэкспрессировали miR-664a-3p. По сравнению с группой NC **P<0,01, ***P<0,001.

Подтверждение того, что BCL2A1 обращает эффект miR-664a-3p на пролиферацию и апоптоз клеток KGN

Как показано на Рисунок 5A, B, C, D, F Сверхэкспрессия 3p в отношении клеточной пролиферации и клеточного цикла (все P<0.05), а также обратил эффект миР-664a-3p на индукцию апоптоза (все P<0,05).

Рисунок 5 Сверхэкспрессия BCL2A1 может обратить действие miR-664a-3p на функцию гранулярных клеток. (A) Проверка эффективности сверхэкспрессии плазмиды BCL2A1; (B) сверхэкспрессия BCL2A1 обращала вспять действие miRNA-664a-3p на пролиферацию клеток KGN; (C) сверхэкспрессия BCL2A1 обращала вспять действие miRNA-664a-3p на клеточный цикл KGN; (D) сверхэкспрессия BCL2A1 обращала вспять действие miRNA-664a-3p на клетки KGN, экспрессирующие связанные с клеточным циклом белки CDK2 и CCNB1; (E) избыточная экспрессия BCL2A1 обращала вспять действие микроРНК-664a-3p на апоптоз клеток KGN; (F) избыточная экспрессия BCL2A1 обращала вспять эффект miRNA-664a-3p на экспрессию белков, связанных с апоптозом, BCL2 и Bax, в клетках KGN.По сравнению с векторной группой *P<0,05, **P<0,01, ***P<0,001. Н.С.: P>0,05. N.S., без существенного.

Влияние ингибирования miR-664a-3p на сигнальный путь митоген-активируемой протеинкиназы/киназы, регулируемой внеклеточным сигналом (MAPK/ERK)

Вестерн-блоттинг показал, что miR-664a-3p ингибирует фосфорилирование MAPK, ERK и белки N-концевой киназы c-Jun (JNK) (все P<0,05), в то время как сверхэкспрессия BCL2A1 обращала этот эффект (все P<0,05) (, рис. 6, ).

Рисунок 6 Ингибирующее действие miR-664a-3p на сигнальный путь MAPK/ERK. По сравнению с группой NC + вектор *P<0,05, **P<0,01, ***P<0,001; по сравнению с группой miR-664a-3p + вектор, ## P<0,01, ### P<0,001.


Обсуждение

СПКЯ — сложное и многофакторное эндокринное заболевание, поражающее около 10% женщин детородного возраста (14). Это связано с множественными маленькими антральными фолликулами в яичнике, которые не могут развиться в более крупные доминантные фолликулы.Клетки гранулезы яичников при СПКЯ являются аномальными. В исследованиях наблюдалось увеличение числа фолликулов и пролиферация GC в моделях СПКЯ у мышей (15). Кроме того, повышенная пролиферация клеток гранулезы в более мелких фолликулах также наблюдалась в яичниках женщин с СПКЯ (16,17). Следовательно, аномальная пролиферация ГК яичников может играть роль в патогенезе СПКЯ. Однако его внутренний механизм остается неясным. Как группа важных посттранскрипционных регуляторов, микроРНК играют важную роль в гранулярных клетках при физиологических и патологических состояниях.Многие miRNAs экспрессируются в GC и напрямую регулируют нормальное развитие и функцию фолликулов путем нацеливания на специфические молекулы и регулирования различных сигнальных путей (18), включая атрезию, овуляцию и выработку стероидов яичниками. Более того, исследования подтвердили, что микроРНК могут играть роль в СПКЯ, воздействуя на клетки гранулезы (19).

Предыдущие сообщения показывают, что miR-664a-3p выполняет различные функции при различных заболеваниях. Йонеда и др. использовали технологию микрочипов и технологию ОТ-ПЦР для анализа профилей миРНК в сыворотке в образцах пациентов с хроническим и нехроническим пародонтитом и обнаружили, что экспрессия миР-664a-3p у пациентов с пародонтитом была выше, чем в контроле. группа.Ожидается, что миР-664a-3p станет сывороточным биомаркером хронического периодонтита (20). Кроме того, Modak и др. обнаружили, что экспрессия miR-664a-3p у пациентов с кардиогенным инсультом является аномальной (21). Кроме того, аномальная экспрессия miR-664a-3p также была обнаружена при различных злокачественных опухолях, таких как рак желудка, рак молочной железы, рак шейки матки, остеосаркома и хронические респираторные заболевания (22,23). В этом исследовании впервые была обнаружена экспрессия миР-664a-3p в клетках гранулезы у пациентов с СПКЯ и у здоровых людей, и было обнаружено, что ее экспрессия была снижена.Впоследствии путем сверхэкспрессии или вмешательства в миР-664a-3p в клетках гранулезы было обнаружено, что миР-664a-3p обладает эффектом ингибирования пролиферации клеток гранулезы и стимулирования апоптоза.

BCL2A1 — один из наименее изученных представителей семейства BCL2. В соответствии с его антиапоптотической активностью BCL2A1 сильно активируется при некоторых злокачественных новообразованиях кроветворной системы (24). Недавние исследования показали, что сниженная экспрессия BCL2A1 в большинстве злокачественных опухолей может восстановить чувствительность опухоли к химиотерапевтическим препаратам, что дает четкую основу для рака, нацеленного на BCL2A1 (25,26).Тем не менее, в литературе нет соответствующих отчетов о BCL2A1 и СПКЯ. В этом исследовании впервые были предсказаны возможные гены-мишени miR-664a-3p с использованием веб-сайта биологической информации (TargetScan), и BCL2A1 привлек наше внимание благодаря своей антиапоптотической активности и потенциальным сайтам связывания. Эксперимент с репортерным геном люциферазы подтвердил, что BCL2A1 действительно является геном-мишенью miR-664a-3p. Впоследствии совместная трансфекция плазмиды со сверхэкспрессией BCL2A1 и миметика miR-664a-3p в клетках гранулезы доказала, что BCL2A1 может обратить ингибирующее действие miR-664a-3p на пролиферацию клеток KGN и способствовать апоптозу.Кроме того, известно, что BCL2A1 оказывает активирующее действие на сигнальный путь MAPK (27), поэтому это исследование было использовано для проверки. Исследования показали, что путь MAPK клеток KGN, сверхэкспрессирующих miR-664a-3p, значительно ингибируется, и это ингибирование может быть обращено вспять, когда клетки одновременно сверхэкспрессируют BCL2A1. Предполагается, что miR-664a-3p играет роль в клетках KGN, ингибируя передачу сигналов BCL2A1/MAPK.

Это первое исследование, в котором использовались клетки гранулезы в исследовании in vitro , чтобы подтвердить, что миР-664a-3p может ингибировать пролиферацию клеток KGN и индуцировать апоптоз.Конкретный механизм может заключаться в том, что miR-664a-3p действует путем нацеливания на BCL2A1, чтобы регулировать состояние активации сигнального пути MAPK/ERK. Эти результаты обеспечивают теоретическую основу для клинического применения миР-664a-3p для мониторинга и лечения СПКЯ. Однако это исследование также имеет ограничения. Например, в этом исследовании использовали только гранулярные клетки KGN для подтверждения эффекта miR-664a-3p in vitro, что было ограничено ограничениями фундаментальных исследований. По-прежнему необходимы дальнейшие углубленные исследования для изучения роли и механизма миР-664a-3p в СПКЯ, чтобы как можно скорее предоставить новые идеи для клинического лечения СПКЯ.


Выводы

МиР-664a-3p деактивирует сигнальный путь MAPK/ERK, воздействуя на BCL2A1, тем самым ингибируя пролиферацию клеток KGN и индуцируя апоптоз. Это исследование обеспечивает возможную цель для клинического лечения СПКЯ.


Благодарности

Финансирование: Нет.


Контрольный список отчетов: Авторы заполнили контрольный список отчетов MDAR. Доступно на http://dx.doi.org/10.21037/atm-21-1614

Заявление о совместном использовании данных: Доступно на http://dx.doi.org/10.21037/atm-21-1614

Конфликты интересов: Все авторы заполнили единую форму раскрытия информации ICMJE (доступна по адресу http://dx.doi.org/10.21037/atm-21-1614). У авторов нет конфликта интересов, о котором следует заявить.

Этическое заявление: Авторы несут ответственность за все аспекты работы, обеспечивая надлежащее расследование и решение вопросов, связанных с точностью или целостностью любой части работы. Все процедуры, проведенные в этом исследовании с участием людей, соответствовали Хельсинкской декларации (пересмотренной в 2013 г.).Исследование было одобрено Комитетом по этике Второй дочерней больницы Университета Чжэнчжоу (№: 2017663), и у всех пациентов было получено информированное согласие.

Заявление об открытом доступе: Это статья открытого доступа, распространяемая в соответствии с Международной лицензией Creative Commons Attribution-NonCommercial-NoDerivs 4.0 (CC BY-NC-ND 4.0), которая разрешает некоммерческое копирование и распространение статья со строгим условием, что не вносятся никакие изменения или правки и правильно цитируется оригинальная работа (включая ссылки как на официальную публикацию через соответствующий DOI, так и на лицензию).См.: https://creativecommons.org/licenses/by-nc-nd/4.0/.


Ссылки

  1. Teede HJ, Misso ML, Boyle JA, et al. Международная сеть СПКЯ. Перевод и внедрение руководства по СПКЯ под руководством Австралии: клиническое резюме и ресурсы для перевода из Международного научно обоснованного руководства по оценке и лечению синдрома поликистозных яичников. Med J Aust 2018;209:S3-8. [Crossref] [PubMed]
  2. Norman RJ, Dewailly D, Legro RS, et al. Синдром поликистоза яичников.Ланцет 2007;370:685-697. [Crossref] [PubMed]
  3. Guzick DS. Синдром поликистоза яичников. Obstet Gynecol 2004;103:181-93. [Crossref] [PubMed]
  4. Chen B, Xu P, Wang J и др. Роль микроРНК в синдроме поликистозных яичников (СПКЯ). Гена 2019;706:91-96. [Crossref] [PubMed]
  5. Zhou JY, Zhang XY, Yu ML, et al. Влияние чрескожной электростимуляции акупунктурных точек на уровни половых гормонов в сыворотке крови и экспрессию ферментов метаболизма стероидных гормонов яичников у крыс с синдромом поликистозных яичников.Чжэнь Ци Янь Цзю 2016; 41:11-7. [PubMed]
  6. Цзян YC, Ма JX. Роль миР-324-3p в синдроме поликистозных яичников (СПКЯ) посредством нацеливания на WNT2B. Eur Rev Med Pharmacol Sci 2018;22:3286-93. [PubMed]
  7. Сироткин А.В., Лаукова М., Овчаренко Д. и соавт. Идентификация микроРНК, контролирующих пролиферацию и апоптоз клеток яичников человека. J Cell Physiol 2010; 223:49-56. [PubMed]
  8. Bao Y, Chen B, Wu Q и др. Сверхэкспрессия миР-664 связана с усиленной миграцией клеток остеосаркомы и способностью к инвазии посредством нацеливания на SOX7.Clin Exp Med 2017;17:51-8. [Crossref] [PubMed]
  9. Wu L, Li Y, Li J и др. МикроРНК-664 нацелена на субстрат инсулинового рецептора 1 для подавления пролиферации и инвазии клеток при раке молочной железы. Oncol Res 2019;27:459-67. [Crossref] [PubMed]
  10. Vogler M. BCL2A1: неудачник в семействе BCL2. Cell Death Differ 2012; 19:67-74. [Crossref] [PubMed]
  11. Haq R, Yokoyama S, Hawryluk EB, et al. BCL2A1 является клоноспецифическим антиапоптозным онкогеном меланомы, который придает устойчивость к ингибированию BRAF.Proc Natl Acad Sci U S A 2013;110:4321-6. [Crossref] [PubMed]
  12. Sochalska M, Schuler F, Weiss JG, et al. MYC отбирает сниженную экспрессию белка BCL2A1/A1 во время В-клеточного лимфомагенеза. Онкоген 2017;36:2066-73. [Перекрестная ссылка] [PubMed]
  13. . Роттердамская рабочая группа по консенсусу по СПКЯ, спонсируемая ESHRE/ASRM. Пересмотренный консенсус 2003 г. по диагностическим критериям и долгосрочным рискам для здоровья, связанным с синдромом поликистозных яичников. Фертил Стерил 2004; 81:19-25. [Crossref]
  14. Йылдыз Б.О., Боздаг Г., Япычи З. и др.Распространенность, фенотип и кардиометаболический риск синдрома поликистозных яичников при различных диагностических критериях. Хум Репрод 2012; 27:3067-3073. [Crossref] [PubMed]
  15. Färkkilä A, Haltia UM, Tapper J, et al. Патогенез и лечение гранулезоклеточной опухоли яичника у взрослых. Энн Мед 2017;49:435-47. [Crossref] [PubMed]
  16. Yildiz BO, Bozdag G, Yapici Z, et al. Распространенность, фенотип и кардиометаболический риск синдрома поликистозных яичников при различных диагностических критериях. Хум Репрод 2012; 27:3067-73.[Crossref] [PubMed]
  17. Liu T, Li Q, Wang S, et al. Трансплантация гранулезоподобных клеток яичников, полученных из индуцированных человеком плюрипотентных стволовых клеток, для лечения преждевременной недостаточности яичников у мышей. Мол Мед Реп 2016;13:5053-8. [Crossref] [PubMed]
  18. Tesfaye D, Gebremedhn S, Salilew-Wondim D, et al. МикроРНК: крошечные молекулы, играющие важную роль в развитии фолликулов и ооцитов млекопитающих. Репродукция 2018;155:R121-35. [Crossref] [PubMed]
  19. Tu J, Cheung AH, Chan CL, et al.Роль микроРНК в гранулезных клетках яичников в норме и при патологии. Front Endocrinol (Лозанна) 2019; 10:174. [Crossref] [PubMed]
  20. Yoneda T, Tomofuji T, Ekuni D, et al. МикроРНК сыворотки и хронический пародонтит: исследование случай-контроль. Arch Oral Biol 2019; 101: 57-63. [Crossref] [PubMed]
  21. Modak JM, Roy-O’Reilly M, Zhu L, et al. Дифференциальная экспрессия микрорибонуклеиновой кислоты при кардиоэмболическом инсульте. J Stroke Cerebrovasc Dis 2019; 28: 121-4. [Crossref] [PubMed]
  22. Ван Л., Ли Б., Чжан Л. и др.миР-664a-3p функционирует как онкоген, воздействуя на путь Hippo при развитии рака желудка. Cell Prolif 2019; 52:e12567 [Crossref] [PubMed]
  23. Zhong S, Chen C, Liu N, et al. Сверхэкспрессия hsa-miR-664a-3p связана с хронической обструктивной болезнью легких, вызванной сигаретным дымом, посредством нацеливания на FHL1. Int J Chron Obstruct Pulmon Dis 2019; 14: 2319-29. [Crossref] [PubMed]
  24. Lionnard L, Duc P, Brennan MS, et al. TRIM17 и TRIM28 антагонистически регулируют убиквитинирование и антиапоптотическую активность BCL2A1.Cell Death Differ 2019; 26: 902-17. [Crossref] [PubMed]
  25. Haq R, Yokoyama S, Hawryluk EB, et al. BCL2A1 является клоноспецифическим антиапоптозным онкогеном меланомы, который придает устойчивость к ингибированию BRAF. Proc Natl Acad Sci U S A 2013;110:4321-6. [Crossref] [PubMed]
  26. Wang T, Li F, Tang S. MiR-30a активирует экспрессию BCL2A1, IER3 и циклина D2, воздействуя на FOXL2. Oncol Lett 2015;9:967-71. [Crossref] [PubMed]
  27. Yu B, You W, Chen G и др. МиР-140-5p ингибирует пролиферацию клеток и метастазирование, регулируя MUC1 через путь BCL2A1/MAPK при тройном негативном раке молочной железы.Клеточный цикл 2019;18:2641-50. [Crossref] [PubMed]

(редактор на английском языке: A. Kassem)

Цитируйте эту статью как: He M, Mao G, Xiang Y, Li P, Wu Y, Zhao D, Li T. MicroRNA- 664a-3p ингибирует пролиферацию гранулезных клеток яичников при синдроме поликистозных яичников и способствует апоптозу путем нацеливания на BCL2A1. Энн Трансл Мед 2021;9(10):852. doi: 10.21037/atm-21-1614

Дифференцировка крысиных iPS-клеток и ES-клеток в клетки, подобные клеткам гранулезы, in vitro | Acta Biochimica et Biophysica Sinica

Аннотация

Преждевременная недостаточность яичников (ПНЯ) представляет собой дефект яичников, характеризующийся преждевременным истощением фолликулов в яичниках до 40 лет, что является одной из основных причин женского бесплодия.Стволовые клетки обеспечивают возможность потенциального лечения POF. В этом исследовании эмбриональные стволовые клетки крысы (ЭСК) и индуцированные плюрипотентные стволовые клетки (ИПСК) культивировали совместно с клетками гранулезы (ГК) для дифференцировки в ГК-подобные клетки. Уровень эстрадиола (Е2), проанализированный с помощью радиоиммуноанализа, показал, что концентрация Е2 в супернатанте культуры совместно культивируемых ИПСК и ЭСК крыс увеличивалась в зависимости от времени по сравнению с группой ГК, которая имеет противоположную тенденцию. Экспрессия рецептора фолликулостимулирующего гормона (FSHR) была подтверждена иммуноокрашиванием.Эти результаты показали, что ИПСК и ЭСК крысы эффективно индуцировались в GC-подобные клетки посредством непрямого межклеточного контакта. Реакция полимеразной цепной реакции в реальном времени была проведена для анализа уровня экспрессии генов маркера в POF, включая BMP15 , FMR1 , FSHR , Inda , AMH , NOBOX , FoxO3 , EIF2B , FIGLA и GDF9 . Гены BMP15 , FSHR , INHA , AMH , NOBOX и GDF9 были значительно активизированы в ИПСК, а клетки ЭСК культивировались совместно с клетками, не культивируемыми с GC. .Таким образом, здесь мы продемонстрировали доступный метод дифференцировки ИПСК и ЭСК крысы в ​​GC-подобные клетки in vitro для возможной клеточной терапии ПЯН.

Введение

[1]. Многие маркерные гены играют роли в разработке POF, в том числе BMP15 , FMR1 , FSHR , Inda , AMH , NOBOX , FoxO3 , EIF2B , Figla и генов GDF9 [2]; однако в настоящее время до сих пор неизвестно, какой ген или гены играют наиболее важную роль в развитии ПНЯ.Пациентов с ПНЯ можно лечить экзогенной заместительной терапией эстрогенами; однако уровень эстрогена у этих пациентов не может поддерживаться в пределах нормального физиологического диапазона. Кроме того, использование донорской ткани является новым способом лечения ПНЯ, но нехватка донорской ткани, а также возможность иммунологического отторжения ограничивают клиническое применение этого потенциального метода лечения.

После успешного создания линий эмбриональных стволовых клеток мыши (ESC) в 1981 году [3] стволовые клетки стали полезным инструментом для исследования болезней и функций генов.В 2006 г. другой тип плюрипотентных стволовых клеток, называемый индуцированными плюрипотентными стволовыми клетками (ИПСК), был получен путем перепрограммирования взрослых клеток с использованием определенных факторов транскрипции [4,5]. Технология иПСК потенциально может преодолеть два важных препятствия, связанных с использованием ЭСК человека: иммунное отторжение после трансплантации и этические проблемы, связанные с использованием человеческих эмбрионов. Это обеспечивает полезную модель для исследования механизма ПНЯ и одновременно дает возможность лечения ПНЯ с помощью клеточной терапии, опосредованной трансплантацией стволовых клеток.

Цель этого исследования была сосредоточена на модели дифференцировки ИПСК и ЭСК крыс, совместно культивируемых с гранулезными клетками яичников (GCs) in vitro .

Материалы и методы

ГХ культура

GC были выделены с использованием метода, описанного Tajima et al. [6] с модификациями. Вкратце, 4-недельным самкам крыс Sprague Dawley подкожно вводили 40 МЕ гонадотропина сыворотки беременных кобыл (PMSG, Folligon; Intervet, Новый Южный Уэльс, Австралия), чтобы вызвать рекрутирование фолликулов и увеличить количество собранных ооцитов.Через сорок восемь часов после инъекции PMSG GC собирали из фолликулов и поддерживали в среде DMEM/F12, содержащей 10% фетальной бычьей сыворотки (FBS).

Культура ЭСК

Облученные фидерные клетки C57BL/6 (SiDanSai, Шанхай, Китай) высевали в культуральные колбы с желатиновым покрытием за 2 дня до пассажа ЭСК при плотности 60 000 клеток/см 2 . Культуральная среда для фидерных клеток состояла из DMEM (Invitrogen, Carlsbad, USA) с добавлением 10% FBS (Hyclone, Logan, USA).Культуральную среду меняли на среду ESC непосредственно перед пассированием ESC. ЭСК поддерживали в среде ЭСК, которая содержала среду N2B27 (Invitrogen) с 1 мМ ингибитора MEK PD0325901 (Stemgent, Кембридж, США), 3 мМ ингибитора GSK3 CHIR99021 (Stemgent), 2 мМ l-глютамина, 1% заменимых аминокислот. кислот и 0,1 мМ β-меркаптоэтанола [7].

Культура иПСК

крысиных iPS-клеток были любезно предоставлены Dr Xiao [8]. ИПСК высевали на мышиные эмбриональные фибробласты в количестве 6 × 10 5 клеток/лунку в шестилуночном планшете с культуральной средой (DMEM/F12 + 10% FBS + 10% замена сыворотки).

ИПСК и ЭСК, совместно культивированные с ГХ

Непрямое совместное культивирование было установлено с использованием системы совместного культивирования Transwell (Costar, Кембридж, США). Каждая лунка содержала вставку с мембраной с размером пор 0,4 мкм для раздельного культивирования ИПСК и ЭСК из ГК. ИПСК и ЭСК высевали в количестве 5 × 10 3 клеток/лунку через 2 ч перед помещением 5 × 10 3 ГХ во вставку. В каждую лунку вводили по 4 мл DMEM с добавлением 15% FBS и антибиотиков. В качестве альтернативы эти клетки также культивировали в кондиционированной среде новорожденных GC (GC, выращенные до 90% слияния, использовали для сбора супернатанта после 24 часов инкубации.Среда, кондиционированная ГХ, относится к надосадочной жидкости, смешанной в соотношении 1:1 с полной средой). Клетки культивировали при 37°С в 5% СО 2 и заменяли среду каждые 2 дня. Через 7 дней вставки удаляли, а ИПСК и ЭСК собирали для иммуноцитохимии и полимеразной цепной реакции (ПЦР) в реальном времени.

Окрашивание щелочной фосфатазой

Набор для обнаружения щелочной фосфатазы (AP) (Millipore, Billerica, USA) использовали для определения активности AP. Клетки ES или iPS крыс культивировали в течение 3 дней, а затем фиксировали фиксатором [4% параформальдегид в фосфатно-солевом буфере (PBS)] в течение 1–2 минут, промывали 1-кратным промывочным буфером с последующим окрашиванием AP (буфер A: буфер B). : Буфер C : H 2 O = 1 : 1 : 1 : 1).Примерно через 15 минут клетки дважды промывали 1× промывочным буфером и, наконец, покрывали 1× буфером PBS для предотвращения высыхания. Затем активность АП определяли под микроскопом (Olympus, Токио, Япония). Недифференцированные клетки ES или iPS крысы окрашивались в пурпурно-синий цвет, что указывало на то, что клетки были положительными по AP, в то время как дифференцированные клетки были отрицательными для окрашивания на AP.

Иммуноокрашивание

Антитела к рецептору фолликулостимулирующего гормона (FSHR) (1 : 150; Chemicon, Billerica, США) использовали для экспериментов по иммуноокрашиванию.ИПСК и ЭСК сначала промывали PBS, а затем фиксировали в течение 30 мин при комнатной температуре в 4% параформальдегиде, блокировали 10% неиммунной сывороткой плюс 0,2% Triton X-100. Первичные антитела инкубировали с клетками в течение ночи при 4°С. Клетки промывали три-пять раз PBS, содержащим 0,1% Triton X-100 (PBST), а затем инкубировали со вторичным Alexa Fluor ® 594 ослиных анти-козьих IgG (H + L) (Invitrogen) в буфере в течение 1 ч при комнатной температуры в темноте. Затем клетки трижды промывали PBST и затем инкубировали с 4,6-диамино-2-фенилиндолом (DAPI) в конечной концентрации 1 мкг/мл в PBS в течение 5 мин.Наконец, клетки дважды (по 5 мин) промывали PBS, а затем визуализировали с помощью флуоресцентного микроскопа (Olympus).

Анализ на гормоны

супернатантов совместной культуры анализировали с помощью радиоиммуноанализа, как описано ранее [9], с адаптацией к эстрадиолу (Е2). В дни 1, 5 и 7 вставки удаляли и культуральный супернатант собирали для анализа после культивирования в течение ночи.

ОТ-ПЦР в реальном времени

Тотальную РНК экстрагировали из образцов клеток с помощью набора Trizol (Invitrogen) в соответствии с инструкциями производителя.После экстракции общее количество выделенных нуклеиновых кислот элюировали в 100 мкл. Реакционную смесь для обратной транскрипции общим объемом 25 мкл готовили следующим образом. Сначала к 5 мкл выделенной РНК добавляли 1 мкл случайных праймеров (0,2 мкг/мкл; Promega, Мэдисон, США). Смесь денатурировали при 70°С в течение 5 мин и немедленно охлаждали на льду. Затем 5 мкл 5-кратного буфера для обратной транскрипции, 0,75 мкл РНКазина (40 ЕД/мкл; Promega), 1 мкл обратной транскриптазы M-MLV (200 ЕД/мкл; Promega), 1.В реакционную пробирку добавляли 25 мкл dNTP ( 10 мМ; Promega) и 11 мкл воды без РНКазы. Пробирку осторожно встряхивали и инкубировали в течение 60 мин при 37°С. Реакцию останавливали при 95°С в течение 5 мин. Синтезированную кДНК использовали для ПЦР-амплификации в реальном времени с использованием набора SYBR Green I PCR (BioWhittaker, Walkersville, USA) в соответствии с рекомендациями производителя. Реакцию проводили на приборе ПЦР в реальном времени Smart Cycler (Bio-Rad, Hercules, США). Праймеры, использованные для ПЦР в реальном времени, перечислены в таблице 1.Реакции ПЦР инициировали при 95°С в течение 90 с, затем следовали 40 циклов при 94°С в течение 15 с, 66°С в течение 10 с и 72°С в течение 30 с, а также завершающее удлинение при 72°С в течение 5 мин. Анализы кривых плавления (100 циклов 45–95°C в течение 10 с) также проводили для исключения неспецифических продуктов ПЦР. Ряд разведенных образцов кДНК использовали в качестве шаблонов для получения стандартных кривых. Каждую реакцию повторяли трижды.

Таблица 1

Оптимальные праймеры, используемые в ПЦР в реальном времени

Назад CTCTTCAAGATAGCCCTG
Мишень . . Последовательность (5′–3′) . 90 172
BMP15 Форвард GCCAGTGCAATGAGGCTTCTCAG
Обратный ACTCTCCGTCCCTTGCGATTCC
FMR1 Форвард ATCCCTGCAGAGCACCTCCA
Обратный TTCACCTCATGCCCTGTGCC
INHA Форвард ACAGGTGCCACCTGTGAGGA
Обратный TGTCCCAAGGACACAGGCAC
FSHR Форвард TGCAAACTTGAAGCGGCAAATCTC
Обратный CAAGACCCTGAGGATGTTGTACCC
OCT4 Форвард CGAGGCCTTTCCCTCTGTTCCT
Reverse ACCTTTGCCTCTGAAACCTATCCT
АМГ Форвард CCAAGCAAAGAAGGTGCCACCC
Reverse GCAGAGCACGAACCAAGCGA
NOBOX Форвард AGCCAGTGCAGATCTGCACC
Reverse TGTCACTGCCAGGAACATCCCTC
FOXO3 Форвард GGCAAAGCAGACCCTCAAACTGAC
Reverse TGTCCACGATGGCAGGTCAC
EIF2B Форвард TCTCCAACGAGCTAGATGACCCTG
Reverse TGACTCGGAGGACAACAGGCA
FIGLA Вперед TTTCTACCACAGAGCAGGAAGCCC
Назад TCTTCAAGCCACTTGCACAGCC
GDF9 GDF9 Forver CCTAACCCAGCAGAAGTCACCCCT REVICE
REVICE AGGAAGCAGCGGGGTTGTTCAG
Назад CTCTTCAAGATAGCCCTG
. . Последовательность (5′–3′) . 90 172
BMP15 Форвард GCCAGTGCAATGAGGCTTCTCAG
Обратный ACTCTCCGTCCCTTGCGATTCC
FMR1 Форвард ATCCCTGCAGAGCACCTCCA
Обратный TTCACCTCATGCCCTGTGCC
INHA Форвард ACAGGTGCCACCTGTGAGGA
Обратный TGTCCCAAGGACACAGGCAC
FSHR Форвард TGCAAACTTGAAGCGGCAAATCTC
Обратный CAAGACCCTGAGGATGTTGTACCC
OCT4 Форвард CGAGGCCTTTCCCTCTGTTCCT
Reverse ACCTTTGCCTCTGAAACCTATCCT
АМГ Форвард CCAAGCAAAGAAGGTGCCACCC
Reverse GCAGAGCACGAACCAAGCGA
NOBOX Форвард AGCCAGTGCAGATCTGCACC
Reverse TGTCACTGCCAGGAACATCCCTC
FOXO3 Форвард GGCAAAGCAGACCCTCAAACTGAC
Reverse TGTCCACGATGGCAGGTCAC
EIF2B Форвард TCTCCAACGAGCTAGATGACCCTG
Reverse TGACTCGGAGGACAACAGGCA
FIGLA Вперед TTTCTACCACAGAGCAGGAAGCCC
Назад TCTTCAAGCCACTTGCACAGCC
GDF9 GDF9 Forver CCTAACCCAGCAGAAGTCACCCCTCCTCACCAGCAGAGTCACCCTCTCAGCAGCAGCAGCGGGAGTTGTTCAG
Таблица 1

Оптимальные праймеры, используемые в реальном времени PCR

Назад CTCTTCAAGATAGCCCTG
. . Последовательность (5′–3′) . 90 172
BMP15 Форвард GCCAGTGCAATGAGGCTTCTCAG
Обратный ACTCTCCGTCCCTTGCGATTCC
FMR1 Форвард ATCCCTGCAGAGCACCTCCA
Обратный TTCACCTCATGCCCTGTGCC
INHA Форвард ACAGGTGCCACCTGTGAGGA
Обратный TGTCCCAAGGACACAGGCAC
FSHR Форвард TGCAAACTTGAAGCGGCAAATCTC
Обратный CAAGACCCTGAGGATGTTGTACCC
OCT4 Форвард CGAGGCCTTTCCCTCTGTTCCT
Reverse ACCTTTGCCTCTGAAACCTATCCT
АМГ Форвард CCAAGCAAAGAAGGTGCCACCC
Reverse GCAGAGCACGAACCAAGCGA
NOBOX Форвард AGCCAGTGCAGATCTGCACC
Reverse TGTCACTGCCAGGAACATCCCTC
FOXO3 Форвард GGCAAAGCAGACCCTCAAACTGAC
Reverse TGTCCACGATGGCAGGTCAC
EIF2B Форвард TCTCCAACGAGCTAGATGACCCTG
Reverse TGACTCGGAGGACAACAGGCA
FIGLA Вперед TTTCTACCACAGAGCAGGAAGCCC
Назад TCTTCAAGCCACTTGCACAGCC
GDF9 GDF9 Forver CCTAACCCAGCAGAAGTCACCCCT REVICE
REVICE AGGAAGCAGCGGGGTTGTTCAG
Назад CTCTTCAAGATAGCCCTG
. . Последовательность (5′–3′) . 90 172
BMP15 Форвард GCCAGTGCAATGAGGCTTCTCAG
Обратный ACTCTCCGTCCCTTGCGATTCC
FMR1 Форвард ATCCCTGCAGAGCACCTCCA
Обратный TTCACCTCATGCCCTGTGCC
INHA Форвард ACAGGTGCCACCTGTGAGGA
Обратный TGTCCCAAGGACACAGGCAC
FSHR Форвард TGCAAACTTGAAGCGGCAAATCTC
Обратный CAAGACCCTGAGGATGTTGTACCC
OCT4 Форвард CGAGGCCTTTCCCTCTGTTCCT
Reverse ACCTTTGCCTCTGAAACCTATCCT
АМГ Форвард CCAAGCAAAGAAGGTGCCACCC
Reverse GCAGAGCACGAACCAAGCGA
NOBOX Форвард AGCCAGTGCAGATCTGCACC
Reverse TGTCACTGCCAGGAACATCCCTC
FOXO3 Форвард GGCAAAGCAGACCCTCAAACTGAC
Reverse TGTCCACGATGGCAGGTCAC
EIF2B Форвард TCTCCAACGAGCTAGATGACCCTG
Reverse TGACTCGGAGGACAACAGGCA
FIGLA Вперед TTTCTACCACAGAGCAGGAAGCCC
Назад TCTTCAAGCCACTTGCACAGCC
GDF9 GDF9 Forver CCTAACCCAGCAGAAGTCACCCCT REVICE
REVICE AGGAAGCAGCGGGGTTGTTCAG

результаты

Морфология иПСК и ЭСК до и после совместного культивирования с ГХ

В нормальных условиях ИПСК и ЭСК крысы образовывали плотно упакованные трехмерные скопления клеток.Эти скопления были механически диссоциированы и повторно высеяны на свежие фидерные клетки до тех пор, пока они не приобрели гомогенную, уплощенную и плотно упакованную морфологию с четкими краями [, рис. 1(A,F) ]. Когда фиксированные иПСК и ЭСК окрашивали AP, недифференцированные клетки выглядели красными и были окружены бесцветными дифференцированными клетками [, рис. 1(B,G) ]. На 3-й день морфологию ИПСК и ЭСК наблюдали с помощью световой микроскопии [, рис. 1(C,H) ]. Морфология иПСК и ЭСК на 5-й день представлена ​​на рис. .1(Д,И) . На 7-й день морфология иПСК и ЭСК [ рис. 1(E,J )] стала сопоставима с морфологией ГК [ рис. 1(K) ].

Рисунок 1

Наблюдение за ИПСК и ЭСК до и после совместного культивирования  (A) Наблюдение ИПСК под фазово-контрастным светом под микроскопом. (B) AP-окрашивание ИПСК. (C) ИПСК, совместно культивированные с GCs в течение 3 дней. (D) ИПСК совместно культивировали с ГК в течение 5 дней. (E) ИПСК совместно культивировали с ГК в течение 7 дней. (F) Фазово-контрастные световые микроскопические наблюдения за ЭСК.(G) AP-окрашивание ESC. (H) ЭСК совместно культивировали с ГК в течение 3 дней. (I) ЭСК совместно культивировали с ГК в течение 5 дней. (J) ЭСК совместно культивировали с ГК в течение 1 недели. (K) ГХ, культивируемые отдельно. Масштабная линейка = 200 мкм.

Рисунок 1

Наблюдение за ИПСК и ЭСК до и после совместного культивирования  (A) Наблюдение ИПСК под фазово-контрастным светом под микроскопом. (B) AP-окрашивание ИПСК. (C) ИПСК, совместно культивированные с GCs в течение 3 дней. (D) ИПСК совместно культивировали с ГК в течение 5 дней. (E) ИПСК совместно культивировали с ГК в течение 7 дней.(F) Фазово-контрастные световые микроскопические наблюдения за ЭСК. (G) AP-окрашивание ESC. (H) ЭСК совместно культивировали с ГК в течение 3 дней. (I) ЭСК совместно культивировали с ГК в течение 5 дней. (J) ЭСК совместно культивировали с ГК в течение 1 недели. (K) ГХ, культивируемые отдельно. Масштабная линейка = 200 мкм.

Экспрессия FSHR в иПСК и ЭСК после индукции

Результаты иммуноокрашивания показали повышенную экспрессию FSHR в иПСК и ЭСК после совместного культивирования, и можно было наблюдать положительные окрашивающие клетки. Цитоплазму и цитомембрану окрашивали анти-FSHR (красный) и DAPI (синий) соответственно [ Fig.2(А-Ф) ]. ИПСК и ЭСК, культивированные отдельно, использовали в качестве отрицательного контроля [, рис. 2(G-J) ].

Рисунок 2

Экспрессия FSHR в иПСК и ЭСК, совместно культивируемых с GCs  (A,B) Анализ уровня экспрессии FSHR в иПСК после совместного культивирования с помощью иммуноокрашивания. (С) Слияние. (D, E) Анализ уровня экспрессии FSHR в ESC после совместного культивирования с помощью иммуноокрашивания. (F) Слияние. Масштабная линейка = 100 мкм. (G, H) Отрицательный контроль только ИПСК, масштабная линейка = 20 мкм.(I,J) Отрицательный контроль только ЭСК, масштабная линейка = 20 мкм.

Рисунок 2

Экспрессия FSHR в иПСК и ЭСК, совместно культивируемых с GCs  (A,B) Анализ уровня экспрессии FSHR в иПСК после совместного культивирования с помощью иммуноокрашивания. (С) Слияние. (D, E) Анализ уровня экспрессии FSHR в ESC после совместного культивирования с помощью иммуноокрашивания. (F) Слияние. Масштабная линейка = 100 мкм. (G, H) Отрицательный контроль только ИПСК, масштабная линейка = 20 мкм. (I,J) Отрицательный контроль только ЭСК, масштабная линейка = 20 мкм.

Уровни экспрессии маркерных генов в ИПСК и ЭСК после индукции

ПЦР в реальном времени была выполнена для проанализации уровней экспрессии BMP15 , FMR1 , Inda , FSHR , OCT4 , Nanog , AMH , NOBOX , Foxo3 , EIF2B , FIGLA и GDF9 генов в иПСК и ЭСК после индукции ( рис. 3 ). Гены BMP15 , INHA , FSHR , AMH , NOBOX и GDF9 значительно активировались в клетках крыс до иПСК и ЭСК после совместного культивирования. -культура.Ген FMR1 повышал уровень экспрессии в совместно культивируемых ИПСК, но не изменялся в совместно культивируемых ЭСК. Кроме того, гены EIF2B и FOXO3 значительно активировались в совместно культивируемых ИПСК и слабо активировались в совместно культивируемых ЭСК. Ген FIGLA активировался в совместно культивируемых ЭСК, но подавлялся в совместно культивируемых ИПСК. Гены OCT4 и NANOG были значительно подавлены как в совместно культивируемых ИПСК, так и в ЭСК, что указывало на дифференцировку ИПСК и ЭСК.

Рисунок 3

Определение уровней экспрессии маркерных генов BMP15, FMR1, INHA, FSHR, OCT4, AMH, NOBOX, FOXO3, EIF2B, FIGLA, GDF9 и NANOG генов и ЭСК после индукции в ИПСК были обнаружены с помощью ПЦР в реальном времени.

Рисунок 3

Определение уровней экспрессии маркерных генов BMP15, FMR1, INHA, FSHR, OCT4, AMH, NOBOX, FOXO3, EIF2B, FIGLA, GDF9 и гены NANOG iPs и ESC в генах NANOG индукции были обнаружены с помощью ПЦР в реальном времени.

Уровень E2 совместно культивируемых ИПСК крысы и ЭСК

ГК выполняют функцию секреции эстрогена. Радиоиммуноанализ показал, что уровень E2 в супернатантах культуры GC составлял 1,25 нг/мл в день 1 и снижался в зависимости от времени. В культуральных супернатантах группы совместного культивирования ИПСК крысы и ЭСК-ГК наблюдалась противоположная тенденция. В группе совместного культивирования иПСК крысы и ГК Е2 составлял 0,13 нг/мл в 1-й день и увеличивался в зависимости от времени, достигая 1.69 нг/мл на 7-й день (, рис. 4, ). В группе совместного культивирования ЭСК-ГК Е2 составлял 0,12 нг/мл в 1-й день и повышался в зависимости от времени до 1,35 нг/мл в 7-й день (, рис. 4, ). Таким образом, мы можем заключить, что продукты, секретируемые ГЦ-индуцированными ИПСК и ЭСК крысы, дифференцируются в ГЦ-подобные клетки и секретируют Е2.

Рисунок 4

Индукция секреции Е2 из крысиных ИПСК и ЭСК, совместно культивируемых с клетками ГК Концентрации  Е2 (нг/мл) культурального супернатанта из крысиных иПСК и ЭСК, совместно культивируемых с ГК, измеряли с помощью радиоиммуноанализа в 1-й день. , 5 и 7.Рисунок 4 1, 5 и 7.

Обсуждение

Пациентов с ПНЯ можно лечить экзогенной заместительной терапией эстрогенами; однако их уровень эстрогена не может поддерживаться в пределах нормального физиологического диапазона in vivo .Эндогенный эстроген в основном секретируется ГК растущего фолликула. Стволовые клетки обеспечивают новую стратегию лечения POF с трансплантацией производных GC для секреции E2. Канг и др. [9] подтвердили, что иПСК мыши могут дифференцироваться в функциональные GC-подобные клетки и могут синтезировать и секретировать эстроген in vitro . В этом исследовании мы использовали новый подход для изучения дифференцировки ИПСК и ЭСК крысы в ​​GC-подобные клетки. Результаты иммуноокрашивания показали повышение экспрессии FSHR в иПСК и ЭСК, совместно культивируемых с ГК.Радиоиммуноанализ проводили для анализа уровня Е2 в культуральном супернатанте совместно культивируемых крысиных ИПСК и крысиных ЭСК. Уровни E2 были значительно повышены в группах совместного культивирования крысиных ИПСК и крысиных ЭСК. Напротив, уровни E2 были обратными в GCs, культивируемых отдельно. Эти результаты показали, что крысиные ИПСК и крысиные ЭСК дифференцировались в GC-подобные клетки во время совместного культивирования с GC.

в настоящее время некоторые маркерные гены, включая BMP15 , FMR1 , INCA , FSHR , AMH , NOBOX , FoxO3 , EIF2B , Figla , и GDF9 были сообщается об участии в развитии POF [10–18].В настоящее время прогнозирование ПЯН основывается на общепринятых биохимических маркерах [ФСГ, Е2, ингибин В или антимюллеровский гормон (АМГ)], которые подтверждают диагноз, на который указывают нарушения менструального цикла. AMH , BMP15 и GDF9 являются членами надсемейства трансформирующих факторов роста-β, которые экспрессировались в фолликулах яичников либо ооцитами, либо GCs [19]. Ген BMP15 кодирует фактор роста и дифференцировки ооцитов, который участвует в развитии фолликулов в качестве критического регулятора многих процессов GC [11].Эти результаты могут свидетельствовать о том, что гапло-недостаточность BMP15 как первого сцепленного с Х-хромосомой гена может играть определяющую роль в возникновении дисгенезии яичников. Ген BMP15 кодирует препропротеин, состоящий из сигнального пептида, прорайона и зрелого домена, который может образовывать гомо- или гетеродимеры с родственными факторами, такими как GDF9 [20]. Гомеобокс яичников новорожденных ( NOBOX ) кодирует два фактора транскрипции, специфичных для ооцитов, которые регулируют гены, уникальные для ооцитов. NOBOX представляет собой гомеобоксный ген, который имеет решающее значение для спецификации паттерна экспрессии генов, ограниченных ооцитами, включая GDF9 и BMP15 [21]. Делеция NOBOX у мышей с нокаутом ускоряет постнатальную потерю ооцитов с замещением фолликулов фиброзной тканью, что приводит к фенотипу, сходному с несиндромальной недостаточностью яичников у женщин. Таким образом, генов AMH , BMP15 , GDF9 и генов NOBOX являются взаимодействующими факторами в процессах POF.

FSHR является рецептором гликопротеинового гормона, принадлежащим к семейству GPCRs [13]. Вместе со своим связывающим гормоном ФСГ этот рецептор необходим для нормальной репродуктивной функции у обоих полов. Ингибин А ( INHA ) является еще одним геном-кандидатом для POF, учитывая его важную роль в регуляции функции яичников либо в качестве модулятора гипофизарного синтеза ФСГ, либо в качестве паракринного фактора [22]. Сообщается, что ФСГ и АМГ являются биохимическими маркерами ПНЯ.

Castrillon и др. .[23] обнаружили, что самки мышей с нокаутом FOXO3 демонстрируют заметное возрастное снижение репродуктивной способности из-за преждевременного развития фолликулов, приводящего к гибели ооцитов и раннему истощению фолликулов, что приводит к бесплодию. Ген EIF2B играет важную роль в синтезе белка, и его регуляция в различных стрессовых условиях предотвращает накопление денатурированных белков во время клеточного стресса. Следовательно, его дисфункция могла быть ответственна за повышенный апоптоз фолликулов яичников, но ни одна из известных мутаций в генах EIF2B , как гомозиготных, так и гетерозиготных, не была обнаружена у пациенток с изолированной 46, XX ПНЯ [16].Также сообщалось, что гены FMR1 и FIGLA имеют определенную связь с возникновением POF, но не участвуют непосредственно в развитии клеток GC и регуляции овуляции [10,17]. Гены EIF2B и FOXO3 значительно активировались в совместно культивируемых ИПСК и слабо активировались в совместно культивируемых ЭСК. Ген FMR1 повышал уровень экспрессии в совместно культивируемых ИПСК, но не изменялся в совместно культивируемых ЭСК. Ген FIGLA активировался в совместно культивируемых ЭСК, но подавлялся в совместно культивируемых ИПСК.

Наши результаты подтвердили, что ИПСК крысы и ЭСК крысы могут давать функциональные GC-подобные клетки, которые могут синтезировать и секретировать эстрогены in vitro и экспрессировать специфический рецептор FSHR клеток GC, но необходимы дополнительные данные, чтобы подтвердить, действительно ли эти клетки, индуцированные из ИПСК и ЭСК крысы, являются именно ГК. ИПСК крысы и крысиные ЭСК демонстрируют сходные изменения во время совместного культивирования с GCs в морфологии, функции и экспрессии генов. В наших результатах гены AMH , BMP15 , GDF9 , NOBOX , FSHR и INHA значительно активизировались в клетках, совместно культивируемых ИПСК и ЭСК. и значительно повышенные уровни экспрессии указывают на то, что эти гены могут быть генами-кандидатами для предсказания POF в соответствии с их функцией.Однако функции генов FMR1, FOXO3 , EIF2B и FIGLA , а также подробные молекулярные механизмы, лежащие в основе дифференцировки ИПСК и ЭСК крысы в ​​GC-подобные клетки, до сих пор неясны.

В заключение, эти результаты могут дать очень полезные подсказки для понимания процесса ПНЯ и выбора наиболее полезных генов-кандидатов для предсказания ПНЯ. Мы создали доступную модель для исследования процесса POF; однако перед клиническим применением этого метода необходимо преодолеть множество препятствий.

Финансирование

Эта работа была поддержана грантом Национального фонда естественных наук Китая (30971682).

Благодарности

Мы благодарим доктора Лей Сяо (Исследовательский центр стволовых клеток и биологии развития, Колледж наук о животных, Чжэцзянский университет, Ханчжоу, Китай) за техническую помощь и ценные комментарии к этой рукописи.

Каталожные номера

1.

Механизмы преждевременной недостаточности яичников

,

Ann Endocrinol

,

2003

, том.

64

 (стр. 

87

92

)2,  ,  ,  ,  .

Генетические аспекты преждевременной недостаточности яичников: обзор литературы

283

 (стр. 

635

643

)3,  .

Создание в культуре плюрипотентных клеток из эмбрионов мышей

,

Nature

,

1981

, vol.

292

 (стр. 

154

156

)4,  ,  ,  ,  ,  ,  , и др.

Архив индуцированных ENU мутантов для нацеливания генов у крыс

,

Nat Genet

,

2008

, vol.

40

 (стр. 

514

515

)5,  .

Индукция плюрипотентных стволовых клеток из культур эмбриональных и взрослых фибробластов мыши с помощью определенных факторов

126

 (стр. 

663

676

)6,  ,  ,  ,  ,  .

Роль взаимодействия гранулезы и тека-клеток в созревании фолликулов яичников

69

 (стр. 

450

458

)7,  ,  ,  ,  ,  ,  , и др.

Дифференцировка in vitro эмбриональных стволовых клеток крысы в ​​функциональные кардиомиоциты

,

Cell Res

,

2011

, vol.

21

 (стр. 

1316

1331

)8,  ,  ,  ,  ,  ,  , и др.

Создание линий индуцированных плюрипотентных стволовых клеток из клеток взрослых крыс

4

 (стр. 

11

15

)9,  ,  .

Секреция эстрогена индуцированными мышами плюрипотентными стволовыми клетками, совместно культивируемыми с клетками гранулезы яичников in vitro

35

 (стр. 

871

874

)10,  ,  ,  ,  ,  ,  , и др.

Изучение основных этапов репродуктивного старения у женщин-носителей премутации FMR1

,

Hum Reprod

,

2007

, vol.

22

 (стр. 

2142

2152

)11,  ,  ,  ,  ,  ,  , и др.

Ооцит и его роль в регуляции скорости овуляции: новая парадигма в репродуктивной биологии

,

Репродукция

,

2004

, том.

128

 (стр.

379

386

)12,  ,  .

Мутационный анализ зрелой пептидной области генов ингибина у индийских женщин с недостаточностью яичников

,

Hum Reprod

,

2004

, том.

19

 (стр. 

1760

1764

)13,  .

Мутации гонадотропинов и рецепторов гонадотропинов: выяснение физиологии и патофизиологии гипофизарно-гонадной функции

21

 (стр.

551

583

)14.

NOBOX правильно влияет на фолликулярный резерв: понимание преждевременной недостаточности яичников

28

 (стр. 

567

568

)15,  ,  ,  ,  ,  ,  .

Анализ мутации FOXO3 у 114 китайских женщин с преждевременной недостаточностью яичников

,

Reprod Biomed Online

,

2010

, vol.

20

 (стр. 

499

503

)16,  ,  ,  ,  ,  ,  .

Скрининг известных мутаций в генах EIF2B у большой группы пациенток с преждевременной недостаточностью яичников

4

стр.

8

 17,  ,  ,  ,  ,  ,  , и др.

Фактор транскрипции FIGLA мутирован у пациенток с преждевременной недостаточностью яичников

82

 (стр. 

1342

1348

)18,  ,  ,  ,  ,  .

Анализ мутации GDF9 у 100 китайских женщин с преждевременной недостаточностью яичников

,

Fertil Steril

,

2007

, том

88

 (стр. 

1474

1476

)19,  ,  ,  .

Система костных морфогенетических белков в репродукции млекопитающих

,

Endocr Rev

,

2004

, vol.

25

 (стр. 

72

101

)20,  ,  .

Генетический анализ надсемейства бета-трансформирующих факторов роста млекопитающих

,

Endocr Rev

,

2002

, vol.

23

 (стр. 

787

823

)21,  ,  ,  ,  .

Дефицит NOBOX нарушает ранний фолликулогенез и экспрессию генов, специфичных для ооцитов

305

 (стр. 

1157

1159

)22,  ,  ,  ,  ,  ,  , и др.

Ингибин: ген-кандидат преждевременной недостаточности яичников

,

Hum Reprod

,

2000

, vol.

15

 (стр. 

2644

2649

)23,  ,  ,  ,  .

Подавление активации фолликулов яичников у мышей фактором транскрипции Foxo3a

,

Science

,

2003

, vol.

301

 (стр. 

215

218

)

© Автор 2013.Опубликовано редакцией ABBS совместно с Oxford University Press от имени Института биохимии и клеточной биологии Шанхайского института биологических наук Китайской академии наук.

миР-132 активируются при синдроме поликистозных яичников и ингибируют жизнеспособность клеток гранулезы путем нацеливания на Foxa1

Введение

Синдром поликистозных яичников (СПКЯ) является одним из наиболее распространенными эндокринными метаболическими нарушениями, поражающими 5–10% женщин репродуктивного возраста во всем мире (1,2).Это обычно характеризуется гиперандрогенией, поликистозом яичников и ановуляция; однако это также связано с метаболическими дисфункция, риск сердечно-сосудистых заболеваний, аномальные клетки гранулезы (GC) пролиферация и остановка роста фолликулов (3,4). клинические симптомы и признаки СПКЯ включают отсутствие или нерегулярность менструации, трудности с зачатием, прыщи и толстые, темные и гладкие участки кожи (5). Генетические факторы и факторы окружающей среды играют важную роль в патогенез СПКЯ; однако основные молекулярные механизмы еще предстоит полностью выяснить (6).

МикроРНК (миРНК или миР) представляют собой малые некодирующие РНК. которые негативно регулируют экспрессию генов, кодирующих белок, через РНК сайленсинг и посттранскрипционная регуляция (7,8). Исследования показали, что аберрантная экспрессия микроРНК связанные с патологическим прогрессированием различных заболеваний, включая рак, метаболические заболевания, воспаления и репродуктивные расстройства (8–10). Однако функция и основная молекулярные механизмы микроРНК в развитии фолликулов и в Развитие СПКЯ до конца не выяснено.

миР-132, расположенная в интроне некодирующего гена на хромосоме 17 у людей, как сообщается, играет дифференциальную роли в различных заболеваниях, таких как сосудисто-эндотелиальная воспаление, гестационный сахарный диабет и пародонтит (9–11). Недавно было продемонстрировано, что миР-132 может опосредовать инициацию и развитие опухоли, регулируя пролиферация раковых клеток, апоптоз, инвазия и миграция (12,13). Кроме того, Ву и др. (14) показали, что миР-132 стимулировал синтез эстрадиола в GCs яичников посредством трансляционного репрессия члена 2 группы А подсемейства 4 ядерных рецепторов.Однако роль и основные механизмы миР-132 в СПКЯ остаются неясными. Поэтому целью настоящего исследования было определить, участвует ли миР-132 в аномальной жизнеспособности ГК от пациентов с СПКЯ и для выяснения потенциального лежащие в основе механизмы.

Материалы и методы
Пациенты и образцы

Исследуемая популяция состояла из женщин, Центр репродуктивной медицины женщин и младенцев Шаньси Госпиталь (Тайюань, Китай) с июня 2016 г. по декабрь 2016 г.Все субъекты были этническими ханьцами из провинции Шаньси в Северном Китае. Исследование было одобрено Комитетом по этике Shanxi Women and Этика больницы для младенцев (утверждение № 2011), а также все участники подписали письменное информированное согласие на участие в эта учеба. Образцы крови и фолликулярной жидкости были получены от 26 пациентов с СПКЯ и 30 здоровых контролей. Диагностика СПКЯ был основан на Роттердамских критериях (15), включая олигоовуляцию и/или ановуляция, избыточная активность андрогенов и ультразвуковое изображение поликистозные яичники.Пациентки с эндометриозом, врожденным надпочечниковым гиперплазия, гипотиреоз, андрогенсекретирующие опухоли, болезнь Кушинга синдром и другие системные заболевания были исключены из исследования. Контрольную группу составили пациентки с регулярным менструальным циклом. бесплодие в результате трубных факторов (прежде всего трубная непроходимость нарушение перистальтики маточных труб) и/или мужские факторы (включая тяжелая олигоспермия и тяжелая астеноспермия). Все участники согласие на эндокринные тесты и другие плановые проверки, а также результаты приведены в Таблице I.

Таблица I.

Характеристики пациентов с СПКЯ (n=26) и контрольная группа (n=30).

Таблица I.

Характеристики пациентов с СПКЯ (n=26) и контрольная группа (n=30).

Характеристика Группа СПКЯ Контрольная группа Значение P
Возраст, лет 29,86±2.81 30.11 ± 2.95 0.75
BMI 23.74 ± 3.36 21.84 ± 3.02 0.03 0.03
Бесплодие длительность, лет 4,42 ± 2,76 4,78 ± 2,99 0,64
ФСГ, мМЕ / мл 6,79 ± 2,18 6,96 ± 1,92 0,76
ЛГ, мМЕ / мл 9,53 ±6,48 4,37±2,11 <0,001
E 2 , пг/мл 51.12 ± 14,77 47,96 ± 19,98 0,51
ПРЛ, нг / мл 14,13 ± 6,48 14,41 ± 6,26 0,87
ТЭС, нг / дл 1,14 ± 0,39 0,44 ±0,17 <0,001
Контролируемая гиперстимуляция яичников протокол

Как пациенты с СПКЯ, так и контрольные пациенты получили экстракорпоральное оплодотворение и перенос эмбрионов лечения, следуя стандартной процедуре операции.Все женщины прошла контролируемую гиперстимуляцию яичников гонадотропином Начат длинный протокол агониста высвобождающего гормона гипофиз подавление ацетатом лейпролида (диферелин 0,1 мг; GenSci Company) в дозе 0,05 мг/сут в миллютеиновую фазу предыдущий цикл. Полное угнетение гипофиза было подтверждено уровень сывороточного фолликулостимулирующего гормона (ФСГ) <5 мМЕ/мл, уровень лютеинизирующего гормона (ЛГ) <5 мМЕ/мл, эстрадиол (E2) уровень <50 пг/мл, двусторонний антральный фолликул диаметр <5 мм, толщина эндометрия ≤5 мм.Урофоллитропин (ЛИВЗОН) применяли в дозах от 75 МЕ/день до 300 МЕ/сут в зависимости от возраста пациента, индекса массы тела, размера и количество антральных фолликулов и базовый уровень ФСГ в сыворотке крови. Дозировка уровень урофоллитропина корректировали в зависимости от реакции яичников, что оценивали по УЗИ и уровням Е2 в сыворотке. Раствор рекомбинантного человеческого хориогонадотропина-альфа (ХГЧ; Merck Serono SpA) вводили подкожно в дозе 250 мкг. уровне, когда по крайней мере два фолликула со средним диаметром ≥18 мм были обнаружено.Забор яйцеклеток проводился под руководством трансвагинальное УЗИ через 34-36 ч после инъекции ХГЧ. Человек Одновременно были получены ГК из фолликулярной жидкости.

Культура клеток

После забора ооцитов все фолликулярные жидкости из каждого пациента объединяли и хранили в пробирке. ГК были подготовлены и культивированы, как описано ранее (16). Вкратце, аспирированный фолликулярный жидкость центрифугировали при 1000×g в течение 10 мин при 37°C после удаления ооцитов. Осадок клеток ресуспендировали в 1 мл фосфата буферный раствор (PBS).Затем суспензию наслаивали на 1 мл фиколла и центрифугировали при 800×g в течение 30 мин при 37°С. ГК были аспирировали с интерфейса и несколько раз промывали PBS. Следующий, выделенные и очищенные ГК (1×105) культивировали в Модифицированная Дульбекко среда Игла/питательная смесь Среда для ветчины F12 (DMEM/F12; Invitrogen; Thermo Fisher Scientific, Inc.) с 10% эмбриональная бычья сыворотка (FBS; TBD), 100 мкг/мл пенициллина и 0,1 мг/мл стрептомицин (MRC) при 37°C с 5% CO2 и 95% влажность.

Трансфекция клеток

Линия клеток гранулезоподобной опухоли человека, клетки KGN, которые имеют физиологические характеристики клеток яичников, были приобретены из Американской коллекции типовых культур.ГК (1×105) выращивали в среде DMEM/F12 с 10% FBS при 37°C с 5% CO2 и 95% влажности. Мимика miR-132 (каталожный номер 219600), ингибитор (кат. № 219300) и отрицательный контроль (NC; кат. нет. 1022076) были разработаны и синтезированы Qiagen, Inc. Forkhead бокс-белок A1 (Foxa1) — малая интерферирующая (si)РНК (каталожный номер A10001), контрольные миРНК (si-NC; кат. № A06001) были сконструированы и синтезировано Shanghai GenePharma Co., Ltd. Клетки высевали в 6-луночные планшеты (2×105 клеток/лунку) за 1 день до трансфекции до достижения конфлюэнтности 90%, а затем среду заменяют средой, не содержащей сыворотки и антибиотиков.Затем миР-132 миметик, ингибитор miR-132 и si-Foxa1 трансфицировали на заключительном этапе концентрация 50 нМ с использованием реагента Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) после протоколы производителя. Через 36 ч после трансфекции клетки собраны для следующих анализов.

Анализ жизнеспособности клеток

Жизнеспособность клеток оценивали с помощью счетчика клеток Метод Kit-8 (CCK-8). Чтобы изучить влияние миР-132 и Foxa1 на жизнеспособности клетки, трансфицированные миРНК или миРНК, высевали в 96-луночные планшеты по 5×103 клеток/лунку.Жизнеспособность клеток была выявляется через 24, 48 и 72 ч после трансфекции с использованием CCK-8 при 45 нм в соответствии с инструкциями производителя (Beyotime Institute of Биотехнология) при 37°С в течение 4 часов.

Анализ TUNEL

Апоптоз ГК определяли окрашиванием TUNEL с помощью набора для обнаружения клеточного апоптоза TUNEL (Nanjing KeyGen Biotech Co., Ltd.) в соответствии с протоколом производителя. ГК (1×104) культивировали непосредственно на покровных стеклах. В дальнейшем ГХ фиксировали в 4% параформальдегиде при 4°С в течение 25 мин, а затем трижды отмывали в PBS.Клетки инкубировали в 50 мкл пермеабилизирующего раствора (0,2% Triton X-100) на 5 мин при комнатной температура. Затем ГХ переносили в 50 мкл реакционной смеси TUNEL. смеси (45 мкл равновесного буфера + 5 мкл смеси нуклеотидов + 1 мкл TdT) и инкубировали во влажной камере в течение 60 мин в темнота при 37°С. Реакцию останавливали инкубацией ГХ в 2X буфер SSC в течение 15 мин при комнатной температуре. Тогда клетки были три раза промывали PBS/PVP. Затем клетки обрабатывали с 0.5 мкг/мл РНКазы без ДНКазы. Изображения были сняты с помощью Микроскоп BX40 (BX40; Olympus Corporation). охристый (обморочный желтый) ядро ​​указывает на TUNEL-положительные клетки. Всего пять поля (увеличение, ×200) брались случайным образом для каждого образца. Данные представлены в виде процента TUNEL-положительных клеток среди общее количество клеток. Каждый эксперимент проводился в тройной. Клетки отрицательного контроля подвергали TUNEL. анализ без добавления терминальной дезоксинуклеотидилтрансферазы в реакционной смеси.Клетки положительного контроля инкубировали с 100 мкл раствора ДНКазы I перед анализом TUNEL для индукции ДНК деградация прядей.

Выделение РНК и реверсирование анализ транскрипционно-количественной ПЦР (RT-qPCR)

Суммарная РНК GC была выделена с использованием Комплект RNeasy/miRNeasy Mini (Qiagen Benelux BV), согласно инструкции производителя. Тотальную РНК (2 нг) использовали для обратного транскрипция с использованием набора OneStep RT-PCT (Qiagen Benelux BV), следуя инструкциям производителя.Праймеры для миР-132 были точной последовательностью зрелой миР-132. U6 использовался как внутренний контроль. Праймеры были приобретены у Qiagen Benelux. БВ. Условия термоциклирования микроРНК были следующими: 95°С. в течение 15 мин, затем 95°С в течение 15 с и 60°С в течение 1 мин (40 циклы). Для экспрессии мРНК Foxa1 использовали GAPDH в качестве внутренний контроль. Последовательности праймеров для Foxa1 и GAPDH были следующими: следующим образом: смысл Foxa1, 5′-AGGGCTGGATGGTTGTATTG-3′ и антисмысловой, 5′-GCCTGAGTTCATGTTGCTGA-3′; смысл GAPDH, 5′-GAAGGTGAAGGTCGGAGTC-3′ и антисмысловой, 5′-GAAGATGGTGATGGGATTTC-3′.термоциклирование условия для Foxa1 были следующими: 95°C в течение 5 мин; 35 циклов 95°С в течение 1 мин, 60°С в течение 1 мин и 72°С в течение 1 мин; а потом 72°С в течение 7 мин. RT-qPCR проводили в трех повторностях с использованием SYBR® Premix Ex Taq Kit (Takara Bio, Inc.), согласно протокол производителя в системе ПЦР в реальном времени CFX96 (Био-Рад Лабораториз, Инк.). Все реакции проводили в трехкратной повторности. а экспрессию генов определяли с помощью 2-∆∆Cq метод (17).

Репортерный анализ с двойной люциферазой
Было предсказано, что

Foxa1 станет мишенью для миР-132. онлайн база данных TargetScanHuman 7.1 (www.targetscan.org; Институт биомедицинских исследований Уайтхеда). Исследование). Затем этот фрагмент встраивали в люциферазу pGL3. промоторный вектор (Promega Corporation) для разработки Векторы Luc-pGL3-Foxa1-3’UTR и Luc-pGL3-Foxa1-mut-3’UTR. Клетки (1×105) в 24-луночных планшетах котрансфицировали Вектор Luc-pGL3-Foxa1-3’UTR или Luc-pGL3-Foxa1-mut-3’UTR и миР-132 миметиков или miR-NC с использованием реагента Lipofectamine 2000 в соответствии с инструкции производителя. Люцифераза Renilla репортерный вектор трансфицировали в качестве внутреннего контроля в каждом проба.Через 48 ч после трансфекции светлячок и Renilla Активность люциферазы определяли с помощью двойного люциферазного репортерная система (Promega Corporation). Результаты выражаются как относительная активность люциферазы (Firefly/Renilla). Все опыты проводились трижды в трехкратной повторности.

Вестерн-блоттинг

Вестерн-блоттинг был выполнен для оценки экспрессия Foxa1. Вкратце, клетки собирали и лизировали на лед в лизирующем буфере RIPA (Beyotime Institute of Biotechnology) с ингибитор протеазы, согласно инструкции производителя.Концентрацию белка в клеточных лизатах определяли с помощью Набор BCA (Wuhan Boster Biological Technology Co., Ltd.). Равный количества белковых лизатов (30 мкг на дорожку) разрешались на 10% SDS-PAGE, а затем электроперенос на мембраны PVDF (EMD Миллипор). Мембраны блокировали ТБС с 0,1% Твин-20. (TBST)_содержащий 5% обезжиренного молока в течение 2 ч при комнатной температуре, и затем инкубировали со специфическими антителами при 4°C в течение ночи, включая мышиный анти-Foxa1 (1:1000; кат. № ab40868), мышиный анти-Бакс (1:1000; кат.нет. ab3191), мышиное анти-Bcl-2 (1:1000; Кот. нет. ab692) и мышиное анти-GAPDH (1:200; № по каталогу ab8245) моноклональные антитела (оба от Abcam). После промывки TBST, мембраны дополнительно инкубировали с HRP-конъюгированным козьим антимышиный IgG (1:2000; кат. № BA1051; Wuhan Boster Biological Technology Co., Ltd.) при 37°С в течение 1 ч с последующей визуализацией. с набором ECL (Nanjing KeyGen Biotech Co., Ltd.). белок уровни экспрессии были полуколичественно определены с использованием программного обеспечения Quantity One. (версия 4.6.7; Био-Рад Лабораториз, Инк.).

Статистический анализ

Все статистические анализы проводились с использованием GraphPad Prism 6.0 (программное обеспечение GraphPad, Inc.). Нормально распределенный данные представлены как среднее ± стандартная ошибка среднего. К Проверить нормальность распределения можно с помощью теста Шапиро-Уилка. выполнено. Двусторонний критерий Стьюдента был выполнен для сравнения средних значений двух групп; однофакторный дисперсионный анализ (с последующим апостериорным тестом Бонферрони) использовали для определения различия между средними значениями нескольких групп, потому что количественные данные следовали нормальному распределению.Р<0,05 был расценивается как указание на статистически значимое различие.

Результаты
Характеристики пациента

Характеристика пациенток с СПКЯ группа и контрольная группа представлены в Таблице I. Всего 26 пациентов с СПКЯ были набраны из пациентов, обращающихся за репродуктивной помощью в Центр репродуктивной медицины больницы Шаньси для женщин и младенцев. Каждый пациент с СПКЯ был подтвержден клинически. Всего 16 случаев трубного бесплодия и 14 случаев бесплодия, связанного с мужские факторы были включены в качестве контроля для этого исследования.Не было значительная разница между СПКЯ и контрольной группой относительно возраста, продолжительности бесплодия и уровня ФСГ, Е2 и ПРЛ. Однако, по сравнению с контрольной группой, ИМТ, а уровни ЛГ и ТЭС были значительно повышены в группа СПКЯ (P<0,05)

Экспрессия
миР-132 повышается в ГК человека от пациентов с СПКЯ

RT-qPCR была проведена для обнаружения экспрессии миР-132 в ГК 26 пациентов с СПКЯ и 30 контрольных. По сравнению с в контроле экспрессия миР-132 была значительно повышена в ГК пациентов с СПКЯ (P<0.05; Рисунок 1).

Апоптоз увеличивается в ГК из пациенты с СПКЯ

Чтобы определить скорость апоптоза GC при СПКЯ, клетки культивировали непосредственно на покровных стеклах и окрашивали TUNEL. набор для обнаружения клеточного апоптоза. Значительно увеличилось количество апоптотические ядра присутствовали в группе СПКЯ по сравнению с контрольная группа (P<0,05; рис. 2А и Б).

миР-132 негативно регулирует клетки рост и жизнеспособность в ГХ

Отметив значительно более высокую экспрессию миР-132 в СК яичников пациенток с СПКЯ было предположили, что миР-132 может быть связана с ростом и жизнеспособность ГК.Поэтому ГК трансфицировали миР-132. миметики и ингибитор миР-132, а также относительная экспрессия миР-132 был проверен (рис. 3A и B). Так как показан на рис. 3C, анализ CCK-8 показали, что снижение экспрессии миР-132 в GC способствует жизнеспособность (Р<0,05). В отличие от миметиков miR-132, Ингибитор миР-132 стимулировал рост клеток (P<0,05; рис. 3C). Для дальнейшего определения роли миР-132 в клеточном апоптозе ГК человека, использовали вестерн-блоттинг для определения уровней экспрессии белков Bax и Bcl-2. результаты показали, что миметики miR-132 значительно увеличивали Bax экспрессия белка и сниженная экспрессия белка Bcl-2 при по сравнению с контрольной группой. Принимая во внимание, что ингибитор миР-132 значительно повышал экспрессию белка Bcl-2 и снижал экспрессию белка Bax по сравнению с контрольная группа (P<0,05; рис. 3D и Е).

миР-132 напрямую ингибирует Foxa1 экспрессия путем связывания с его 3’UTR
Было предсказано, что

Foxa1 станет мишенью для миР-132. онлайн база данных TargetScanHuman 7.1 (www.targetscan.org), с последовательностью GACUGUUA в 3’UTR является предполагаемым сайтом связывания (фиг. 4А). Значительное подавление Экспрессия Foxa1 была обнаружена с помощью RT-qPCR в человеческих GC от пациентов с СПКЯ (P<0,05; рис. 4Б). Затем были проведены RT-qPCR и вестерн-блоттинг для наблюдения за экспрессия Foxa1 на уровне мРНК и белка в GCs трансфицировали миметиками miR-132 и ингибитором. По сравнению с контрольная группа, после активации миР-132, мРНК и уровни белка Foxa1 были значительно снижены.В то время как, после подавления миР-132, мРНК Foxa1 и белка уровни были значительно повышены (P<0,05; рис. 4C, D и F). Для дальнейшей демонстрации был ли Foxa1 прямой мишенью миР-132, 3'UTR Foxa1 был клонирован в репортерный вектор люциферазы и предполагаемую миР-132 Сайт связывания в 3'UTR Foxa1 был мутирован (фиг. 4Е). По сравнению с контрольной группой, Сверхэкспрессия миР-132 подавляла активность люциферазы репортерный вектор с Foxa1-WT; тогда как нокдаун миР-132 увеличился люциферазная активность вектора WT.Кроме того, люцифераза активность вектора MUT в ГК не подвергалась влиянию миР-132 гиперэкспрессия или нокдаун (рис. 4Е). В совокупности эти данные свидетельствуют о том, что ген Foxa1 является прямой мишенью сверхэкспрессии миР-132, которая ингибирует Foxa1 выражение в ГК.

Анализ цитотоксичности сайленсинга Foxa1in человека GCs

Для изучения функции Foxa1 в GC, Foxa1 экспрессия была подавлена ​​siRNA в человеческих GC по сравнению с контролем пациенты. RT-qPCR и вестерн-блоттинг показали, что мРНК и уровни белка Foxa1 были значительно снижены через 24 часа в ГК, трансфицированные Foxa1-siRNA (P<0.05; Рис. 5А-С). Затем определение жизнеспособности клеток была проведена для оценки влияния Foxa1-siRNA на ГК человека. Как и ожидалось, GC, трансфицированные миРНК Foxa1, демонстрировали сниженный уровень клеток. жизнеспособность по сравнению с si-NC через 48 ч после трансфекции (P<0,05; Рис. 5D). Эти результаты показали что замалчивание Foxa1 ингибирует рост человеческого GC.

Гиперэкспрессия Foxa1 изменяет подавляющий эффект миметиков миР-132

Для дальнейшего определения роли миР-132 на клетке жизнеспособность за счет прямого нацеливания на Foxa1 в человеческих GCs, клетках трансфицировали pcDNA3.Имитаторы 1-Foxa1 или miR-132. Как показано в Рис. 6А, сверхэкспрессия Foxa1. с помощью pcDNA3.1-Foxa1 значительно увеличивал экспрессию Foxa1 у человека ГК по сравнению с контрольной группой переносчиков (P<0,05). ингибирующий эффект миметиков миР-132 на экспрессию Foxa1 был частично реверсируется гиперэкспрессией Foxa1. Впоследствии было обнаружили, что подавление жизнеспособности клеток после трансфекции с миметиками миР-132 была ослаблена гиперэкспрессией Foxa1 у человека. ГК (P<0,05; рис. 6B).

Обсуждение

Цель настоящего исследования состояла в том, чтобы изучить, миР-132 была вовлечена в аномальную жизнеспособность ГК у пациентов. с СПКЯ и для выяснения основных механизмов.Это было наблюдали, что экспрессия миР-132 была значительно увеличена в ГК у пациентов с СПКЯ. Кроме того, результаты выявили что снижение экспрессии миР-132 было связано с повышенный индекс клеточного апоптоза ГК у пациентов с СПКЯ. Более того, репортерный анализ с двойной люциферазой показал, что Foxa1 была прямой мишенью для miR-132 и способствовала жизнеспособности GC. Фокса1 сверхэкспрессия обращала вспять супрессивные эффекты миметиков miR-132. Таким образом, эти результаты указывают на то, что миР-132 подавляет клеточный жизнеспособность, и потенциальные основные механизмы связаны с нацеливанием и подавлением экспрессии Foxa1.

Предыдущие исследования показали, что миР-132 играет проапоптотическую роль в ряде типов рака, таких как глиома (18), колоректальный рак (19,20), остеосаркома (21), рак печени (22), рак молочной железы (23), опухоль гипофиза (24) и рак легкого (25). Кроме того, повышенная экспрессия миР-132 была обнаружена в периовуляторных мышиных GC после Лечение ЛГ/ХГЧ и усиленный синтез эстрадиола при ГК (14,26). Однако большое количество исследований миР-132 в первую очередь сосредоточены на раке, и механизмы, лежащие в основе роли миР-132 при СПКЯ еще не исследовалась.В меру наших известно, настоящее исследование было первым, в котором сообщалось, что миР-132 был вовлечен в ингибирование жизнеспособности клеток KGN, предполагая что миР-132 играет решающую роль в аномальной жизнеспособности GCs, что может привести к развитию СПКЯ.

Foxa1 представляет собой транскрипционный фактор, принадлежащий семейство forkhead, состоящее из ДНК-связывающего домена в виде крылатой спирали, и N-концевой и С-концевой транскрипционные домены, тем самым разграничение геномных областей и возможность последующего связывания других факторов транскрипции, таких как рецептор эстрогена, рецептор прогестерона и рецептор андрогена (27–29).Foxa1 экспрессируется в различных органах, включая молочные железы, печень, поджелудочной железы и простаты и может влиять на экспрессию большого количество генов, связанных с метаболическими процессами, регуляция передачи сигналов и клеточного цикла (30,31). Сообщалось, что Foxa1 является прямой мишенью миР-132 в рак молочной железы, рак щитовидной железы и рак носоглотки (32–34). В соответствии с вышеупомянутым результаты, настоящее исследование также продемонстрировало, что Foxa1 является прямая мишень миР-132 в жизнеспособности клеток KGN.Однако Санг и др. al (35), который идентифицировал микроРНК в фолликулярной жидкости человека у пациентов с СПКЯ, продемонстрировали, что миР-132 экспрессируется при значительно более низких уровни в фолликулярной жидкости пациентов с СПКЯ по сравнению с в здоровом контроле. Различия, вероятно, были вызваны разнообразие причин. Экспрессия миР-132 в вышеупомянутом исследовании измеряли в фолликулярной жидкости человека, тогда как в настоящем В ходе исследования экспрессию миР-132 исследовали в ГК человека. Кроме того, процесс регуляции пролиферации GC сложен и тесно связано с целым рядом факторов (36,37).

В заключение, результаты настоящего исследования продемонстрировали, что экспрессия миР-132 значительно увеличивается у пациентов с СПКЯ. Кроме того, гиперэкспрессия миР-132 ингибировала жизнеспособность клеток KGN путем нацеливания на Foxa1. Эти результаты предоставили новые доказательства дисрегуляции жизнеспособность ГК наблюдается при СПКЯ. В связи с ограничением в количество использованных образцов СПКЯ и типов клеток, дальнейшие исследования необходимы для того, чтобы полностью определить основные молекулярные механизмы миР-132 в POCS.

Благодарности

Не применимо.

Финансирование

Это исследование было поддержано Научным исследовательским Проект Департамента здравоохранения провинции Шаньси (грант No. 201601070), Фонд первоначальных научных исследований доктора философии в Шаньси Провинциальная народная больница (грант № b201635), Естественный Научный фонд Шаньси (грант № 201901D211519 и 201901D211546), Фонд естественных наук Шаньси (грант №. 201901D211546), исследовательский проект, поддерживаемый Шаньси Стипендиальный совет Китая (грант №.HGKY2019092) и Китай Постдокторский научный фонд (грант № 2020M670703).

Наличие данных и материалов

Наборы данных, использованные и/или проанализированные в течение текущего исследование доступно у соответствующего автора на разумных запрос.

Вклад авторов

XC и XJ написали рукопись и существенно вклад в дизайн настоящего исследования. XW, JL и XB способствовал интерпретации данных и написанию рукописи.Все авторы прочитали и одобрили окончательный вариант рукописи.

Одобрение этики и согласие на участвовать

Настоящее исследование было одобрено Этическим комитетом. Комитет по этике больниц Шаньси для женщин и младенцев (Тайюань, Китай; № утверждения 2011), и все участники подписали письменное информированное согласие на участие в данном исследовании.

Согласие пациента на публикацию

Не применимо.

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересы.

Каталожные номера

1

Линь Дж., Хуан Дж., Ван Н., Куан Й. и Цай Р.: Влияние индекса массы тела до беременности на беременность и перинатальный период исходы у женщин с СПКЯ, перенесших замороженные эмбрионы. БМК Беременность Роды. 19:4872019. Просмотр статьи : Академия Google : PubMed/NCBI

2

Ли С, Ци Дж, Тао И, Чжу Ц, Хуан Р, Ляо И, Yue J, Liu W, Zhao H, Yin H и Sun Y: повышенный уровень Метаболиты арахидоновой кислоты в фолликулярной жидкости пациентов с СПКЯ.Репродукция. 1 ноября–2019 г. (Epub перед печатью). дои: 10.1530/РЭП-19-0136.

3

Сагвекар П., Манголи В., Десаи С., Патил А. и Мукерджи С.: Гипометилирование CpG-ДНК LINE1 в клетках гранулезы и лейкоциты крови связаны с СПКЯ и родственными признаками. Дж Клин Эндокринол Метаб. 102: 1396–1405. 2017. Просмотр статьи: Google Scholar: PubMed/NCBI

4

Макриноу Э., Дронг А.В., Кристопулос Г., Лернер А., Чапа-Чорда И., Карадери Т., Лавери С., Харди К., Линдгрен CM и Franks S: Профилирование метилирования по всему геному в гранулезе лютеиновые клетки женщин с синдромом поликистозных яичников (СПКЯ).Мол Клеточный эндокринол. 500:1106112019. Просмотр статьи : Академия Google : PubMed/NCBI

5

Цю С, Вэй И, Лю С, Дин С и Чжао С: Гиперандроген усиливает апоптоз гранулезных клеток яичников человека посредством повышающей регуляции и деметилирования PDCD4. Гинекол Эндокринол. 36:333–337. 2019. Просмотр статьи: Google Scholar: PubMed/NCBI

6

Li Y, Liu YD, Zhou XY, Chen SL, Chen X, Zhe J, Zhang J, Zhang QY и Chen YX: МиР-29а регулирует пролиферация, экспрессия ароматазы и биосинтез эстрадиола клетки гранулезы человека при синдроме поликистозных яичников.Мол Ячейка Эндокринол. 498:1105402019. Просмотр статьи : Академия Google : PubMed/NCBI

7

Сун И, Ю Г, Сян И, Ли И, Ван Л и Тан L: измененные миР-186 и миР-135a вносят вклад в клетки гранулезы. дисфункция путем нацеливания на ESR2: возможная роль в поликистозе яичников синдром. Мол Селл Эндокринол. 494:1104782019. Просмотр статьи : Академия Google : PubMed/NCBI

8

Chen B, Xu P, Wang J и Zhang C: роль микроРНК при синдроме поликистозных яичников (СПКЯ).Ген. 706:91–96. 2019. Просмотр статьи: Google Scholar: PubMed/NCBI

9

Ван В, Ли С, Рен Л, Юань С, Хань И и Wang Z: МиР-132 снимает воспаление эндотелия сосудов и улучшают эндотелиальную функцию у крыс с атеросклерозом, регулируя СИРТ1. Минерва Эндокринол. 45:158–161. 2019. PubMed/NCBI

10

Хань И, Ван Ф, Шао Л, Хуан П и Сюй И: LncRNA TUG1 опосредует липополисахарид-индуцированную пролиферативную ингибирование и апоптоз клеток периодонтальной связки человека протирание миР-132.Acta Biochim Biophys Sin (Шанхай). 51:1208–1215. 2019. PubMed/NCBI

11

Чжоу Х, Сян С и Чжэн Х: миР-132 служит диагностическим биомаркером при гестационном сахарном диабете и его регулирующее влияние на жизнеспособность клеток трофобласта. Диагностика Патол. 14:11

. Просмотр статьи : Академия Google : PubMed/NCBI

12

Wei XC и Lv ZH: микроРНК-132 ингибирует миграции, инвазии и эпителиально-мезенхимального перехода через Сигнальный путь TGFβ1/Smad2 при раке мочевого пузыря человека.Цели Онко тер. 12: 5937–5945. 2019. Просмотр статьи: Google Scholar: PubMed/NCBI

13

Zhang XL, Sun BL, Tian SX, Li L, Zhao YC и Shi PP: микроРНК-132 устраняет резистентность к цисплатину и метастазирование рака яичников путем целенаправленной регуляции Bmi-1. Eur Rev Med Pharmacol Sci. 23:3635–3644. 2019. PubMed/NCBI

14

У С, Сунь Х, Чжан Ц, Цзян И, Фан Т, Цуй I, Yan G и Hu Y: микроРНК-132 способствует синтезу эстрадиола в клетки гранулезы яичников посредством трансляционной репрессии Nurr1.Репрод Биол Эндокринол. 13:942015. Просмотр статьи : Академия Google : PubMed/NCBI

15

Аззиз Р.: Споры в клинической эндокринология: Диагностика синдрома поликистозных яичников: Роттердамские критерии преждевременны. J Clin Endocrinol Metab. 91: 781–785. 2006. Просмотр статьи: Google Scholar: PubMed/NCBI

.

16

Каур С., Арчер К.Дж., Деви М.Г., Криплани А., Штраус Дж.Ф. III и Сингх Р.: Дифференциальная экспрессия генов в гранулезные клетки у пациентов с синдромом поликистозных яичников и без инсулинорезистентности: идентификация гена восприимчивости устанавливает с помощью сетевого анализа.J Clin Endocrinol Metab. 97:E2016–E2021. 2012. Просмотр статьи: Google Scholar: PubMed/NCBI

.

17

Ливак К.Дж. и Шмитген Т.Д.: Анализ данные об относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метод 2(-Delta Delta C(T)). Методы. 25:402–408. 2001. Просмотр статьи : Академия Google : PubMed/NCBI

18

Ли И, Чжан Дж, Хе Дж, Чжоу В, Сян Г и Xu R: МикроРНК-132 вызывает апоптоз клеток глиомы посредством блокады метаболического пути SREBP-1c, связанного с SIRT1.Биомед Фармацевт. 78:177–184. 2016. Просмотр статьи: Google Scholar: PubMed/NCBI

.

19

Мокутани Ю., Уэмура М., Мунаката К., Окудзаки Д, Харагути Н, Такахаши Х, Нисимура Дж, Хата Т, Мурата К, Такемаса I и др.: подавление микроРНК-132 связано с с неблагоприятным прогнозом колоректального рака. Энн Сург Онкол. 23 (Прил. 5): 599–608. 2016. Просмотр статьи: Google Scholar: PubMed/NCBI

.

20

Цинь Дж., Ке Дж., Сюй Дж., Ван Ф, Чжоу Й, Цзян Й и Wang Z: Понижающая регуляция микроРНК-132 за счет гиперметилирования ДНК. связано с инвазией клеток при колоректальном раке.Цели Онко тер. 8:3639–3648. 2015. PubMed/NCBI

.

21

Лю И, Ли И, Лю Дж, Ву И и Чжу Цюй: МикроРНК-132 ингибирует рост клеток и метастазирование при остеосаркоме клеточные линии, возможно, путем нацеливания на Sox4. Int J Oncol. 47: 1672–1684. 2015. Просмотр статьи: Google Scholar: PubMed/NCBI

.

22

Лэй СиДжей, Ли Л, Гао С, Чжан Дж, Пан Цюй, Лонг HC, Chen CZ, Ren DF и Zheng G: Hsa-miR-132 ингибирует пролиферацию клеток карциномы печени путем нацеливания на YAP.Клеточная биохимия Функц. 33:326–333. 2015. Посмотреть Статья : Google Scholar : PubMed/NCBI

23

Zhang ZG, Chen WX, Wu YH, Liang HF и Zhang BX: МиР-132 запрещает распространение, вторжение, миграцию и метастазирование рака молочной железы путем нацеливания на HN1. Биохим Биофиз Рез коммун. 454: 109–114. 2014. Просмотр статьи: Google Scholar: PubMed/NCBI

.

24

Renjie W и Haiqian L: МиР-132, МиР-15а и миР-16 синергически ингибируют опухолевые клетки гипофиза пролиферация, инвазия и миграция путем нацеливания на Sox5.Рак лат. 356: 568–578. 2015. Просмотр статьи: Google Scholar: PubMed/NCBI

.

25

Li Y, Zu L, Wang Y, Wang M, Chen P и Чжоу Q: миР-132 ингибирует миграцию и инвазию клеток рака легких нацелен на SOX4. Дж. Торак Дис. 7: 1563–1569. 2015. PubMed/NCBI

.

26

Fiedler SD, Carletti MZ, Hong X и Christenson LK: Гормональная регуляция экспрессии микроРНК в периовуляторные мышиные пристеночные гранулезные клетки.Биол Репрод. 79:1030–1037. 2008. Просмотр статьи: Google Scholar: PubMed/NCBI

.

27

Фу Х, Перейра Р, Де Анджелис С, Вирарагхаван Дж., Нанда С., Цинь Л., Катальдо М.Л., Сетхунатх В., Мехраваран С., Гутьеррес С. и др.: Активация FOXA1 способствует энхансер и перепрограммирование транскрипции у эндокринно-резистентных рак молочной железы. Proc Natl Acad Sci USA. 116:26823–26834. 2019. Просмотр статьи : Академия Google

28

Цзин С, Лян Х, Хао С, Хунся Л и Цуй X: анализ эпигенетического переключателя, участвующего в активации пионерский фактор FOXA1, ведущий к прогностической ценности эстрогена Коэкспрессия рецептора и FOXA1 при раке молочной железы.Старение. 11:7442–7456. 2019. Просмотр статьи: Google Scholar: PubMed/NCBI

29

Gou L, Zou H и Li B: Длинная некодирующая РНК Нокдаун MALAT1 ингибирует прогрессирование анапластической щитовидной железы карциному, регулируя миР-200a-3p/FOXA1. Рак Биол Тер. 20:1355–1365. 2019. Просмотр статьи: Google Scholar: PubMed/NCBI

30

Stone L: Драйв разных классов FOXA1 рак простаты.Нат Рев Урол. 16:5082019. Просмотр статьи : Академия Google

31

БенАйед-Гуерфали Д., Даббеш-Бурич Э., Аяди В., Трифа Ф., Чарфи С., Хабир А., Селлами-Будавар Т. и Mokdad-Gargouri R: Ассоциация маркеров FOXA1 и EMT (Twist1 и Е-кадгерин) при раке молочной железы. Mol Biol Rep. 46:3247–3255. 2019. Просмотр статьи : Академия Google : PubMed/NCBI

32

Ван Д., Рен Дж., Рен Х., Фу Д.Л. и Ю.Д.: МикроРНК-132 подавляет пролиферацию клеток при раке молочной железы человека путем прямого нацеливания на FOXA1.Акта Фармакол Син. 39:124–131. 2018. Просмотр статьи : Академия Google : PubMed/NCBI

33

Чен Х, Ли М, Чжоу Х и Чжан Л: miR-132 нацеливается на FOXA1 и оказывает подавляющее действие на опухоль в щитовидной железе. рак. Онкол Рез. 27:431–437. 2019. Просмотр статьи: Google Scholar: PubMed/NCBI

34

Li YL, Zhao YG, Chen B и Li XF: МикроРНК-132 повышает чувствительность клеток карциномы носоглотки к цисплатину посредством регуляции белка forkhead box A1.Аптека. 71:715–718. 2016. PubMed/NCBI

.

35

Сан Кью, Яо Зи, Ван Х, Фэн Р, Ван Х, Чжао С., Син Ц., Джин Л., Хе Л., У Л. и Ван Л.: Идентификация микроРНК в фолликулярной жидкости человека: характеристика микроРНК которые регулируют стероидогенез in vitro и связаны с синдром поликистозных яичников in vivo. J Clin Endocrinol Metab. 98:3068–3079. 2013. Просмотр статьи: Google Scholar: PubMed/NCBI

.

36

Кранц В., Будна Дж., Кахан Р., Чачула А., Брыя А., Чесёлка С.

Добавить комментарий

Ваш адрес email не будет опубликован.